Human Molecular Genetics Advance Access originally published online on September 3, 2009
Human Molecular Genetics 2009 18(23):4576-4589; doi:10.1093/hmg/ddp425
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Interaction between environmental and genetic factors modulates schizophrenic endophenotypes in the Snap-25 mouse mutant blind-drunk
MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, South Parks Road, Oxford OX1 3QX, UK
* To whom correspondence should be addressed. Tel: +44 1865285864; Fax: +44 1865285878; Email: peter.oliver{at}dpag.ox.ac.uk
Received June 23, 2009; Accepted September 2, 2009
| ABSTRACT |
|---|
|
|
|---|
To understand the pathophysiology of neuropsychiatric disorders such as schizophrenia requires consideration of multiple genetic and non-genetic factors. However, very little is known about the consequences of combining models of synaptic dysfunction with controlled environmental manipulations. Therefore, to generate new insights into gene–environment interactions and complex behaviour, we examined the influence of variable prenatal stress (PNS) on two mouse lines with mutations in synaptosomal-associated protein of 25 kDa (Snap-25): the blind-drunk (Bdr) point mutant and heterozygous Snap-25 knockout mice. Neonatal development was analysed in addition to an assessment of adult behavioural phenotypes relevant to the psychotic, cognitive and negative aspects of schizophrenia. These data show that PNS influenced specific anxiety-related behaviour in all animals. In addition, sensorimotor gating deficits previously noted in Bdr mutants were markedly enhanced by PNS; significantly, these effects could be reversed with the application of anti-psychotic drugs. Moreover, social interaction abnormalities were observed only in Bdr animals from stressed dams but not in wild-type littermates or mutants from non-stressed mothers. These results show for the first time that combining a synaptic mouse point mutant with a controlled prenatal stressor paradigm produces both modified and previously unseen phenotypes, generating new insights into the interactions between genetics and the environment relevant to the study of psychiatric disease.
| INTRODUCTION |
|---|
|
|
|---|
In recent years, a considerable number of putative susceptibility genes for schizophrenia have been described, and the majority have central roles in synaptic function (1,2). However, according to the neurodevelopmental model of schizophrenia, polygenetic and environmental factors combine to influence early synaptic development and function, causing pathophysiological abnormalities long before the emergence of the symptoms required for diagnosis (3). For example, it is now well established that prenatal stress (PNS) has been directly associated with a number of significant long-term mental health problems, including schizophrenia (4–7). Consequently, a large number of studies in wild-type rodents have attempted to understand the important link between such early life programming and neurological development (8). A range of approaches have been described to date, from the induction of viral infection to the application of physical or social stress during pregnancy (9,10). This work has shown that the timing and duration in addition to the type of environmental stressor can generate a wide variety of post-natal behavioural outcomes, including anxiety and memory deficits (11–20). In addition, PNS can elicit phenotypes in the adult offspring more specifically relevant to psychiatric disorders, such as abnormal sensorimotor gating or pre-pulse inhibition (PPI) responses (21). However, detailed interpretation or comparison of these datasets is problematic due to the inconsistency of the PNS paradigms used and the limited range of post-natal effects measured in a single study. Considering all these issues, a more heuristic approach to modelling the pathophysiology of schizophrenia would be to manipulate the prenatal environment of a mouse with a known genetic lesion and synaptic phenotype and investigate the behavioural consequences of the combined insults (22).
