Human Molecular Genetics Advance Access originally published online on December 24, 2007
Human Molecular Genetics 2008 17(7):1010-1019; doi:10.1093/hmg/ddm373
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differential aggregation and functional impairment induced by polyalanine expansions in FOXL2, a transcription factor involved in cranio-facial and ovarian development
1 Department of Genetics and Development, INSERM U567, Team21 Genomics and Epigenetics of Placental Diseases, 2 CNRS UMR8104 3 Faculté de Médecine, Institut Cochin, Université Paris Descartes, Cochin-Port-Royal, 24 rue du Faubourg St-Jacques, Paris 75014, France 4 INRA-BDR, Jouy en Josas, France 5 Université Denis Diderot, Paris VII, Paris, France
* To whom correspondence should be addressed. Email: veitia{at}cochin.inserm.fr
Received November 26, 2007; Accepted December 19, 2007
| ABSTRACT |
|---|
|
|
|---|
Polyalanine (polyAla) tract expansions have been associated with an increasing number of human diseases. Here, we have undertaken a functional study of the effects of polyAla expansions in the context of the transcription factor FOXL2, involved in cranio-facial and ovarian development. Using two cellular models, we show that FOXL2 polyAla expansions lead to protein mislocalization and aggregation in a length-dependent manner. The fraction of cells containing cytoplasmic staining displays a sigmoidal relationship with respect to the length of the polyAla tract, suggesting the existence of a threshold length above which protein mislocalization occurs. The existence of such a threshold might be rationalized if we consider that the longer the polyAla tract is, the higher its tendency to misfolding or to inducing spurious interactions with cytoplasmic components. To study the intranuclear dynamics of polyAla-expanded FOXL2, we performed fluorescence recovery after photobleaching experiments. The most unexpected result concerned the pathogenic protein containing 19 Ala residues in the run, which was virtually immobile, although this variant does not present a classical aggregation pattern. Luciferase assays and real time RT–PCR of many potential target genes showed that polyAla expansions induce different losses of activity according to the target promoters tested. We provide molecular explanations for these findings. Although our main focus is the mechanisms of pathogenesis of polyAla-expanded proteins, we discuss the potential relevance of polyAla length variation in micro- and macroevolution because polyAla-containing proteins tend to be transcription factors.
| INTRODUCTION |
|---|
|
|
|---|
An increasing number of diseases have been shown to be caused by expansions of polyalanine (polyAla) tracts (1). This class of disorders includes blepharophimosis ptosis epicanthus inversus syndrome (BPES, caused by mutations of FOXL2) (2), synpolydactily type II (HOXD13) (3), cleidocranial dysplasia (RUNX2) (4), holoprosencephaly (ZIC2) (5), hand-foot-genital syndrome (HOXA13) (6), mental retardation with growth hormone deficiency (SOX3) (7), Partington syndrome (ARX) (8), congenital central hypoventilation syndrome (PHOX2B) (9) and occulopharyngeal muscular dystrophy (PABPN1) (10). All these genes, with the exception of PABPN1, encode transcription factors involved in developmental processes. PolyAla tracts are encoded by heterogeneous GCN codon repeats and are usually short and stable during meiosis and mitosis. The longest polyAla tract in the human genome in non-pathogenic condition is found in PHOX2B and involves 20 residues (11).
Here we concentrate on the FOXL2 gene, whose mutations lead to autosomal dominant BPES syndrome. This genetic disorder is characterized by palpebral anomalies associated (BPES type 1) or not (BPES type 2) with premature ovarian failure (POF) (12). FOXL2 encodes a forkhead transcription factor, which plays a key role in ovarian development (2,13,14) and probably in adult ovarian function. In addition to its forkhead DNA-binding domain, FOXL2 carries a polyAla tract of 14 residues strictly conserved among mammals (15,16). Several kinds of mutations have been identified including extragenic rearrangements and mutations in the coding sequence (details in the human FOXL2 mutation database at http://medgen.ugent.be/foxl2). PolyAla expansions of +10 residues (i.e. Ala24) have been identified in
30% of patients and are mainly responsible for BPES type 2 (i.e. absence of ovarian phenotype). However, recent evidence suggests an effect of polyAla expansions on ovarian dysfunction. Some cases of heterozygous Ala24 and one case of Ala26 (17) expansion have been associated with ovarian dysfunction. In addition, we have recently reported the first homozygous FOXL2 mutation leading to a polyAla expansion of +5 residues (Ala19) (18). This mutation segregates in an Indian family where heterozygous mutation carriers are unaffected, whereas homozygous individuals have the typical BPES phenotype, with proven POF in one female. We have shown that the wild-type (WT) FOXL2 protein (i.e. Ala14) exclusively localizes in the nucleus in a rather diffuse manner. On the contrary, a polyAla expansion of +10 alanines (Ala24) leads to strong cytoplasmic staining as well as cytoplasmic and nuclear aggregation in COS-7 cells (19), whereas an expansion of +5 alanines (Ala19) only leads to cytoplasmic staining in a small fraction of transfected cells and no detectable aggregation using fluorescence microscopy (18).
