Skip Navigation


Human Molecular Genetics Advance Access originally published online on November 27, 2007
Human Molecular Genetics 2008 17(5):747-758; doi:10.1093/hmg/ddm347
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
17/5/747    most recent
ddm347v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Talkowski, M. E.
Right arrow Articles by Nimgaonkar, V. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Talkowski, M. E.
Right arrow Articles by Nimgaonkar, V. L.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

A network of dopaminergic gene variations implicated as risk factors for schizophrenia

Michael E. Talkowski1,3, George Kirov4, Mikhil Bamne1, Lyudmila Georgieva4, Gonzalo Torres2, Hader Mansour1, Kodavali V. Chowdari1, Vihra Milanova5, Joel Wood1, Lora McClain1, Konasale Prasad1, Brian Shirts3, Jianping Zhang6, Michael C. O’Donovan4, Michael J. Owen4, Bernie Devlin1,3 and Vishwajit L. Nimgaonkar1,3,*

1 Department of Psychiatry and 2 Department of Neurobiology, University of Pittsburgh School of Medicine, Pittsburgh, PA, USA 3 Department of Human Genetics, University of Pittsburgh Graduate School of Public Health, Pittsburgh, PA, USA 4 Department of Psychological Medicine, Cardiff University, Heath Park, Cardiff, UK 5 Department of Psychiatry, Medical University, Sofia, Bulgaria and 6 Division of Clinical Pharmacology, Department of Molecular Pharmacology and Experimental Therapeutics, Mayo Medical School, Mayo Clinic, Rochester, MN, USA

* To whom correspondence should be addressed at: Department of Psychiatry, University of Pittsburgh School of Medicine, WPIC, Office 444, 3811 O’Hara Street, Pittsburgh, PA 15213, USA. Tel: +1 4122466353; Fax: +1 4122466350; Email: nimga{at}pitt.edu

Received September 15, 2007; Accepted November 26, 2007


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
We evaluated the hypothesis that dopaminergic polymorphisms are risk factors for schizophrenia (SZ). In stage I, we screened 18 dopamine-related genes in two independent US Caucasian samples: 150 trios and 328 cases/501 controls. The most promising associations were detected with SLC6A3 (alias DAT), DRD3, COMT and SLC18A2 (alias VMAT2). In stage II, we comprehensively evaluated these four genes by genotyping 68 SNPs in all 478 cases and 501 controls from stage I. Fifteen (23.1%) significant associations were found (p ≤ 0.05). We sought epistasis between pairs of SNPs providing evidence of a main effect and observed 17 significant interactions (169 tests); 41.2% of significant interactions involved rs3756450 (5' near promoter) or rs464049 (intron 4) at SLC6A3. In stage III, we confirmed our findings by genotyping 65 SNPs among 659 Bulgarian trios. Both SLC6A3 variants implicated in the US interactions were overtransmitted in this cohort (rs3756450, p = 0.035; rs464049, p = 0.011). Joint analyses from stages II and III identified associations at all four genes (pjoint < 0.05). We tested 29 putative interactions from stage II and detected replication between seven locus pairs (p ≤ 0.05). Simulations suggested our stage II and stage III interaction results were unlikely to have occurred by chance (p = 0.008 and 0.001, respectively). In stage IV we evaluasted rs464049 and rs3756450 for functional effects and found significant allele-specific differences at rs3756450 using electrophoretic mobility shift assays and dual-luciferase promoter assays. Our data suggest that a network of dopaminergic polymorphisms increase risk for SZ.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
The distribution of schizophrenia (SZ) in families and populations is consistent with a substantial genetic basis for the disorder. No obvious genetic model can explain the data, but models including multiple interacting loci conferring risk provide a good fit (1,2). The disorder is common, with an estimated lifetime morbid risk of 1%, and concordance estimates for monozygotic twins (48%) are significantly higher than that for dizygotic twins (17%) (3). There has been long-standing research into the hypothesis that dopamine dysfunction contributes to SZ pathogenesis (4,5). The hypothesis originated from observed correlations between the clinical potency of anti-psychotic drugs and their affinity for dopamine D2 receptors (DRD2) (6–8). Patients with SZ display increased sensitivity to the psychotogenic effects of agents that increase synaptic dopamine release (5,9–12). In addition, acute amphetamine challenge to SZ patients leads to increased dopaminergic transmission in vivo, as measured by radioligand binding to dopamine D2 receptors during positron emission tomography scans (13–15). Therefore, dopamine genes have traditionally been prime candidates for genetic studies in SZ.

Despite the substantial biological evidence implicating dopaminergic dysfunction in SZ pathogenesis, it is not precisely known whether genetic polymorphisms in dopaminergic genes are associated with dopamine abnormalities. If such a functional link exists, the nature of these variations, the number of genes affected, interactions among them and their functional importance are poorly understood. Associations between SZ and many dopaminergic gene variations have been reported, but most studies evaluated one or at best a handful of polymorphisms, usually on the basis of preliminary evidence of a functional impact (e.g. exonic SNPs or functional repeats). Most previous studies were better suited to identify risk factors of substantial effect size than multiple interacting loci, for which the marginal effect of an individual locus could be small. Therefore, it appears that many genes in the dopamine pathway have not been investigated adequately for their impact on SZ risk. Our recent review of the literature estimated that ~5% of representative common SNPs currently available in public databases have been considered in association studies of dopaminergic genes with at least 50% power to detect modest effect sizes expected [odds ratios (OR) from 1.2 to 1.5] (16). For example, a large number of studies investigated a single coding variant (rs6280) at the dopamine D3 receptor gene (DRD3) with largely inconsistent results (17–19). Until recently, studies did not consider other variations within the gene. Two independent studies of 13 SNPs and 17 SNPs now suggest that associations with other SNPs/haplotypes might account for past inconsistencies at rs6280 (20,21). Similar associations could be present with common variants yet to be investigated at other dopaminergic targets, but alternative strategies may be necessary to jointly evaluate these genes.

Multi-stage studies can be useful in analyses of a functionally related network of genes by initially screening a large group of susceptibility targets and subsequently evaluating only the most promising candidates in additional samples, thus maximizing power with the resources available (22–24). Skol et al. (25) recently showed that an increase in power for multi-stage whole-genome studies can be attained by evaluating the joint distribution of test statistics from both samples versus independent consideration of each sample. We reasoned a similar approach could be applied to gene-based association studies that are restricted to a smaller number of loci, since samples from individual studies are almost always underpowered to consistently detect associations and interactions of modest effect. In the present study, we revisited the genetic basis for the so-called ‘dopamine hypothesis’ of SZ by investigating 18 dopaminergic genes in three independent samples. We hypothesized that key susceptibility variants within the dopaminergic network could be identified if results from multiple samples were evaluated jointly. Our multi-stage strategy progressively pruned the list of promising susceptibility candidate genes and culminated in functional analyses of associated SNPs.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Design overview
An overview of the study design is provided in Figure 1. Briefly, in stage I, we screened 18 dopamine-related genes, using two independent samples from the USA: a family-based sample and a case–control sample. To improve the power of our screen, we evaluated the joint distribution of test statistics from both samples. In stage II, in-depth analyses of the most promising stage I genes were conducted using tag SNPs and all available case–control samples from stage I. Pair-wise epistatic interactions were then modeled for a limited number of SNPs in which evidence for main effects were detected. In stage III, we analyzed a third independent sample from Bulgaria. In sum, 3256 participants were genotyped. Finally, functional effects of key SNPs were examined in stage IV.


Figure 1
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 1. Study design. Overview of multi-stage study design utilized, including all samples and SNPs analyzed in each stage. In stage I, the 328 cases are independent of the 150 probands from the family-based samples. DA, dopamine; GC, genomic control.