As alterations in synaptic connectivity and function are central to most of the currently favoured hypotheses regarding schizophrenia pathobiology, then genes that control these process warrant further attention (1). The neuronal soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) and SNARE-associated proteins play a central role in the neurotransmitter release, and the expression several, including SNAP-25 and syntaxin, is selectively affected in brains from schizophrenic patients (23–26). More compelling evidence of a role in disease causation comes from a meta-analysis of genome-wide association data in which the SNAP-25 genomic region emerges as strongly linked to schizophrenia (27). Mouse mutants of the SNARE-related proteins have shown a variety of complex behavioural phenotypes (28–32), although studies have been limited by the embryonic lethality of the Snap-25, synaptobrevin-2 and Munc-18 knockouts (33–35). To augment this resource, we have recently identified and characterized the Snap-25 dominant mutant blind-drunk (Bdr), named after its distinctive ataxic gait. A single amino acid substitution (I67T) results in an increased binding affinity within the core SNARE complex, preventing the normal recycling of synaptic vesicles (36). This in turn alters the amplitude of cortical neurotransmission, although no overt neuropathological abnormalities have been detected. Interestingly, Bdr mice display a range of behavioural defects including some aspects of anxiety and apathy but also a robust reduction in PPI response. Thus the Bdr mutant provides an important link between sensory behavioural abnormalities and a specific synaptic deficit caused by a single amino acid change. Taken together, these data suggest the SNARE complex and SNAP-25 may play a significant role in synaptic dysfunction in psychiatric disease. Moreover, the relatively mild behavioural phenotype of the Bdr mutant, in combination with the well-characterized synaptic deficit, renders it eminently suitable to examine the role of PNS in the modulation of behaviour.
The aim of this study was to investigate the combination of environmental and genetic factors on the development and behaviour of the Bdr mutant. The Snap-25 knockout heterozygous (HET) mouse was added to the study to determine for the first time whether a 50% reduction in Snap-25 expression results in any specific behavioural abnormalities (33). In addition, we wanted to ascertain whether a reduction in expression of a synaptic protein would modulate sensitivity to PNS. Using a random, variable PNS paradigm, we carried out initially a detailed developmental screen on both strains. We then went on to assess the mutants in a battery of tests to model the psychotic, cognitive and negative aspects of schizophrenia and show that PNS influenced specific anxiety-related behaviour in all animals. Furthermore, the PPI and social interaction deficits noted in the Bdr mutants were markedly modulated by PNS. Thus for the first time we have demonstrated that PNS interacts with a genetic lesion in a SNARE protein to enhance schizophrenic-like behaviour.
| RESULTS |
|---|
|
|
|---|
Effect of PNS on breeding and development
PNS has been shown to cause subtle behavioural changes in the pregnant dams themselves that can influence development of the offspring (39,43), therefore this phenomenon was assessed by taking pre- and post-partum measurements of maternal activity. Data from all litters show that there was no significant effect of stress or genotype on average weight gain of the dams during pregnancy, litter size or sex ratio (Supplementary Material, Fig. S1 and Table S1). In addition, there was no difference in the nesting behaviour in either mutant group irrespective of PNS (Table 1). Pup retrieval was also measured, and there was also no significant effect of PNS on this parameter, although dams from the HET cross were quicker to instigate and complete the task than those from the Bdr group (Table 1).
|
Effect of PNS on corticosterone
To confirm that the chosen PNS protocol was causing measurable changes in stress hormones, the levels of corticosterone were measured 30 min after the second forced swim stressor at E14.5 and the third round of restraint stress at E15.5. The results show an approximate 4–5-fold increase in cortisosterone levels after forced swimming and restraint in both Bdr and HET crosses compared with non-stress (NS) controls (P < 0.01; Fig. 1).
|
Effect of PNS on early development
The influence of PNS on neonatal Snap-25 mutants was examined in detail to determine whether adult behavioural phenotypes might reflect the delay of specific developmental milestones or maturation of the nervous system. These data show that there were only very minor defects in motor function due to the PNS protocol, although those that were observed did not persist until weaning (Supplementary Material, Fig. S2).