PolyAla expansions in PABPN1 and Arx lead to intranuclear aggregation and cell death (20,21). In these cases the expansions are supposed to induce a toxic gain-of-function. PolyAla expansions in Hoxd13, HOXA13, RUNX2, SOX3 and PHOX2B have been shown to induce cytoplasmic mislocalization and cytoplasmic and nuclear aggregation of these nuclear proteins (19,22–24). In vivo studies of a polyAla expansion in Hoxd13, using a natural mouse mutant spdh (which displays synpolydactily), showed a reduction of the mutant protein level and its cytoplasmic mislocalization (23). Finally in ZIC2, an expansion of +10 alanines (from 15 to 25 residues) does not induce any visible aggregation while a longer expansion (Ala35) induces nuclear and cytoplasmic aggregation (25). Moreover, an impaired capacity of transactivation due to polyAla expansions has been shown for ZIC2, PHOX2B and SOX3 using luciferase reporter constructs (22,24,26). These recent data have given some insights into the comprehension of the pathogenesis associated with polyAla expansions. However, the mechanism by which these expansions operate to induce the pathology remains elusive. Indeed, polyAla expansions may act by several mechanisms. First, they might induce a toxic gain-of-function (neomorphic allele), probably through the formation of aggregates, as it has been suggested for PABPN1 and Arx. Second, they might induce a dominant negative effect (antimorphic allele) through the sequestration of the WT protein, and even other factors (trans-dominant negative), in the aggregates. This hypothesis has been suggested for at least three factors, Hoxd13, FOXL2 and PHOX2B, for which it has been shown that the WT proteins are retained in the aggregates when co-expressed with the expanded proteins. The third hypothesis is that the expansion simply induces a loss-of-function (amorphic or hypomorphic allele depending on the polyAla length) through aggregation and cytoplasmic retention, which prevent the relevant transcription factor to reach its target genes.
In this study, we aim to provide better understanding of the molecular consequences of the expression of an allelic series of FOXL2 leading to various polyAla expansions, through the analysis of protein localization, mobility and function. This study, taking FOXL2 as a model, not only provides insights about the process of abnormal protein aggregation, but also about the way polyAla length might regulate transcription factor activity.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
PolyAla expansions in FOXL2 lead to its sequestration in the cytoplasm and its aggregation in a length-dependent manner
To characterize the impact of the length of polyAla expansions on the localization and aggregation of FOXL2, we generated a series of constructs driving the expression of FOXL2 containing polyAla tracts of different lengths (FOXL2-Ala14, 17, 19, 20, 21, 24, 30, 37, respectively) in fusion with the green fluorescent protein (GFP). These constructs were transiently transfected in two different cell lines: COS-7 (Monkey Cercopithecus aethiops kidney cell line) and KGN (a human granulosa-like cell line) (27). We evaluated the percentage of cells displaying cytoplasmic staining and aggregation, as well as, nuclear staining and aggregation by direct visualization using fluorescence microscopy. In both cell lines, cytoplasmic staining became statistically significant for FOXL2 containing 19 alanines and increased with the length of the polyAla (Fig. 1A). For Ala37, 100% of the cells displayed cytoplasmic staining.
|
Several not mutually exclusive hypotheses might explain the cytoplasmic mislocalization of FOXL2. First, polyAla expansions might induce a protein misfolding that disturbs interactions with nuclear transporters. We have shown that FOXL2 contains a classical nuclear localization signal (NLS) and a non-canonical one (28). Second, oligomerization might lead to the presence of structures whose size is incompatible with the import through the nuclear pores, yet small enough not to be considered as aggregates using light microscopy. This might explain the presence of diffuse fluorescence observed in the cytoplasm of a fraction of transfected cells. Alternatively, there might be cytoplasmic components that interact with long polyAla tracts and retain the mutant protein. However, even if we do not know the details of FOXL2 nuclear import, cytoplasmic mislocalization of the mutant cannot be explained by a saturation of the transporters because it is never observed for the WT protein.
To evaluate a potential link between cytoplasmic staining and aggregation, we calculated the ratios between the percentage of cells displaying cytoplasmic aggregation to those with cytoplasmic staining. If the two processes were directly linked, we would expect a constant ratio. However, we found that these ratios increased with the length of the polyAla (Fig. 1B).
We further analyzed the level of cytoplasmic staining according to the length of the polyAla repeat. The graphs representing the levels of cytoplasmic staining versus the number of alanines in the repeat can be fitted to sigmoids and the inflexion points were graphically determined at
20 Ala residues for both cell lines (Fig. 1C). This suggests the existence of a threshold for the polyAla length above which protein mislocalization occurs. The existence of such a threshold might be explained considering that the longer the polyAla tract is, the higher its tendency to misfolding or to inducing spurious interactions with cytoplasmic components in a cooperative way. Interestingly, a length of 20 residues (as our threshold) corresponds to the longest polyAla tract found in mammals in non-pathogenic conditions, observed in PHOX2B (11). This might be a selected property of the polyAla-containing sub-proteome, which consists mainly of transcription factors (11,29) to avoid cytoplasmic mislocalization and aggregation upon an even slight increase of polyAla length.
Nuclear staining was detected in almost 100% of the cells transfected with constructs ranging from Ala14 to Ala24 in both cell lines, and this percentage decreased for Ala30 and Ala37 proteins (Fig. 2A). In COS-7 cells, nuclear aggregation was weak whatever the expressed protein (2–15% of cells) and the highest level of nuclear aggregation was observed for Ala24 (i.e. significantly higher than for Ala21 and Ala30, Fig. 2A). This can be explained by the high levels of cytoplasmic aggregation and retention of FOXL2-Ala30 and 37, which hinders or even prevents nuclear import. Thus, when considering the ratio of the percentage of cells displaying nuclear aggregation over nuclear staining, FOXL2-Ala30 and 37 were not statistically different from Ala24 (Fig. 2B). In KGN cells, nuclear aggregation was stronger and rose to over 75% of cells displaying nuclear staining for Ala24 to 37. KGN cells are able to express FOXL2 but since we are overexpressing both WT and mutant exogenous FOXL2, the contribution of the endogenous protein to the effects observed can be disregarded. The ratios nuclear aggregation/nuclear staining for the various polyAla lengths were positively correlated with the ratios cytoplasmic aggregation/cytoplasmic staining in both cell lines (r = 0.84, P = 0.009 for COS-7 and r = 0.97, P = 9.10–5 in KGN, Fig. 2A and B). This behaviour suggests that these FOXL2 variants are intrinsically aggregation prone in both subcellular compartments.