 
Candidate genes
Because the list of genes impacting dopaminergic function is potentially long, subjective and continually expanding, we restricted our evaluation to dopaminergic genes analyzed in genetic association studies as of 2003. The selected genes included those required for dopamine synthesis (TH, DDC), transport (SLC6A3, SLC6A2, SLC18A1, SLC18A2), metabolism (MAOA, MAOB, COMT), conversion of dopamine to norepinephrine (DBH) and all dopamine receptors (DRD1, DRD2, DRD3, DRD4, DRD5) (Table 1). We also chose three genes important for dopamine regulation, namely PPP1R1C (alias DARPP-32), DRD1IP (alias CALCYON, a dopamine D1 receptor-interacting protein) and NR4A2 (alias NURR1, an orphan nuclear receptor and putative transcription factor for the dopamine transporter) (Table 1). One candidate, DRD3, was analyzed in our US sample earlier as part of a collaborative study (20). On the basis of the significant associations detected in that study, DRD3 was retained for stage II of this study, which included 501 independent controls.


View this table:
[in this window]
[in a new window]

  		Table 1. Dopaminergic genes and SNPs analyzed

 
Stage I: SNP screen among two independent US samples
We conducted 95 tests of association in the US family-based sample (150 trios, SNPs selected from Celera, 2003 based on physical distance). The most significant association was detected at SLC6A3 (DAT) (rs403636, p= 0.0004, OR = 2.36). Transmission distortion was noted at two other SLC6A3 SNPs (rs27072, p= 0.001; rs12516948, p= 0.07). All trends for association (p< 0.10; n= 9 SNPs) were genotyped in a replicate US case–control sample (328 cases, 501 controls). In this independent sample, significant associations were detected with four SNPs, including replication of rs403636 (p= 0.04). The joint distribution of test statistics from both samples identified SLC6A3, DRD3, COMT and SLC18A2 as the four most promising candidates (pjoint < 0.05) (see Table 2 for selected significant results; complete list in Supplementary Material, Table S1). These four genes were retained for follow-up analyses.


View this table:
[in this window]
[in a new window]

  		Table 2. Significant associations from joint analyses of stage I

 
Stage II: comprehensive gene coverage and epistasis among US samples
We assayed 68 SNPs among all available cases and controls from stage I (478 cases, 501 controls) at SLC6A3, DRD3, COMT and SLC18A2. SNPs were obtained from HapMap (26) and in-house sequencing for SNP detection. These analyses were not intended to replicate the stage I findings, as the samples overlapped. Instead, they enabled us to conduct in-depth analysis of representative common variants (minor allele >5%) from these four genes, over and above what was possible in our initial screen.

Overall, the distribution of test statistics from these SNPs was skewed towards small p-values (median trends test 1.07; expected median 0.456). Significant associations (p< 0.05) were found for 15 SNPs (Supplementary Material, Table S2). At SLC6A3, six of 17 SNPs tested were nominally significant (p< 0.05). Linkage disequilibrium (LD) analyses revealed that these associated SNPs were not part of a single cluster (Fig. 2). Associations were also detected with six DRD3 SNPs, three SLC18A2 SNPs and one COMT SNP.


Figure 2
View larger version (83K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 2. LD among SLC6A3 SNPs. LD patterns among all SLC6A3 SNPs genotyped in the US and Bulgarian samples (16 SNPs were common to both samples). LD values between pairs of SNPs (r2) are indicated, and associated SNPs (p< 0.10 and p< 0.05) are shown.

 
Gender-specific analyses were conducted at three COMT SNPs on the basis of a previously reported association by Shifman et al. (27). Consistent with those findings, logistic regression revealed a significant interaction between gender and rs737865 genotype ({chi}2= 14.14, 2 d.f., p= 0.0007). The significant effect appeared to be attributable to females, and a trends test comparing female patients with female controls for this SNP revealed significant differences in genotype distributions between groups (p= 0.008; OR= 1.34). Of note, the frequency of the G allele at rs737865 among female cases (0.38) was different than all three comparison groups, namely female controls (0.29), male cases (0.29) and male controls (0.28). Gender-related differences were not consistent with the findings of Shifman et al. at the other two SNPs (rs165599 and rs4680).

We next tested epistatic interactions among pairs of SNPs from different genes when a main effect was observed (cutoff set at p< 0.10, n= 22 SNPs including rs6347 based on stage III, see what follows; total 169 tests). We identified significant interactions between 17 locus pairs (p≤ 0.05). Notably, seven of 17 significant interactions (41.2%) involved either rs3756450 in the 5' upstream region of SLC6A3 or rs464049 within intron 4 of SLC6A3 (LD between these SNPs: r2= 0.04/D' = 0.56). In sum, 29 putative interactions were detected at p≤ 0.10.

Stage III: corroboration with an independent Bulgarian family sample
On the basis of our findings in stages I and II, we tested our hypotheses in a third independent sample composed of 659 case-parent trios from Bulgaria (total n= 1977), using 65 SNPs.

Significant associations were again detected in this cohort for both consistently interacting dopamine transporter SNPs in the stage II epistatic analyses (SLC6A3: rs464049, p= 0.011 and rs3756450, p= 0.035). Trends for transmission bias (p< 0.10) were detected at five SLC6A3 SNPs. Associations were not detected with other SNPs, including the three key exonic polymorphisms recently shown to alter COMT mRNA secondary structure (rs4680, rs4633, rs4818). We tested rs737865 for gender-related differences on the basis of our stage II results and again noted significant transmission distortion to female probands (p= 0.04, OR = 1.47) but not male probands (p= 0.18); however, the overtransmitted allele was the A allele, in contrast to the US samples. The joint distribution of test statistics for SNP analyses from stages II and III (US case–control and Bulgarian trios, respectively) found individual SNP associations at all four genes (pjoint< 0.05), including seven SLC6A3 loci (Table 3).


View this table:
[in this window]
[in a new window]

  		Table 3. Associated SNPs at SLC6A3, DRD3, SLC18A2 and COMT: joint analyses of US and Bulgarian samples

 
We next tested the putative epistatic interactions from the US sample in this cohort. Interaction tests were limited to the 29 SNP pairs in which epistasis was detected in the US sample at p≤ 0.10 or better using a conditional logit model. Remarkably, seven of these 29 interactions (24.1%) were significant (p≤ 0.05) in this independent family-based cohort. Consistent with the patterns observed in the US sample, interactions with SLC6A3 loci were replicated with each of the other three genes (e.g. p≤ 0.05 for the same locus pairs in both samples when analyzing SLC6A3*DRD3, SLC6A3*SLC18A2 and SLC6A3*COMT) (Fig. 3). One DRD3*SLC18A2 interaction was also significant in both samples. Table 4 lists all pairs of loci in which at least a trend (p≤ 0.10) was detected in both samples (Table 4).


Figure 3
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 3. Epistatic interactions at SLC6A3, DRD3, SLC18A2 and COMT. The genomic organization of all four genes retained from stage I analyses is shown. Boxes extending below the horizontal line indicate exons, and black tick marks represent all SNPs analyzed in the US and Bulgarian samples. The SNPs retained for epistatic interactions (i.e. SNPs where p≤ 0.10 for main effects) are listed. Gray lines indicate epistatic interactions at p< 0.10 in both the US and Bulgarian samples; bold black lines indicate significant interactions in the US as well as the Bulgarian samples at p< 0.05.

 


View this table:
[in this window]
[in a new window]

  		Table 4. Noteworthy epistatic interactions at SLC6A3, DRD3, SLC18A2 and COMT

 
To interpret the results from our interaction tests, we performed simulations of our analysis design. Using permutation and rejection sampling methods, we emulated the complicated multi-stage design employed here. The simulation results suggest it would be unusual to obtain seven or more ‘replicated interactions’, such as in stage III. From the simulations, we estimate the probability of this event to be roughly one in a thousand (0.0013 ± 0.00071). Similarly, we estimate the results of finding the initial 29 interaction ‘trends’ (p≤ 0.10) in stage II to also be rare, despite the much larger number of tests (0.0078 ± 0.0055).

Stage IV: functional analysis
We selected rs3756450 and rs464049 for further analyses of allele-specific functional effects, as these SLC6A3 SNPs were associated individually with risk for SZ in both samples and featured prominently in the epistatic analyses.

We performed electrophoretic mobility shift assays (EMSA), using nuclear extracts from SHSY-5Y cell line (Fig. 4A). Both allelic probes at rs3756450 generated DNA–protein gel shift bands. Addition of 50-fold unlabeled oligonucleotides probes for each allele inhibited formation of the gel shift bands, demonstrating specificity for these oligonucleotide sequences. We observed three distinct DNA–protein gel shift bands for the T allelic probe at rs3756450. In contrast, the C allelic probe at rs3756450 annealed to only two of the three bands, indicating allele-specific difference in DNA–protein complex formation. The result was replicated in two additional experiments, including one in which 2-fold excess of nuclear extract was added for assays with the C allele (Fig. 4A). In contrast, no allele-specific DNA–protein gel shift bands were observed at rs464049, though bands common to both alleles were noted (data not shown).


Figure 4
View larger version (34K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 4. EMSA and promoter assays using rs3756450 at SLC6A3. (A) Nuclear extracts from SHSY-5Y cells were incubated with labeled probes. The labeled probe for the T allele was loaded in the first three lanes, and the labeled probe for the C allele in the next three lanes. Unlabeled competitor oligonucleotides were included in 50-fold molar excess in lanes 3 and 6. Lanes 1 and 4 indicate the migration of the labeled probe without the nuclear extract. Asterisk indicates altered band shift pattern for T allele of rs3756450 (lane 2) with respect to C allele (lane 5), despite 2-fold excess of nuclear extract added to lanes 5 and 6. (B) Promoter activity in a dual-luciferase assay system for constructs containing either the C or T allele at rs3756450 but identical at all other bases.

 
Since rs3756450 is localized 5' to the putative promoter region of SLC6A3, we also evaluated its effect on transcription. Dual-luciferase assays were conducted using four clones from CEPH individuals whose genotypes were known (two constructs for each allele, Fig. 4A). Significant promoter activity was present in all constructs, compared with the promoterless construct. In addition, promoter activity was significantly different between constructs carrying C and T alleles (Student’s t-test, t = 10.32, 5 d.f., p< 0.0001; Fig. 4B).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Our systematic multi-stage approach yielded novel SNP associations and replicated epistasis between four dopaminergic genes, SLC6A3, DRD3, COMT and SLC18A2. We also noted plausible allele-specific functional effects in vitro for one of the associated SLC6A3 SNPs (rs3756450). Three of these genes have been frequent targets in previous SZ association studies (DRD3, COMT, SLC6A3), yet prior studies have not provided definitive evidence for or against associations. Overall, the SLC6A3 associations were most striking. More than a third of test statistics for stage II analyses involving SLC6A3 SNPs were significant. The median trends test statistic among 18 SNPs was 2.26, indicating a significant shift towards small p-values compared with expectations. When we sought evidence for epistasis, SNPs at SLC6A3 also dominated the list. Two SLC6A3 SNPs (rs3756450 in the 5' upstream and rs464049 at intron 4) were involved in 41.2% of the interactions in the US samples. When we evaluated an independent Bulgarian sample, both these SNPs were again associated. Though the dopamine transporter has long been a target for genetic association studies of SZ (reviewed in 28), most reports have focused on a variable number tandem repeat polymorphism localized to 15th exon (29), but meta-analysis does not suggest an association (29). A previous analysis of the SLC6A3 3' VNTR in a subset of the Bulgarian families also was not significant (30). Associations with other SLC6A3 polymorphisms have been reported, including significant associations in the 5' region near the promoter (31–33).

At DRD3, the present associations are consistent with our previous report, which analyzed a smaller set of US cases and a different group of control samples (20). They follow in a long line of studies that have targeted rs6280, a non-synonymous functional polymorphism (19). More recent studies have shown associations with other variants in both the 5' and 3' regions of the gene (16).

A functional exonic SNP (rs4680, Val/Met) has been the focus of numerous association studies at COMT, but the results have not been replicated consistently (34–38; reviewed in 39). Associations with haplotypes including rs4680 have been reported recently among Chinese and Ashkenazi Jewish samples (27,40). The latter reported on a haplotype of large effect size comprising three SNPs spanning the gene (rs737865–rs4680–rs165599), and the association was more significant among women. This haplotype was later found to be associated with decreased COMT mRNA levels in the human brain (41). Gender-specific associations have also been detected with an SNP in this haplotype (rs737865) in late-onset Alzheimer’s disease with psychosis (42). Our US samples revealed a gender-related association between SZ and rs737865 consistent with the Shifman results (OR = 1.34). In contrast, our analyses of the Bulgarian sample found overtransmission of the opposite risk allele (A allele), matching the results of Sweet et al. (42). Unlike the other three candidates, to date only one small association study of Japanese families at SLC18A2 has been conducted (43).

The epistatic interactions suggest a susceptibility model in which variations at SLC6A3 are important determinants of SZ susceptibility, with additional risk due to variants at SLC18A2, DRD3 and COMT. This model is appealing because all four proteins regulate synaptic dopamine concentrations, and there are plausible functional relationships between these genes. The dopamine transporter (DAT) controls both the intensity and duration of dopamine actions at synapses by modulating re-uptake into the pre-synaptic nerve terminal (44,45). Because DRD3 may function as an autoreceptor (46,47), it is reasonable to suggest molecular interactions between DRD3 and DAT. Indeed, DRD3 as well as the dopamine D2 (DRD2) receptor subtypes can regulate DAT function (48,49). However, the molecular details of this ‘cross-talk’ are not known. Since VMAT2, the protein encoded by SLC18A2, mediates the transport of dopamine into synaptic vesicles, molecular interactions between VMAT2 and DAT following DAT-mediated re-uptake of dopamine into pre-synaptic terminals are possible and require investigation. Finally, COMT is a key enzyme regulating synaptic dopamine levels through catabolism (50). Common homeostatic mechanisms may thus regulate COMT and DAT.

EMSA analyses suggest specific bandshift patterns using rs464049 probes in neuroblastoma cell lines. More intriguing allele-specific effects were observed with rs3756450, which is localized upstream to the core promoter sequences (51). Our results suggest a putative transcription factor that either has differential affinity for the rs3756450 alleles or binds to rs3756450T but not rs3756450C. Furthermore, luciferase promoter assays suggest significant differences in promoter activity for alleles of this SNP. Thus, sequences flanking rs3756450 may represent a novel promoter domain for SLC6A3.

There are some limitations to our association analyses. Though the SNP selection in stage I was more extensive than past studies, more comprehensive coverage would have been desirable for several genes, particularly MAOA, MAOB and DDC. The samples available for stage I analyses were also limited. We estimate only 41.3% power to detect an effect size of 1.5, so type II errors were possible and undetected liability loci could be present at genes that were not carried forward in stage II. Similarly, our family-based US samples had limited power to replicate other reported associations. Our tests of epistasis were relatively conservative, as we considered only locus pairs with evidence of a main effect. Evaluation of much larger samples would be required to conduct an exhaustive analysis of all potential interactions across a larger network of dopaminergic genes.