|
We have also found that the proportion of cells displaying aggregation as a function of the polyAla length are well correlated in both cell lines but are more important, in absolute terms in KGN cells, particularly for nuclear aggregation. However, this is not due to a higher expression of FOXL2 variants in KGN cells, as COS-7 cells display an expression level about three times higher than that of KGN cells (estimated as explained in Materials and Methods section). Then, the difference in aggregation between the two cell lines suggests the existence of a strong impact of the cellular proteome on this process. This can be due to different expression levels of proteins involved in folding and of modulators of the aggregation process such as heat shock proteins, ubiquitin conjugation or the proteasomes. It cannot be excluded, although unlikely, the existence of a species-specific effect on protein aggregation (Homo sapiens versus C. aethiops).
PolyAla expansions affect the intranuclear mobility and transcriptional activity of FOXL2
In order to evaluate whether polyAla expansions impair intranuclear mobility of FOXL2 even when no aggregation is detectable by fluorescence microscopy, we used fluorescence recovery after photobleaching (FRAP) on COS-7 transfected cells. This assay consists of bleaching a small portion of a cell expressing a fluorescently tagged FOXL2 and measuring the recovery of fluorescence in the bleached portion. The measure of the time required to recover half the maximum of fluorescence (t1/2) is inversely proportional to protein mobility. We focused on intranuclear protein mobility and tested all our constructs except Ala30 and Ala37, which display only weak nuclear staining (Fig. 3). Recovery of fluorescence of FOXL2-Ala17 displayed an average t1/2 of 14.4 s (±4.7 s), which was significantly higher than that of the WT protein (8.5 ± 5.5 s, P = 0.03). The most striking result concerned Ala19 protein, which was found to be virtually immobile. Interestingly, this variant does not present with aggregation detectable in our light microscopy conditions. As expected, the mobility of proteins containing >20 Ala residues in the tract was also severely compromised in the nuclear compartment. In all these cases the t1/2 could not be determined.
|
Next, we studied the impact of aggregation, mislocalization and altered mobility of polyAla-expanded FOXL2 on its transcriptional activity. For this, we used two reporter constructs previously described: 3XGRAS-luciferase (GRAS-Luc) and DK3-luciferase (DK3-Luc). The GRAS-Luc construct contains three repeats of the GnRH receptor activating sequence (GRAS) recognized by FOXL2, coupled to the firefly luciferase reporter gene (30). The DK3-Luc construct corresponds to 1055 bp of the FOXL2 promoter of the goat also coupled to the firefly luciferase reporter (31). Both constructs have been shown to be activated by FOXL2 in cellular models. We performed the transfections in KGN cells that naturally express FOXL2 and constitute a suitable cellular model to study its activity. The cells were transfected with (i) the GRAS-Luc or DK3-Luc construct and (ii) one of the construct coding for a FOXL2-GFP variant or the empty GFP vector. As expected, in both cases WT FOXL2 (Ala14) induced an increase of luciferase activity when compared with the GFP empty vector (Fig. 4). Interestingly, the various polyAla-expanded versions showed different behaviours according to the reporter system used. With the GRAS-Luc construct, the activity of Ala17 was not significantly different from that of Ala14, whereas all other constructs failed to increase the reporter gene expression (i.e. activity similar to that of the empty vector in pair-wise comparisons). In contrast, with DK3-Luc reporter, the luciferase activity observed for Ala17, 19, 20 and 21 was not significantly different from that of Ala14, whereas lack of transcriptional activity appeared for FOXL2 containing 24 Ala residues or more in the repeat.
|
In spite of the reduced mobility of the FOXL2-Ala17, the luciferase assays revealed that this variant displays a transcriptional activity similar to that of the WT with both reporter systems. This shows that a mild decrease in the mobility of the protein does not automatically translate into a significant reduction of transcriptional activity. If this is so, why has an allele encoding FOXL2-Ala17 never been detected in normal populations? We can propose several explanations: (i) such an allele might be difficult to be generated by either polymerase slippage or unequal crossing over, (ii) it cannot be excluded that FOXL2-Ala17 has a reduced activity on a specific set of target promoters and (iii) alternatively, a decreased mobility may reflect some aggregation and misfolding that do not affect the protein activity in standard conditions, whereas some circumstances, such as cellular stress, might induce a significant loss of activity. These conditions might be encountered either in development or during adult life. Since this factor is essential for female fertility, any slightly functionally impaired variant would be counterselected, which could explain the extreme conservation of the length of the FOXL2 polyAla in mammals (15,16).
The luciferase assays have shown that longer polyAla expansions induce a loss of activity that is different according to the promoters tested. This result suggests the existence of different sensitivities of the target promoters to the decreased availability of FOXL2 due to aggregation and mislocalization. This leads to situations, epitomized by the Ala19 variant, where the protein appears to be non-functional when acting on the GRAS promoter, whereas it behaves like the WT on the DK3 promoter.