Our study design was intended to first identify promising susceptibility targets and then test these targets as comprehensively as possible. Spurious associations arising from population substructure are unlikely to account for the SLC6A3 results, as significant associations were detected in both of the family-based samples. Genomic control (GC) analyses also did not detect meaningful population substructure, and no corrections were necessary. To limit false-positive results, we employed three independent samples, analyzing them independently and jointly. We also simulated our study design and empirically determined the probability of obtaining similar results to the epistatic interactions. These simulations suggest that both our stage II and stage III interaction findings are unlikely under the null hypothesis (about eight in one thousand and one in one thousand for stages II and III, respectively).

In conclusion, our analyses of 18 dopaminergic genes among over 3000 participants indicate that variants at SLC6A3, DRD3, COMT and SLC18A2 individually and jointly confer risk for SZ. Our findings propose a model for SZ risk in which risk conferred by SLC6A3 variations could be modified by variants at DRD3, COMT and/or SLC18A2.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Samples
Unrelated patients from the USA were recruited at Western Psychiatric Institute and Clinic, Pittsburgh, PA, USA and surrounding regions (n= 478). Diagnoses were based on the Diagnostic Interview for Genetic Studies (52), supplemented by medical records and informant interviews. Consensus DSM IV diagnoses of SZ (n= 272) or schizoaffective disorder (SZA; n= 206) were assigned by board-certified psychiatrists/psychologists following review of all these sources of information. Both parents of 150 patients were ascertained for family-based analyses (150 trios). Control DNA samples were collected from the cord blood of 501 unscreened Caucasian neonates born at Magee-Women’s Hospital, Pittsburgh, PA, USA. Ancestry and gender were available for all samples.

The Bulgarian patients and their parents were recruited in Bulgaria as part of a collection of parent—proband trios described previously (53). Diagnoses were made according to DSM-IV criteria, following assessment by a psychiatrist using the Schedules for Clinical Assessment in Neuropsychiatry (SCAN) (54) which has been validated for use in the Bulgarian language by one of the authors of the SCAN instrument, and inspection of hospital discharge summaries. In cases in which the information collected did not allow a confident diagnosis, the patient was re-interviewed by Dr Kirov or the clinical coordinator of the project. All patients and their parents received written information on the project and signed an informed consent form. The Bulgarian sample included 659 trios (n= 1977). Probands were diagnosed with SZ (n= 576) or SZA (n= 83).

The University of Pittsburgh Institutional Review Board approved the study. Written informed consent was obtained from all participants, except neonatal controls, in accordance with IRB guidelines. Approval was obtained from Ethics Committees in all regions of Bulgaria where families were recruited.

Polymorphism selection
We initially selected SNPs from the Celera database (Celera, 2003), the most comprehensive source available when stage I analyses were initiated. SNPs were selected on the basis of physical distance (1 SNP/5 kb attempted). A denser set of SNPs were then chosen for SLC6A3, SLC18A2, DRD3 and COMT in stage II. Polymorphisms for each gene were obtained by surveying the genomic region spanning the gene and at least 5 kb of flanking sequence. For SLC6A3 and SLC18A2, SNPs were identified from available HapMap data (HapMap phase I, October 2005 release for SLC6A3 and HapMap phase II, June 2006 release for SLC18A2) (26), and tag SNPs were chosen using Hclust software (55). Hclust computes a similarity matrix from the square of Pearson’s correlation (r2) between allele counts at pairs of loci and then uses hierarchical clustering to group correlated SNPs (minor allele frequency >5%). Tag SNPs were chosen if the correlation between loci was below an arbitrary threshold (r2 < 0.8). One redundant SNP (rs456082) was also chosen. At COMT and DRD3, additional SNPs were obtained from in-house sequencing. For DRD3, we sequenced overlapping 600–800 bp amplicons across the entire gene and 5 kb of flanking sequence in a pool of 200 Caucasian cases to detect common polymorphisms (minor allele frequency >5%). When polymorphisms were detected that were not available in HapMap, we sequenced the same 60 unrelated CEPH individuals used by HapMap to investigate patterns of LD. Sixty-nine polymorphisms were detected, 15 of which were novel, and 18 SNPs were selected (Supplementary Material, Table S2). The 18 SNPs included tag SNPs (chosen with Hclust as discussed earlier), and SNPs associated with SZ in our previous study (20). At COMT, 27 SNPs were identified from directly sequencing coding regions and flanking intronic sequence for exons 2–6 as well as the proximal promoter region for S-COMT within intron 3. Sequencing was performed among 60 Caucasian US subjects [data provided by R. Weinshilboum and J.Z., Mayo Clinic, Rochester, MN, USA; (56)]. Individuals used for these analyses were different than those used in HapMap. In sum, we chose 20 SNPs from the combination of HapMap and individual sequencing, realizing redundancy in SNP selection could result. It should be noted that for COMT, some SNPs obtained within the pre-determined flanking sequence were localized to other genes (ARVCF or TXNRD2); however, for clarity, these SNPs are still referred to as ‘COMT’ SNPs. In the Bulgarian sample, 65 SNPs were genotyped. Where possible, identical SNPs to stage II were analyzed (n= 59 SNPs). Four additional SNPs were genotyped as surrogates for stage II tag SNPs, and two functional synonymous SNPs at COMT were genotyped on the basis of work by Nackley et al. (57) during the course of this study (Supplementary Material Table S2).

Since a case–control design was used in stage II, we sought evidence for population substructure by implementing GC analyses using 31 SNPs (58,59). We chose a single common SNP (minor allele >10%) from each of the 31 genomic bins least likely to be linked to SZ from a meta-analysis of linkage scans by Lewis et al. (60).

Genotyping assays
Stage I
The screening SNPs (n= 95) were assayed using multiplexed polymerase chain reaction (PCR) amplification, followed by single base extension (SNaPshot, ABI Biosystems), as described elsewhere (61).

Stage II
SNPs were genotyped using the hybridization-based Illumina Golden Gate assay, as described elsewhere (62). In sum, 99 SNPs were assayed, including 31 GC SNPs. The median trends test statistic for GC was 0.336 (expected median 0.456), yielding no evidence for noteworthy substructure. Hence corrections were not applied, as it would be anti-conservative (58).

Stage III
Genotyping in the Bulgarian sample was conducted at both Cardiff University (Cardiff, Wales, UK) and the University of Pittsburgh (Pittsburgh, PA, USA). At Cardiff, 33 of the SLC6A3 and DRD3 SNPs were genotyped by the Sequenom MassARRAYTM system using iPlexTM chemistries according to the recommendations of the manufacturers (Sequenom, San Diego, CA, USA, http://www.sequenom.com). At Pittsburgh, SNPlex (63) and SNaPshot assays (ABI Biosystems Inc.) were utilized to type the remaining 32 SNPs.

Quality control
In the stage I family-based analyses, we sequenced eight cases for all SNPs (752 sequenced genotypes) and one discrepancy was observed between the sequencing data and the SNaPshot data. In stage I and II case–control analyses, there was complete concordance between Illumina genotypes and HapMap genotypes for 11 CEPH individuals. Among 3024 duplicated genotypes from positive controls, no discrepancies were found. In stage III, we assayed 31 CEPH individuals (n= 2139 genotypes) and found five discrepancies. In addition, four SNPs (rs464049, rs463379, rs324030, rs167771) were genotyped in duplicate for all 1977 Bulgarian samples at Pittsburgh and Cardiff (15,816 total genotypes) and 24 discrepancies were found (stage III estimated error rate 0.0015–0.0023). The mean genotype call rate was 99.83% for stage II and 95.71% for stage III.

Mendelian inconsistencies and deviations from Hardy–Weinberg expectations for individual SNPs were evaluated using PEDCHECK (64) and GENEPOP (version 1.31) software, respectively. We detected nine Mendelian errors among the 95 SNPs assayed in stage I and 74 Mendelian errors from analyses of 65 SNPs in 659 Bulgarian trios. In sum, 18 families were removed from Bulgarian analyses owing to multiple Mendelian errors, and remaining sporadic errors were set to null. Hardy–Weinberg equilibrium was tested in each population separately (US cases, US controls, US parents, Bulgarian parents, Bulgarian cases).

Electrophoretic mobility shift assay
Non-radioactive EMSA for rs3756450 was performed using DIG Gel Shift Kit (Roche Applied Science, Inc.) according to the manufacturer’s protocol with slight modifications. Polyacrylamide gel electrophoresis-purified 42-base primers (Integrated DNA Technologies, Inc.) encompassing rs3756450 were annealed to complementary oligonucleotides by incubating them at 95°C for 5 min, followed by gradual cooling to room temperature. Annealed double-stranded oligonucleotides were labeled according to the manufacturer’s protocol (Roche Applied Science, Inc.). Nuclear extracts were prepared from SHSY-5Y cell lines, as described (65). DIG-labeled oligonucleotides were incubated with nuclear extracts (5 µg) in 20 µl reaction containing 5x binding buffer, poly-L-lysine, poly{d(I-C)}, for 30 min at room temperature. Competitive binding was performed by including 50x unlabeled oligonucleotides in appropriate control reactions. DIG-labeled oligonucleotide–nuclear extract complexes were resolved on 6% non-denaturing polyacrylamide gel for 2 h at room temperature and transferred on positively charged nylon membranes (Boehringer Mannheim–Roche Applied Science, Inc.) by electroblotting. Blots were visualized by an enzyme chemiluminescent method (Roche Applied Science, Inc.). The experiment was replicated, with 2-fold excess of the nuclear extract added to reactions having the rs3756450C probes (Fig. 4A, lanes 4–6). The primer sequences used for generating allele-specific probes are as follows, with altered bases in bold:

rs3756450 T allele FWD: 5' TAGCAGCAACCACAATGATAATAAAGCCGACTTGGCATTTAG 3'; rs3756450 T allele REV: 5' CTAAATGCCAAGTCGGCTTTATTATCATTGTGGTTGCTGCTA 3'; rs3756450 C allele FWD: 5' TAGCAGCAACCACAATGATAACAAAGCCGACTTGGCATTTAG 3'; rs3756450 C allele REV: 5' CTAAATGCCAAGTCGGCTTTGTTATCATTGTGGTTGCTGCTA 3'.

Dual-luciferase assay
A 2.8 kb genomic region encompassing the 5'-UTR of SLC6A3 (–2783 to +63, spanning rs3756450) was amplified from two CEPH samples homozygous for alleles of rs3756450, using the Expand High Fidelity PCR System (Roche Applied Science, Inc). The PCR-amplified fragments were cloned between Kpn1 and HindIII restriction sites in a pGL3 basic vector (Promega, Inc). Sequence homology for all residues was confirmed by sequencing. Transient transfections of constructs into neuroblastoma cell line SHSY-5Y (ATCC-CRL-2266) were performed in 24-well plates (0.8 x 106 cells/well), using LipofectAMINE (Life Technologies, Inc.), according to the manufacturer’s instructions. The pRL-TK (Promega, Inc.) vector expressing Renilla luciferase by an HSV-TK promoter was co-transfected with each construct as an internal control, to normalize for firefly luciferase expression. Cells were harvested 30 h after transfection, and luciferase assays performed using the dual-luciferase reporter assay system (Promega, Inc.). Relative luciferase values were normalized from a promoterless pGL3 BASIC vector. Six readings were taken for each clone, and the entire experiment was conducted in triplicate.

Statistical analysis
Evidence for transmission distortion was assessed using FBAT software (66). Differences in genotype distributions between cases and controls were evaluated with the Armitage trends test (SAS software) (58). Markers localized to the X chromosome (MAOA and MAOB) were analyzed using likelihood ratio tests in a loglinear model, as implemented in the UNPHASED software suite (67,68). We tested for gender differences at each of the three COMT SNPs previously described by Shifman et al. (27) (rs4680, rs737865, rs165599) using logistic regression. Gender comparisons were made only for these three SNPs.

To evaluate results from multiple samples, we computed the joint distribution of test statistics (Zjoint) on the basis of the methods of Skol et al. (25). Here, when combining our results from stages II and III, the proportion of markers genotyped remained the same, and thus Skol et al.’s adjustment for variable number of markers genotyped was not applied. Z-statistics were derived for both case–control and family-based association tests. To calculate Zjoint, let n1 and n2 be the sample sizes from which test statistics Z1 and Z2 were calculated. The formula for Zjoint is then Formula , where {pi}1=n1/(n1+ n2). It should be noted that the sign of the test statistic (i.e. Z positive or negative) was accounted for in all analyses, meaning the risk allele was required to be the same in both samples. To determine {pi}1, or the proportion of total samples genotyped in the first stage, we treated a complete case-parent trio (n= 3 individuals) as the equivalent of one case and one control. For stage I, we therefore had the equivalent of 478 cases and 651 controls available, of which the 150 trios represented 26.6% of these samples (i.e. {pi}samples= 0.266). In this staged design, we calculated Zjoint twice, once over the case–control and family-based association analyses in stage I (US samples only), and again over the case–control analyses of stage II and the family-based association analyses of stage III (US and Bulgarian samples). Where surrogates were chosen in the Bulgarian sample to represent tag SNPs in the US sample, Zjoint was calculated by combining the test statistic from the original SNP with that of the surrogate. In using this procedure, we are confident that the size of the test was not likely to be altered (e.g. p= 0.05 was still at least a 5% type I error threshold). However, a lower correlation between SNPs could result in loss of power.

Epistatic interactions were tested in stages II and III. Pairs of loci, each of which provided a p-value <0.10 for a main effect on risk for SZ, were analyzed for interaction effects using an unconditional logit model for case–control analyses and a conditional logit model for trios (69). In both instances, the ‘interaction p-value’ reported represented the likelihood difference between a full model including both main effects and an interaction term from a reduced model including only main effects. When interaction results were significant by asymptotic approximation, empirical p-values were determined by permutation testing (1000 permutations; Genetic Association and Interaction Analysis software) (70).

For the functional analyses, we used a paired t-test to determine differences in luciferase activity between the C and T alleles at rs3756450. To determine significant differences between constructs, we conducted analysis of variance.

Simulations
Interpretation of the interaction results from the staged design is complicated by the design itself and by the LD structure of SNPs in each gene. To facilitate interpretation of results from interaction tests, we performed a simulation experiment on the basis of the data from these cases and controls. Each simulation consisted of three stages:

Stage I: Permute the case–control status, thus making affection status independent of genotypes while retaining the LD structure of the sample. Test all 68 SNPs individually for association with affection status at two levels of significance (p≤ 0.05 and p≤ 0.10). If eight or more SNPs are associated at p≤ 0.05, then record all S SNPs with p≤ 0.10 and proceed to stage II; else reject this set of data and re-run the permutation until eight or more SNPs are associated at p≤ 0.05. Rejection sampling ensures that this stage is comparable with the results obtained in the original experiment in terms of the number of SNPs associated with affection status.