In order to further test the idea that different promoters have different sensitivities to a decreased availability of FOXL2, we studied the activation of 17 genes whose expression has been shown to be increased by FOXL2 overexpression in KGN cells and thus are putative target genes having an impact on different biological pathways (32). These genes are mediators of inflammation and apoptosis, transcriptional regulators, factors involved in cholesterol metabolism and factors involved in reactive oxygen species detoxification. Specifically, we analyzed by real time RT–PCR the expression levels of the relevant genes in cells transfected with either FOXL2-Ala14, FOXL2-Ala24 or an empty vector (mock control). Then, we calculated the ratios between the fold induction levels of the relevant genes induced by the overexpression of FOXL2-Ala14 over FOXL2-Ala24 (Ala14/Mock/Ala24/Mock). A ratio of 1 represents identical transcriptional activity for Ala14 and Ala24. For 10 out of the 17 genes, a statistically significant increased ratio was observed. No significant difference was observed for the remaining seven genes (Fig. 5).
|
Theory predicts that different target promoters will have different sensitivities to decreased amounts of available (i.e. soluble) FOXL2. Two non-exclusive models can be proposed (Fig. 6). When promoters contain the same number of binding sites, the ones displaying a higher affinity for FOXL2 will be fully activated with a lower concentration of this factor (being less sensitive to its decreased availability). Otherwise, when promoters contain sites with similar affinity for FOXL2, the ones displaying a higher number of binding sites are expected to be less sensitive to a decrease of available FOXL2 (33).
|
General discussion
Aggregation seems to be a common feature of polyAla-expanded proteins and has been described for almost all other factors carrying pathogenic polyAla expansions. In particular, five of these factors (HOXD13, HOXA13, RUNX2, SOX3 and PHOX2B) display similar localization/aggregation features as FOXL2. Interestingly, studies of the intracellular localization of homopolymeric amino acids tracts have shown that polyAla tracts ranging from 29 to 35 residues fused to the YFP (yellow fluorescent protein) are located exclusively in the cytoplasm (whereas the YFP alone is located in a diffuse manner in the nucleus and the cytoplasm) but do not show any obvious aggregation (34,35). These fusion proteins do not contain any NLS and nuclear localization of the YFP is due to passive diffusion as it is a small protein (30 kDa). The strict cytoplasmic staining of proteins containing at least 29 alanines is supposed to be a consequence of a self-association mechanism dependent on polyAla length that leads to oligomers unable to pass through the nuclear pores. However, as mentioned above, long polyAla tract might also have a high affinity for cytoplasmic components, which might explain cytoplasmic retention. One of the most noticeable differences between YFP fusion proteins and FOXL2 is that aggregation appears from 19 Ala in FOXL2, whereas it is undetectable even for Ala35-YFP. This result suggests that a long polyAla tract alone is not sufficient to induce aggregation but may prevent nuclear localization. Then, the aggregation observed for FOXL2 and other factors, in particular HOXD13, HOXA13, RUNX2, SOX3 and PHOX2B, may be due to other elements common to these proteins. Indeed, all these proteins have other amino acid runs in particular polyGly, polyPro, polyHis or polyGln (29,36). We can hypothesize that these sequences might play a role in aggregation when the polyAla tract is expanded. On the other hand, the amino acids that flank the polyAla influence the conformation of this region, which might modulate aggregation. For instance, simulations have suggested that four of the seven A residues in the peptide Ac-X2-A7-O2-NH2 (where X denotes diaminobutyric acid; A, alanine and O, ornithine) have a conformational preference for β-strand (an aggregation prone structure) or extended structure (37), whereas a similar polyAla tract flanked by lysine residues in Ac-K-A7-K-NH2 exists predominantly in
-helical conformation (38,39). The pathogenicity of polyAla expansions in FOXL2 depends on several parameters including the length of the expansion, the dose of the expanded proteins and the affected tissue. Indeed, heterozygous expansions of Ala24 and Ala26 always lead to the palpebral defect. This is also the case for essentially all other mutations that have been reported in this gene. The Ala24 and Ala26 variants in heterozygous state must lead to a nuclear concentration insufficient to trigger the expression of a set of genes which are important for eyelid development, in a similar way as a nonsense mutation. In contrast, the ovarian phenotype appears only in a few cases among patients harbouring heterozygous polyAla expansions, while classical null mutations as premature stop codons lead to severe ovarian dysfunction. Thus, the ovary appears to be less sensitive to the effects of polyAla-expanded FOXL2.
In molecular terms, the difference in sensitivity between the eyelid and the ovary may have several not mutually exclusive explanations. The main target promoters in the eyelids might require a higher dose of active FOXL2 (lower number of binding sites or lower affinity?) than those in the ovary (Fig. 6A). An alternative explanation is that mislocalization and aggregation of the mutant FOXL2 are stronger in the eyelids due to the proteomic context and then the active fraction is reduced compared with the ovary (Fig. 6B). In the case of the ovary, the existence of inter-individual variability has been reported (Ala24 patients with and without POF). This can be explained by the existence of polymorphisms in important promoters that decrease their affinity for active FOXL2. Different environmental conditions may also have an impact on the development of ovarian dysfunction in some individuals. Polymorphic differences in the ovarian proteome (such as chaperone or proteasome concentration) might also contribute to explain inter-individual differences in response to polyAla expansions. Indeed, we have shown that the cellular context strongly influences the aggregation process.