Stage II: Using the stage 1 data set and the list of S SNPs, test for all possible SNP–SNP interactions, with the condition that each of the two SNPs be in different genes (i.e. gene–gene interaction). As per the original experiment, record all I interactions having a p≤ 0.10 for association.

Stage III: Do a new permutation of case–control data. With these data, test the I interactions found in Stage II, using a significance level of p≤ 0.05. Record the number of ‘replicated interactions’ R.

We performed this stage 1–3 experiment 10 000 times to obtain the distribution of R. This is, in essence, the design of the original experiment. It differs in the sense that the original experiment used a family-based sample in stage III and had slightly different sample sizes, but neither of these features should be important under the null hypothesis evaluated here.


   SUPPLEMENTARY MATERIAL
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
FUNDING
 REFERENCES
 
Supplementary Material is available at HMG Online.


   FUNDING
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
REFERENCES
 
This research work was supported by the National Institutes of Health (MH56242, MH66263 and MH063420 to V.L.N., MH080582 to M.E.T.; The Pharmacogenetics Research Network GM28157 and GM61388 to R. Weinshilboum). The family collection in Bulgaria was funded by the Janssen Research Foundation, Beerse, Belgium.


   ACKNOWLEDGEMENTS
 
We thank Professor Richard Weinshilboum for providing sequencing data for COMT. We thank Travus Logue, Caitlin Holt and Jeanna Thomas for technical support. We also thank Shawn Wood for programming assistance in the interaction and simulation analyses.

Conflict of Interest statement. None declared.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 

  1. Risch N. Genetic linkage and complex diseases, with special reference to psychiatric disorders. Genet. Epidemiol. (1990) 7:3–16. Discussion.[CrossRef][Web of Science][Medline]

  2. Schliekelman P., Slatkin M. Multiplex relative risk and estimation of the number of loci underlying an inherited disease. Am. J. Hum. Genet. (2002) 71:1369–1385. Epub November 21, 2002.[CrossRef][Web of Science][Medline]

  3. Gottesman I. Schizophrenia Genesis: The Origins of Madness (1991) New York: W.H. Freeman.

  4. Lewis D.A., Lieberman J.A. Catching up on schizophrenia: natural history and neurobiology. Neuron (2000) 28:325–334.[CrossRef][Web of Science][Medline]

  5. Laruelle M., Abi-Dargham A., Gil R., Kegeles L., Innis R. Increased dopamine transmission in schizophrenia: relationship to illness phases. Biol. Psychiatry (1999) 46:56–72.[CrossRef][Web of Science][Medline]

  6. Carlsson A., Lindqvist M. Effect of chlorpromazine or haloperidol on formation of 3-methoxytyramine and normetanephrine in mouse brain. Acta Pharmacol. Toxicol. (1963) 20:140–144.[Medline]

  7. Creese I., Burt D.R., Snyder S.H. Dopamine receptor binding predicts clinical and pharmacological potencies of antischizophrenic drugs. Science (1976) 192:481–483.[Abstract/Free Full Text]

  8. Seeman P., Lee T., Chau-Wong M., Wong K. Antipsychotic drug doses and neuroleptic/dopamine receptors. Nature (1976) 261:717–719.[CrossRef][Medline]

  9. Angrist B., van Kammen D.P. CNS stimulants as a tool in the study of schizophrenia. Trends Neurosci. (1984) 7:388–390.[CrossRef][Web of Science]

  10. Lieberman J.A., Kane J.M., Gadaleta D., Brenner R., Lesser M.S., Kinon B. Methylphenidate challenge as a predictor of relapse in schizophrenia. Am. J. Psychiatry (1984) 141:633–638.[Abstract/Free Full Text]

  11. Davidson M., Keefe R.S., Mohs R.C., Siever L.J., Losonczy M.F., Horvath T.B., Davis K.L. L-Dopa challenge and relapse in schizophrenia. Am. J. Psychiatry (1987) 144:934–938.[Abstract/Free Full Text]

  12. Laruelle M., Abi-Dargham A. Dopamine as the wind of the psychotic fire: new evidence from brain imaging studies. J. Psychopharmacol. (1999) 13:358–371.[Abstract/Free Full Text]

  13. Laruelle M., Abi-Dargham A., van Dyck C.H., Gil R., D’Souza C.D., Erdos J., McCance E., Rosenblatt W., Fingado C., Zoghbi S.S., et al. Single photon emission computerized tomography imaging of amphetamine-induced dopamine release in drug-free schizophrenic subjects. Proc. Natl Acad. Sci. USA (1996) 93:9235–9240.[Abstract/Free Full Text]

  14. Abi-Dargham A., Gil R., Krystal J., Baldwin R.M., Seibyl J.P., Bowers M., van Dyck C.H., Charney D.S., Innis R.B., Laruelle M. Increased striatal dopamine transmission in schizophrenia: confirmation in a second cohort. Am. J. Psychiatry (1998) 155:761–767.[Abstract/Free Full Text]

  15. Breier A., Su T.P., Saunders R., Carson R.E., Kolachana B.S., de Bartolomeis A., Weinberger D.R., Weisenfeld N., Malhotra A.K., Eckelman W.C., et al. Schizophrenia is associated with elevated amphetamine-induced synaptic dopamine concentrations: evidence from a novel positron emission tomography method. Proc. Natl Acad. Sci. USA (1997) 94:2569–2574.[Abstract/Free Full Text]

  16. Talkowski M.E., Bamne M., Mansour H., Nimgaonkar V.L. Dopamine genes and schizophrenia: case closed or evidence pending? Schizophr. Bull. (2007) 33:1071–1081.[Abstract/Free Full Text]

  17. Ioannidis J.P., Ntzani E.E., Trikalinos T.A., Contopoulos-Ioannidis D.G. Replication validity of genetic association studies. Nat. Genet. (2001) 29:306–309.[CrossRef][Web of Science][Medline]

  18. Jonsson E.G., Flyckt L., Burgert E., Crocq M.A., Forslund K., Mattila-Evenden M., Rylander G., Asberg M., Nimgaonkar V.L., Edman G., et al. Dopamine D3 receptor gene Ser9Gly variant and schizophrenia: association study and meta-analysis. Psychiatr. Genet. (2003) 13:1–12.[CrossRef][Web of Science][Medline]

  19. Jonsson E.G., Kaiser R., Brockmoller J., Nimgaonkar V.L., Crocq M.A. Meta-analysis of the dopamine D3 receptor gene (DRD3) Ser9Gly variant and schizophrenia. Psychiatr. Genet. (2004) 14:9–12.[CrossRef][Web of Science][Medline]

  20. Talkowski M.E., Mansour H., Chowdari K.V., Wood J., Butler A., Varma P.G., Prasad S., Semwal P., Bhatia T., Deshpande S., et al. Novel, replicated associations between dopamine D3 receptor gene polymorphisms and schizophrenia in two independent samples. Biol. Psychiatry (2006) 60:570–577.[CrossRef][Web of Science][Medline]

  21. Dominguez E., Loza M.I., Padin F., Gesteira A., Paz E., Paramo M., Brenlla J., Pumar E., Iglesias F., Cibeira A., et al. Extensive linkage disequilibrium mapping at HTR2A and DRD3 for schizophrenia susceptibility genes in the Galician population. Schizophr. Res. (2007) 90:123–129.[CrossRef][Web of Science][Medline]

  22. Lowe C.E., Cooper J.D., Chapman J.M., Barratt B.J., Twells R.C., Green E.A., Savage D.A., Guja C., Ionescu-Tirgoviste C., Tuomilehto-Wolf E., et al. Cost-effective analysis of candidate genes using htSNPs: a staged approach. Genes Immun. (2004) 5:301–305.[CrossRef][Web of Science][Medline]