Although our main focus is the mechanisms of pathogenesis, we cannot overlook the potential relevance of polyAla length variation in evolution. In this context, it is interesting to note that polyAla-containing proteins tend to be either transcription factors (often involved in development) or RNA-binding proteins. Moreover, it is also known that the longer the polyAla run is, the more susceptible it is of being polymorphic (11). Thus, in normal conditions (WT), there might be an equilibrium between available and aggregated protein forms, which regulates the pool of active factors. Depending on the polyAla length, this equilibrium may be shifted towards an increase or a decrease of active forms that may have a functional impact. As we have shown above, the length of the polyAla tract can dramatically alter transactivation capacity. Thus, polymorphic polyAla tracts might explain wide morphological and physiological variation within a species. For instance, Fondon and Garner (40) have found a correlation between cranio-facial morphological parameters in different dog breeds and the ratio of the lengths polyGln over polyAla in Runx-2. The extreme phenotypes associated with the lower polyGln/polyAla ratios (i.e. shorter midface length) are similar to the clinical features of cleidocranial dysplasia (CCD), a human syndrome caused by haploinsufficiency of Runx-2. Interestingly, a mild form of familial CCD results from a 10 Ala expansion in the polyAla of Runx-2. PolyAla-containing proteins may also have an impact at a macro-evolutionary scale. Consider, for instance, that the Hox proteins, that are key determinants of development, form the largest polyAla-containing family in human (11). However, in other vertebrates like fishes and birds, the polyAla tracts in the corresponding Hox proteins tend to be shorter or absent. Given that this may have a functional impact, as shown in this study, the pervasive differences in polyAla length in these crucial transcription factors might explain interspecies differences as well (11,41).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid constructs
The constructs expressing FOXL2-Ala14-GFP and FOXL2-Ala24-GFP are those described in (19). FOXL2-Ala(17–37)-GFP were obtained by junction-PCR (42). We amplified the ORF of FOXL2 in two fragments 5' and 3' using the plasmid FOXL2-Ala14-GFP as template. PolyAla-encoding tails were introduced using junction primers containing a repeat of 16 GCA (alanine codon) in order to obtain several lengths of the polyAla tract. The first fragment was amplified using primers FOXL2-
(5'ATGATGGCCAGTTACCCCGAG 3') and multi-Ala-reverse (5'(TGC)16CATCTGGCAGGAGGC 3'). The second fragment was amplified using primers multi-Ala-forward (5'(GCA)16GGCCCCGGTAGCCCT 3') and FOXL2-
(5'GATCGAGGCGCGAATGCAGCGCG 3'). After the first amplification, both fragments were mixed and amplified together with primers FOXL2-
and FOXL2-
to obtain the full-length FOXL2. Then, the final PCR fragments were cloned into pCDNA3.1-CT-GFP-topoTA cloning vector (Invitrogen, CA, USA) and constructs containing inserts in the right direction were selected by PCR and sequenced. Plasmids GRAS-Luc and DK3-Luc are generous gifts of B. Ellsworth (30) and E. Pailhoux (31), respectively.
Cell culture and transfection
COS-7 cells were maintained in Dulbecco's modified Eagle's medium (DMEM; Gibco-Invitrogen, CA, USA), KGN cells were maintained in DMEM-F12 (Gibco-Invitrogen) and both media were supplemented with 10% fetal calf serum (Gibco-Invitrogen) and 1% penicillin/streptomycin. Cells were seeded 24 h before transfection at 30 (COS-7) and 50% (KGN) of confluence. Cells were seeded in 24-well plates containing sterile coverslips for direct GFP visualization, 24-well plates for luciferase assays or 25 cm3 flasks for RNA extraction. The cells were transfected using the calcium phosphate method (43), and rinsed 24 h after transfection. Quantities of plasmid DNA used for transfections were, respectively, 1 µg per well for GFP visualization, 2 µg per plate for FRAP, total 1 µg per well for luciferase assays (i.e. 570 ng of reporter, 400 ng of GFP constructs and 30 ng of renilla) and 12.5 µg for RNA experiments. For KGN cells, which exhibit a low transfection efficiency (<30%), a second transfection was performed (tandem transfection) 24 h after the first one. We have checked that in terms of morphology there is no change after a tandem with respect to a normal transfection. Tandem transfection simply improves vector delivery efficiency (the percentages of nuclear aggregation and cytoplasmic staining do not change).
FRAP experiments
COS-7 cells were transfected as described above in 35 mM plates, perforated and containing a sterile glass coverslip. A Zeiss confocal LSM 510 META was used for all photobleaching experiments and fluorescent image acquisitions, 48 h after transfection. The 30 mW Argon/Neon laser at 100% power was used for photobleaching (four times every 2 s). A small section of the nucleus was bleached, and images were collected every 1.632 s for 4 min. Data were collected from 5 to 10 different cells for each FOXL2 variant. Image analysis was performed with ImageJ imaging software. Photobleaching and quantification was performed as described (44–46).
Fluorescence microscopy
Forty-eight hours after transfection, cells transfected over coverslids were washed with phosphate-buffered saline and fixed for 15 min with 4% paraformaldehyde. Nuclei were stained with Hoechst regent (1/500) and the coverslips were mounted on slides using fluorescence mounting medium (DAKO, CA, USA). Transfected cells were visualized by epifluorescence microscopy (Nikon E600). Nuclear and cytoplasmic staining/aggregation were scored visually as described (19). For each construct, 200–300 GFP-positive COS-7 and KGN cells were analyzed from three different experiments.
Estimation of the fluorescence/expression level of FOXl2 in COS-7 and KGN cells
In order to estimate the fluorescence/expression level of FOXL2 in both cell lines, we determined the minimum exposure time under which the cell fluorescence was imperceptible using the Nikon E600 microscope for 150 cells.
Luciferase assay
The biological activity of the several polyAla-expanded FOXL2 and the GFP empty vector (negative control) on target reporter constructs was assessed by the Dual-Luciferase® Reporter Assay System (Promega, Madison, WI, USA). As luciferase reporter construct we used GRAS-Luc and DK3-Luc. KGN cells were transfected as described above. A Renilla luciferase vector (Promega) was co-transfected in all experiments to monitor transfection efficiency. All luciferase results are reported as relative light units. For each replicate (five for each experiment), the firefly activity observed was divided by the activity recorded from Renilla luciferase vector, and the mean value and standard deviation of the five replicates were calculated. Luminescence was measured using EG-G Berthold Lumat LB 9507 luminometer. Statistical significances were evaluated using a Student t-test.