  23. Aplenc R., Zhao H., Rebbeck T.R., Propert K.J. Group sequential methods and sample size savings in biomarker-disease association studies. Genetics (2003) 163:1215–1219.[Abstract/Free Full Text]

  24. Satagopan J.M., Elston R.C. Optimal two-stage genotyping in population-based association studies. Genet. Epidemiol. (2003) 25:149–157.[CrossRef][Web of Science][Medline]

  25. Skol A.D., Scott L.J., Abecasis G.R., Boehnke M. Joint analysis is more efficient than replication-based analysis for two-stage genome-wide association studies. Nat. Genet. (2006) 38:209–213.[CrossRef][Web of Science][Medline]

  26. HapMap. The International HapMap Project. Nature (2003) 426:789–796.[CrossRef][Medline]

  27. Shifman S., Bronstein M., Sternfeld M., Pisante-Shalom A., Lev-Lehman E., Weizman A., Reznik I., Spivak B., Grisaru N., Karp L., et al. A highly significant association between a COMT haplotype and schizophrenia. Am. J. Hum. Genet. (2002) 71:1296–1302.[CrossRef][Web of Science][Medline]

  28. Bannon M.J., Michelhaugh S.K., Wang J., Sacchetti P. The human dopamine transporter gene: gene organization, transcriptional regulation, and potential involvement in neuropsychiatric disorders. Eur. Neuropsychopharmacol. (2001) 11:449–455.[CrossRef][Web of Science][Medline]

  29. Gamma F., Faraone S.V., Glatt S.J., Yeh Y.C., Tsuang M.T. Meta-analysis shows schizophrenia is not associated with the 40-base-pair repeat polymorphism of the dopamine transporter gene. Schizophr. Res. (2005) 73:55–58.[CrossRef][Web of Science][Medline]

  30. Georgieva L., Dimitrova A., Nikolov I., Koleva S., Tsvetkova R., Owen M.J., Toncheva D., Kirov G. Dopamine transporter gene (DAT1) VNTR polymorphism in major psychiatric disorders: family-based association study in the Bulgarian population. Acta Psychiatr. Scand. (2002) 105:396–399.[CrossRef][Web of Science][Medline]

  31. Keikhaee M.R., Fadai F., Sargolzaee M.R., Javanbakht A., Najmabadi H., Ohadi M. Association analysis of the dopamine transporter (DAT1)-67A/T polymorphism in bipolar disorder. Am. J. Med. Genet. B Neuropsychiatr. Genet. (2005) 135:47–49.[Medline]

  32. Khodayari N., Garshasbi M., Fadai F., Rahimi A., Hafizi L., Ebrahimi A., Najmabadi H., Ohadi M. Association of the dopamine transporter gene (DAT1) core promoter polymorphism -67T variant with schizophrenia. Am. J. Med. Genet. B Neuropsychiatr. Genet. (2004) 129:10–12.[Medline]

  33. Stober G., Sprandel J., Jabs B., Pfuhlmann B., Moller-Ehrlich K., Knapp M. Family-based study of markers at the 5'-flanking region of the human dopamine transporter gene reveals potential association with schizophrenic psychoses. Eur. Arch. Psychiatry Clin. Neurosci. (2006) 46:41.

  34. Glatt S.J., Faraone S.V., Tsuang M.T. Association between a functional catechol O-methyltransferase gene polymorphism and schizophrenia: meta-analysis of case–control and family-based studies. Am. J. Psychiatry (2003) 160:469–476.[Abstract/Free Full Text]

  35. Fan J.B., Zhang C.S., Gu N.F., Li X.W., Sun W.W., Wang H.Y., Feng G.Y., St Clair D., He L. Catechol-O-methyltransferase gene Val/Met functional polymorphism and risk of schizophrenia: a large-scale association study plus meta-analysis. Biol. Psychiatry (2005) 57:139–144.[CrossRef][Web of Science][Medline]

  36. Munafo M.R., Bowes L., Clark T.G., Flint J. Lack of association of the COMT (Val158/108 Met) gene and schizophrenia: a meta-analysis of case–control studies. Mol. Psychiatry (2005) 10:765–770.[CrossRef][Web of Science][Medline]

  37. Williams H.J., Glaser B., Williams N.M., Norton N., Zammit S., MacGregor S., Kirov G.K., Owen M.J., O’Donovan M.C. No association between schizophrenia and polymorphisms in COMT in two large samples. Am. J. Psychiatry (2005) 162:1736–1738.[Abstract/Free Full Text]

  38. Fallin M.D., Lasseter V.K., Avramopoulos D., Nicodemus K.K., Wolyniec P.S., McGrath J.A., Steel G., Nestadt G., Liang K.Y., Huganir R.L., et al. Bipolar I disorder and schizophrenia: a 440-single-nucleotide polymorphism screen of 64 candidate genes among Ashkenazi Jewish case-parent trios. Am. J. Hum. Genet. (2005) 77:918–936.[CrossRef][Web of Science][Medline]

  39. Williams H.J., Owen M.J., O’Donovan M.C. Is COMT a susceptibility gene for schizophrenia? Schizophr. Bull. (2007) 33:635–641.[Abstract/Free Full Text]

  40. Li T., Ball D., Zhao J., Murray R.M., Liu X., Sham P.C., Collier D.A. Family-based linkage disequilibrium mapping using SNP marker haplotypes: application to a potential locus for schizophrenia at chromosome 22q11. Mol. Psychiatry (2000) 5:77–84.[CrossRef][Web of Science][Medline]

  41. Bray N.J., Buckland P.R., Williams N.M., Williams H.J., Norton N., Owen M.J., O’Donovan M.C. A haplotype implicated in schizophrenia susceptibility is associated with reduced COMT expression in human brain. Am. J. Hum. Genet. (2003) 73:152–161.[CrossRef][Web of Science][Medline]

  42. Sweet R.A., Devlin B., Pollock B.G., Sukonick D.L., Kastango K.B., Bacanu S.A., Chowdari K.V., DeKosky S.T., Ferrell R.E. Catechol-O-methyltransferase haplotypes are associated with psychosis in Alzheimer disease. Mol. Psychiatry (2005) 10:1026–1036.[CrossRef][Web of Science][Medline]

  43. Kunugi H., Ishida S., Akahane A., Nanko S. Exon/intron boundaries, novel polymorphisms, and association analysis with schizophrenia of the human synaptic vesicle monoamine transporter (SVMT) gene. Mol. Psychiatry (2001) 6:456–460.[CrossRef][Web of Science][Medline]

  44. Sotnikova T.D., Beaulieu J.M., Gainetdinov R.R., Caron M.G. Molecular biology, pharmacology and functional role of the plasma membrane dopamine transporter. CNS Neurol. Disord. Drug Targets (2006) 5:45–56.[Medline]

  45. Torres G.E. The dopamine transporter proteome. J. Neurochem. (2006) 97:3–10.[CrossRef][Web of Science][Medline]

  46. Sokoloff P., Giros B., Martres M.P., Bouthenet M.L., Schwartz J.C. Molecular cloning and characterization of a novel dopamine receptor (D3) as a target for neuroleptics. Nature (1990) 347:146–151.[CrossRef][Medline]

  47. Sokoloff P., Andrieux M., Besancon R., Pilon C., Martres M.P., Giros B., Schwartz J.C. Pharmacology of human dopamine D3 receptor expressed in a mammalian cell line: comparison with D2 receptor. Eur. J. Pharmacol. (1992) 225:331–337.[CrossRef][Web of Science][Medline]