RNA extraction and real time RT–PCR
Twenty-four hours after the second transfection of KGN cells, total RNA was extracted using the TRIzol Reagent (Invitrogen) according to the manufacturer's instructions. RNAs were reverse transcribed using polydT primers and the SuperScript II reverse transcriptase (Invitrogen). Quantitative real time PCR was performed as described previously (32), using the Platinum SYBR Green qPCR SuperMix-UDG system (Invitrogen) and the Roche Light-Cycler PCR apparatus. Each experiment was performed five times. Statistical significances were calculated using a one-sample t-test which compare observed and expected means (hypothetical mean value = 1) (http://www.graphpad.com/quickcalcs/OneSampleT1.cfm).
| FUNDING |
|---|
|
|
|---|
This work was supported by the French Ministry of Research, the INSERM. L.M. is funded by Fondation pour la Recherche Médicale (FRM). F.B. is supported by a Pfizer Les Conventions Industrielles de Formation par la Recherche fellowship.
| Acknowledgements |
|---|
The authors are specially grateful to Pierre Bourdoncle from the imaging platform of the Institut Cochin for the help with the FRAP experiments. We thank Dr Sandrine Barbaux and Bérénice Benayoun for their helpful comments and discussions. We also thank Dr Anthony Guernec for his help with luciferase experiments.
Conflict of Interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Brown L.Y., Brown S.A. Alanine tracts: the expanding story of human illness and trinucleotide repeats. Trends Genet. (2004) 20:51–58.[CrossRef][Web of Science][Medline]
- Crisponi L., Deiana M., Loi A., Chiappe F., Uda M., Amati P., Bisceglia L., Zelante L., Nagaraja R., Porcu S., et al. The putative forkhead transcription factor FOXL2 is mutated in blepharophimosis/ptosis/epicanthus inversus syndrome. Nat. Genet. (2001) 27:159–166.[CrossRef][Web of Science][Medline]
- Muragaki Y., Mundlos S., Upton J., Olsen B.R. Altered growth and branching patterns in synpolydactyly caused by mutations in HOXD13. Science (1996) 272:548–551.[Abstract]
- Mundlos S., Otto F., Mundlos C., Mulliken J.B., Aylsworth A.S., Albright S., Lindhout D., Cole W.G., Henn W., Knoll J.H., et al. Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell (1997) 89:773–779.[CrossRef][Web of Science][Medline]
-
Brown L.Y., Odent S., David V., Blayau M., Dubourg C., Apacik C., Delgado M.A., Hall B.D., Reynolds J.F., Sommer A., et al. Holoprosencephaly due to mutations in ZIC2: alanine tract expansion mutations may be caused by parental somatic recombination. Hum. Mol. Genet. (2001) 10:791–796.
[Abstract/Free Full Text] - Utsch B., Becker K., Brock D., Lentze M.J., Bidlingmaier F., Ludwig M. A novel stable polyalanine [poly(A)] expansion in the HOXA13 gene associated with hand-foot-genital syndrome: proper function of poly(A)-harbouring transcription factors depends on a critical repeat length? Hum. Genet. (2002) 110:488–494.[CrossRef][Web of Science][Medline]
- Laumonnier F., Ronce N., Hamel B.C., Thomas P., Lespinasse J., Raynaud M., Paringaux C., Van Bokhoven H., Kalscheuer V., Fryns J.P., et al. Transcription factor SOX3 is involved in X-linked mental retardation with growth hormone deficiency. Am. J. Hum. Genet. (2002) 71:1450–1455.[CrossRef][Web of Science][Medline]
- Stromme P., Mangelsdorf M.E., Shaw M.A., Lower K.M., Lewis S.M., Bruyere H., Lutcherath V., Gedeon A.K., Wallace R.H., Scheffer I.E., et al. Mutations in the human ortholog of Aristaless cause X-linked mental retardation and epilepsy. Nat. Genet. (2002) 30:441–445.[CrossRef][Web of Science][Medline]
- Amiel J., Laudier B., Attie-Bitach T., Trang H., de Pontual L., Gener B., Trochet D., Etchevers H., Ray P., Simonneau M., et al. Polyalanine expansion and frameshift mutations of the paired-like homeobox gene PHOX2B in congenital central hypoventilation syndrome. Nat. Genet. (2003) 33:459–461.[CrossRef][Web of Science][Medline]
- Brais B., Bouchard J.P., Xie Y.G., Rochefort D.L., Chretien N., Tome F.M., Lafreniere R.G., Rommens J.M., Uyama E., Nohira O., et al. Short GCG expansions in the PABP2 gene cause oculopharyngeal muscular dystrophy. Nat. Genet. (1998) 18:164–167.[CrossRef][Web of Science][Medline]
-
Lavoie H., Debeane F., Trinh Q.D., Turcotte J.F., Corbeil-Girard L.P., Dicaire M.J., Saint-Denis A., Page M., Rouleau G.A., Brais B. Polymorphism, shared functions and convergent evolution of genes with sequences coding for polyalanine domains. Hum. Mol. Genet. (2003) 12:2967–2979.
[Abstract/Free Full Text] - Zlotogora J., Sagi M., Cohen T. The blepharophimosis, ptosis, and epicanthus inversus syndrome: delineation of two types. Am. J. Hum. Genet. (1983) 35:1020–1027.[Web of Science][Medline]
-
Ottolenghi C., Omari S., Garcia-Ortiz J.E., Uda M., Crisponi L., Forabosco A., Pilia G., Schlessinger D. Foxl2 is required for commitment to ovary differentiation. Hum. Mol. Genet. (2005) 14:2053–2062.
[Abstract/Free Full Text] -
Schmidt D., Ovitt C.E., Anlag K., Fehsenfeld S., Gredsted L., Treier A.C., Treier M. The murine winged-helix transcription factor Foxl2 is required for granulosa cell differentiation and ovary maintenance. Development (2004) 131:933–942.
[Abstract/Free Full Text] - Cocquet J., De Baere E., Gareil M., Pannetier M., Xia X., Fellous M., Veitia R.A. Structure, evolution and expression of the FOXL2 transcription unit. Cytogenet. Genome Res. (2003) 101:206–211.[CrossRef][Web of Science][Medline]
-
Cocquet J., Pailhoux E., Jaubert F., Servel N., Xia X., Pannetier M., De Baere E., Messiaen L., Cotinot C., Fellous M., et al. Evolution and expression of FOXL2. J. Med. Genet. (2002) 39:916–921.
[Free Full Text] -
Raile K., Stobbe H., Trobs R.B., Kiess W., Pfaffle R. A new heterozygous mutation of the FOXL2 gene is associated with a large ovarian cyst and ovarian dysfunction in an adolescent girl with blepharophimosis/ptosis/epicanthus inversus syndrome. Eur. J. Endocrinol. (2005) 153:353–358.
[Abstract/Free Full Text] - Nallathambi J., Moumne L., De Baere E., Beysen D., Usha K., Sundaresan P., Veitia R.A. A novel polyalanine expansion in FOXL2: the first evidence for a recessive form of the blepharophimosis syndrome (BPES) associated with ovarian dysfunction. Hum. Genet. (2007) 121:107–112.[CrossRef][Web of Science][Medline]
-
Caburet S., Demarez A., Moumne L., Fellous M., De Baere E., Veitia R.A. A recurrent polyalanine expansion in the transcription factor FOXL2 induces extensive nuclear and cytoplasmic protein aggregation. J. Med. Genet. (2004) 41:932–936.
[Abstract/Free Full Text] -
Calado A., Tome F.M., Brais B., Rouleau G.A., Kuhn U., Wahle E., Carmo-Fonseca M. Nuclear inclusions in oculopharyngeal muscular dystrophy consist of poly(A) binding protein 2 aggregates which sequester poly(A) RNA. Hum. Mol. Genet. (2000) 9:2321–2328.
[Abstract/Free Full Text] -
Nasrallah I.M., Minarcik J.C., Golden J.A. A polyalanine tract expansion in Arx forms intranuclear inclusions and results in increased cell death. J. Cell Biol. (2004) 167:411–416.
[Abstract/Free Full Text] -
Bachetti T., Matera I., Borghini S., Di Duca M., Ravazzolo R., Ceccherini I. Distinct pathogenetic mechanisms for PHOX2B associated polyalanine expansions and frameshift mutations in congenital central hypoventilation syndrome. Hum. Mol. Genet. (2005) 14:1815–1824.
[Abstract/Free Full Text] -
Albrecht A.N., Kornak U., Boddrich A., Suring K., Robinson P.N., Stiege A.C., Lurz R., Stricker S., Wanker E.E., Mundlos S. A molecular pathogenesis for transcription factor associated poly-alanine tract expansions. Hum. Mol. Genet. (2004) 13:2351–2359.
[Abstract/Free Full Text] -
Trochet D., Hong S.J., Lim J.K., Brunet J.F., Munnich A., Kim K.S., Lyonnet S., Goridis C., Amiel J. Molecular consequences of PHOX2B missense, frameshift and alanine expansion mutations leading to autonomic dysfunction. Hum. Mol. Genet. (2005) 14:3697–3708.
[Abstract/Free Full Text] -
Brown L., Paraso M., Arkell R., Brown S. In vitro analysis of partial loss-of-function ZIC2 mutations in holoprosencephaly: alanine tract expansion modulates DNA binding and transactivation. Hum. Mol. Genet. (2005) 14:411–420.
[Abstract/Free Full Text] - Wong J., Farlie P., Holbert S., Lockhart P., Thomas P.Q. Polyalanine expansion mutations in the X-linked hypopituitarism gene SOX3 result in aggresome formation and impaired transactivation. Front. Biosci. (2007) 12:2085–2095.[CrossRef][Web of Science][Medline]
-
Nishi Y., Yanase T., Mu Y., Oba K., Ichino I., Saito M., Nomura M., Mukasa C., Okabe T., Goto K., et al. Establishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN, that expresses functional follicle-stimulating hormone receptor. Endocrinology (2001) 142:437–445.
[Abstract/Free Full Text] - Moumné L., Batista F., Benayoun B., Nallathambi J., Fellous M., Sundaresan P., Veitia R.A. The mutations and potential targets of the forkhead transcription factor FOXL2. Mol. Cell. Endocrinol. doi:10.1016/j.mce.2007.11.006.
-
Cocquet J., De Baere E., Caburet S., Veitia R.A. Compositional biases and polyalanine runs in humans. Genetics (2003) 165:1613–1617.
[Abstract/Free Full Text] - Ellsworth B.S., Burns A.T., Escudero K.W., Duval D.L., Nelson S.E., Clay C.M. The gonadotropin releasing hormone (GnRH) receptor activating sequence (GRAS) is a composite regulatory element that interacts with multiple classes of transcription factors including Smads, AP-1 and a forkhead DNA binding protein. Mol. Cell. Endocrinol. (2003) 206:93–111.[CrossRef][Web of Science][Medline]
-
Pannetier M., Fabre S., Batista F., Kocer A., Renault L., Jolivet G., Mandon-Pepin B., Cotinot C., Veitia R., Pailhoux E. FOXL2 activates P450 aromatase gene transcription: towards a better characterization of the early steps of mammalian ovarian development. J. Mol. Endocrinol. (2006) 36:399–413.