  48. Zahniser N.R., Doolen S. Chronic and acute regulation of Na+/Cl–-dependent neurotransmitter transporters: drugs, substrates, presynaptic receptors, and signaling systems. Pharmacol. Ther. (2001) 92:21–55.[CrossRef][Web of Science][Medline]

  49. Zapata A., Shippenberg T.S. D(3) receptor ligands modulate extracellular dopamine clearance in the nucleus accumbens. J. Neurochem. (2002) 81:1035–1042.[CrossRef][Web of Science][Medline]

  50. Napolitano A., Cesura A.M., Da Prada M. The role of monoamine oxidase and catechol O-methyltransferase in dopaminergic neurotransmission. J. Neural. Transm. Suppl. (1995) 45:35–45.[Medline]

  51. Kelada S.N., Costa-Mallen P., Checkoway H., Carlson C.S., Weller T.S., Swanson P.D., Franklin G.M., Longstreth W.T. Jr, Afsharinejad Z., Costa L.G. Dopamine transporter (SLC6A3) 5' region haplotypes significantly affect transcriptional activity in vitro but are not associated with Parkinson’s disease. Pharmacogenet. Genomics (2005) 15:659–668.[Web of Science][Medline]

  52. Nurnberger J.I. Jr, Blehar M.C., Kaufmann C.A., York-Cooler C., Simpson S.G., Harkavy-Friedman J., Severe J.B., Malaspina D., Reich T. Diagnostic interview for genetic studies. Rationale, unique features, and training. NIMH Genetics Initiative. Arch. Gen. Psychiatry (1994) 51:849–859.[Abstract/Free Full Text]

  53. Kirov G., Ivanov D., Williams N.M., Preece A., Nikolov I., Milev R., Koleva S., Dimitrova A., Toncheva D., O’Donovan M.C., et al. Strong evidence for association between the dystrobrevin binding protein 1 gene (DTNBP1) and schizophrenia in 488 parent–offspring trios from Bulgaria. Biol. Psychiatry (2004) 55:971–975.[CrossRef][Web of Science][Medline]

  54. Wing J.K., Babor T., Brugha T., Burke J., Cooper J.E., Giel R., Jablenski A., Regier D., Sartorius N. Schedules for Clinical Assessment in Neuropsychiatry (SCAN). Arch. Gen. Psychiatry (1990) 47:589–93.[Abstract/Free Full Text]

  55. Rinaldo A., Bacanu S.A., Devlin B., Sonpar V., Wasserman L., Roeder K. Characterization of multilocus linkage disequilibrium. Genet. Epidemiol. (2005) 28:193–206.[CrossRef][Web of Science][Medline]

  56. Shield A.J., Thomae B.A., Eckloff B.W., Wieben E.D., Weinshilboum R.M. Human catechol O-methyltransferase genetic variation: gene resequencing and functional characterization of variant allozymes. Mol. Psychiatry (2004) 9:151–160.[CrossRef][Web of Science][Medline]

  57. Nackley A.G., Shabalina S.A., Tchivileva I.E., Satterfield K., Korchynskyi O., Makarov S.S., Maixner W., Diatchenko L. Human catechol-O-methyltransferase haplotypes modulate protein expression by altering mRNA secondary structure. Science (2006) 314:1930–1933.[Abstract/Free Full Text]

  58. Devlin B., Roeder K. Genomic control for association studies. Biometrics (1999) 55:997–1004.[CrossRef][Web of Science][Medline]

  59. Bacanu S.A., Devlin B., Roeder K. The power of genomic control. Am. J. Hum. Genet. (2000) 66:1933–1944.[CrossRef][Web of Science][Medline]

  60. Lewis C.M., Levinson D.F., Wise L.H., DeLisi L.E., Straub R.E., Hovatta I., Williams N.M., Schwab S.G., Pulver A.E., Faraone S.V., et al. Genome scan meta-analysis of schizophrenia and bipolar disorder, part II: schizophrenia. Am. J. Hum. Genet. (2003) 73:34–48.[CrossRef][Web of Science][Medline]

  61. Mansour H.A., Talkowski M.E., Wood J., Pless L., Bamne M., Chowdari K.V., Allen M., Bowden C.L., Calabrese J., El-Mallakh R.S., et al. Serotonin gene polymorphisms and bipolar I disorder: focus on the serotonin transporter. Ann. Med. (2005) 37:590–602.[CrossRef][Web of Science][Medline]

  62. Shen R., Fan J.B., Campbell D., Chang W., Chen J., Doucet D., Yeakley J., Bibikova M., Wickham Garcia E., McBride C., et al. High-throughput SNP genotyping on universal bead arrays. Mutat. Res. (2005) 573:70–82.[Web of Science][Medline]

  63. Tobler A.R., Short S., Andersen M.R., Paner T.M., Briggs J.C., Lambert S.M., Wu P.P., Wang Y., Spoonde A.Y., Koehler R.T., et al. The SNPlex genotyping system: a flexible and scalable platform for SNP genotyping. J. Biomol. Tech. (2005) 16:398–406.[Medline]

  64. O’Connell J.R., Weeks D.E. PedCheck: a program for identification of genotype incompatibilties in linakge analysis. Am. J. Hum. Genet. (1998) 63:259–266.[CrossRef][Web of Science][Medline]

  65. Andrews N.C., Faller D.V. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. (1991) 19:2499.[Free Full Text]

  66. Laird N.M., Horvath S., Xu X. Implementing a unified approach to family-based tests of association. Genet. Epidemiol. (2000) 19:S36–S42.[CrossRef][Web of Science][Medline]

  67. Cordell H.J., Clayton D.G. A unified stepwise regression procedure for evaluating the relative effects of polymorphisms within a gene using case/control or family data: application to HLA in type 1 diabetes. Am. J. Hum. Genet. (2002) 70:124–141.[CrossRef][Web of Science][Medline]

  68. Dudbridge F. Pedigree disequilibrium tests for multilocus haplotypes. Genet. Epidemiol. (2003) 25:115–121.[CrossRef][Web of Science][Medline]

  69. Cordell H.J., Barratt B.J., Clayton D.G. Case/pseudocontrol analysis in genetic association studies: a unified framework for detection of genotype and haplotype associations, gene–gene and gene–environment interactions, and parent-of-origin effects. Genet. Epidemiol. (2004) 26:167–185.[CrossRef][Web of Science][Medline]

  70. Macgregor S., Khan I.A. GAIA: an easy-to-use web-based application for interaction analysis of case–control data. BMC Med. Genet. (2006) 7:34.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Schizophr BullHome page
O. D. Howes and S. Kapur
The Dopamine Hypothesis of Schizophrenia: Version III--The Final Common Pathway
Schizophr Bull, May 1, 2009; 35(3): 549 - 562.
[Abstract] [Full Text] [PDF]

Home page
 Schizophr BullHome page
M. N. Bamne, M. E. Talkowski, K. V. Chowdari, and V. L. Nimgaonkar
Functional Analysis of Upstream Common Polymorphisms of the Dopamine Transporter Gene
Schizophr Bull, March 9, 2009; (2009) sbp005v1.
[Abstract] [Full Text] [PDF]

Home page
 Schizophr BullHome page
J. van Os, B. P. Rutten, and R. Poulton
Gene-Environment Interactions in Schizophrenia: Review of Epidemiological Findings and Future Directions
Schizophr Bull, November 1, 2008; 34(6): 1066 - 1082.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
17/5/747    most recent
ddm347v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Talkowski, M. E.
Right arrow Articles by Nimgaonkar, V. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Talkowski, M. E.
Right arrow Articles by Nimgaonkar, V. L.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?