[Abstract/Free Full Text] -
Batista F., Vaiman D., Dausset J., Fellous M., Veitia R.A. Potential targets of FOXL2, a transcription factor involved in craniofacial and follicular development, identified by transcriptomics. Proc. Natl. Acad. Sci. USA (2007) 104:3330–3335.
[Abstract/Free Full Text] - Veitia R.A. A sigmoidal transcriptional response: cooperativity, synergy and dosage effects. Biol. Rev. Camb. Philos. Soc. (2003) 78:149–170.[Medline]
-
Oma Y., Kino Y., Sasagawa N., Ishiura S. Intracellular localization of homopolymeric amino acid-containing proteins expressed in mammalian cells. J. Biol. Chem. (2004) 279:21217–21222.
[Abstract/Free Full Text] - Oma Y., Kino Y., Toriumi K., Sasagawa N., Ishiura S. Interactions between homopolymeric amino acids (HPAAs). Protein Sci (2007) 16:2195–2204.[CrossRef][Web of Science][Medline]
-
Karlin S., Chen C., Gentles A.J., Cleary M. Associations between human disease genes and overlapping gene groups and multiple amino acid runs. Proc. Natl. Acad. Sci. USA (2002) 99:17008–17013.
[Abstract/Free Full Text] -
Shi Z., Olson C.A., Rose G.D., Baldwin R.L., Kallenbach N.R. Polyproline II structure in a sequence of seven alanine residues. Proc. Natl. Acad. Sci. USA (2002) 99:9190–9195.
[Abstract/Free Full Text] - Shinchuk L.M., Sharma D., Blondelle S.E., Reixach N., Inouye H., Kirschner D.A. Poly-(L-alanine) expansions form core beta-sheets that nucleate amyloid assembly. Proteins (2005) 61:579–589.[CrossRef][Web of Science][Medline]
- Blondelle S.E., Forood B., Houghten R.A., Perez-Paya E. Polyalanine-based peptides as models for self-associated beta-pleated-sheet complexes. Biochemistry (1997) 36:8393–8400.[CrossRef][Web of Science][Medline]
-
Fondon J.W. III, Garner H.R. Molecular origins of rapid and continuous morphological evolution. Proc. Natl. Acad. Sci. USA (2004) 101:18058–18063.
[Abstract/Free Full Text] -
Caburet S., Vaiman D., Veitia R.A. A genomic basis for the evolution of vertebrate transcription factors containing amino Acid runs. Genetics (2004) 167:1813–1820.
[Abstract/Free Full Text] -
Higuchi R., Krummel B., Saiki R.K. A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. (1988) 16:7351–7367.
[Abstract/Free Full Text] - Sambrook J., Russel D. Molecular Cloning. A Laboratory Manual (2001) 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
-
Cheutin T., McNairn A.J., Jenuwein T., Gilbert D.M., Singh P.B., Misteli T. Maintenance of stable heterochromatin domains by dynamic HP1 binding. Science (2003) 299:721–725.
[Abstract/Free Full Text] - Lever M.A., Th'ng J.P., Sun X., Hendzel M.J. Rapid exchange of histone H1.1 on chromatin in living human cells. Nature (2000) 408:873–876.[CrossRef][Medline]
-
Phair R.D., Gorski S.A., Misteli T. Measurement of dynamic protein binding to chromatin in vivo, using photobleaching microscopy. Methods Enzymol (2004) 375:393–414.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
A. Dipietromaria, B. A. Benayoun, A.-L. Todeschini, I. Rivals, C. Bazin, and R. A. Veitia Towards a functional classification of pathogenic FOXL2 mutations using transactivation reporter systems Hum. Mol. Genet., September 1, 2009; 18(17): 3324 - 3333. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xu, H. Lei, H. Dong, L. Zhang, Q. Qin, J. Gao, Y. Zou, and X. Yan FOXL2 gene mutations and blepharophimosis-ptosis-epicanthus inversus syndrome (BPES): a novel mutation detected in a Chinese family and a statistic model for summarizing previous reported records Mutagenesis, September 1, 2009; 24(5): 447 - 453. [Abstract] [Full Text] [PDF] |
||||
![]() |
P Laissue, B Lakhal, B A Benayoun, A Dipietromaria, R Braham, H Elghezal, P Philibert, A Saad, C Sultan, M Fellous, et al. Functional evidence implicating FOXL2 in non-syndromic premature ovarian failure and in the regulation of the transcription factor OSR2 J. Med. Genet., July 1, 2009; 46(7): 455 - 457. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Benayoun, F. Batista, J. Auer, A. Dipietromaria, D. L'Hote, E. De Baere, and R. A. Veitia Positive and negative feedback regulates the transcription factor FOXL2 in response to cell stress: evidence for a regulatory imbalance induced by disease-causing mutations Hum. Mol. Genet., February 15, 2009; 18(4): 632 - 644. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Benayoun, S. Caburet, A. Dipietromaria, M. Bailly-Bechet, F. Batista, M. Fellous, D. Vaiman, and R. A. Veitia The identification and characterization of a FOXL2 response element provides insights into the pathogenesis of mutant alleles Hum. Mol. Genet., October 15, 2008; 17(20): 3118 - 3127. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Beysen, L. Moumne, R. Veitia, H. Peters, B. P. Leroy, A. De Paepe, and E. De Baere Missense mutations in the forkhead domain of FOXL2 lead to subcellular mislocalization, protein aggregation and impaired transactivation Hum. Mol. Genet., July 1, 2008; 17(13): 2030 - 2038. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