Adult behavioural test battery
The open-field locomotor activity test showed that both PNS and NS mice from the HET group were generally more active than the Bdr group, although there was no effect of stress on this particular parameter (Fig. 2A). However, animals from the PNS litters spent significantly less time in the central area of the open field than NS animals (Fig. 2B). This anxiety-related behaviour was tested further in the elevated plus maze (EPM). As in the open field, mice from the HET cross were generally more active than those in the Bdr group on the apparatus, although there was no effect of PNS on total distance travelled (data not shown). Measures of unconditioned anxiety, however, were influenced by PNS in mice from both genotypic groups; including a reduction in the time spent in the open arms (Fig. 2C) and number of entries in the open arms (Fig. 2D). However, there was no significant interaction between stress and genotype on either of these parameters.
|
The Y-maze continuous alternation test was chosen as a test of short-term memory acquisition and exploratory behaviour. All mice alternated throughout the apparatus during the testing period, and there was no effect of stress or genotype on performance (Fig. 3A). There was also no influence of stress on the activity of mice in the forced swim test, a common method used to analyse behavioural despair in mice (Fig. 3B), and no alteration in fear-conditioned memory (Fig. 3C).
|
Olfaction is essential for normal rodent social recognition and importantly, none of the mice tested showed any impairment in their ability to find buried food in the test for anosmia, other than background strain differences as expected (Fig. 4A) (44). In the social testing apparatus, both Snap-25 lines showed a strong preference for the first stranger (Stranger 1) versus the empty cage during sociability testing (Fig. 4B) and spent more time with the novel stranger versus the familiar mouse in the social novelty stages of the protocol. Interestingly, however, Bdr mutants from PNS dams spent significantly more time than PNS controls and NS Bdr mice in proximity to the empty cage in the first part of the test revealing a significant interaction between stress and genotype in the Bdr mice (stress x genotype P = 0.040; Fig. 4B). Furthermore, PNS Bdr mice spent approximately equivalent time with the second intruder mouse (Stranger 2) and Stranger 1 in the social novelty analysis compared with wild-types (stress x genotype P = 0.035; Fig. 4B). To determine whether that this effect related to contact between the animals or empty cages as opposed to a measure of activity in each chamber of the apparatus, sniffing time was also recorded for all experimental animals from the Bdr strain. These data confirmed the activity data, showing an interaction between stress and genotype on measures in both the sociability (P = 0.038; Fig. 4C) and social novelty (P = 0.042; Fig. 4C) parts of the test. Control parameters such as number of chamber entries and time in the central chamber were not significantly altered between genotypes or stress conditions (data not shown). In addition, apathy in the form of novel object recognition was assessed. Bdr mutants and controls spent similar lengths of time interacting with two identical objects in the first open-field trial and both groups spent significantly longer interacting with a novel object introduced in the second trial (Fig. 5). There was, however, no effect of PNS in either parameter.
|
|
Pre-pulse inhibition
To assess sensorimotor gating response, mice were tested using a combined acoustic startle and pre-pulse protocol. As previously described, Bdr mice show a significant reduction in PPI of
15% compared with controls at 8 and 16 dB above background, although no such effect was observed in HET mice (Fig. 6A). In all wild-type and HET animals, PNS resulted in a small, but non-significant decrease in PPI. Surprisingly, however, PNS caused a further, significant 20–25% decrease in PPI of Bdr mice compared with non-stressed mutants at both higher pre-pulse levels, revealing a significant interaction between stress and genotype (78 dB, P = 0.025; 86 dB, P = 0.012; Fig. 6A). There was no effect of genotype or stress on the weight-correct startle response amplitude (data not shown). In order to observe the response of Bdr mutants to psychoactive drugs during PPI analysis, acute doses of the commonly used anti-psychotics clozapine and haloperidol were administered along with a saline control on an independent cohort of NS and PNS mice. The doses were selected to be in line with similar studies in mice that cause measurable enhancement in PPI to assess validity of the model, without a significant attenuation of startle response (45–47). Saline-injected animals generated highly similar results to untreated mice, confirming that the PPI deficits in Bdr mutants were reproducible (Fig. 6B). The results after clozapine treatment show a non-significant increase in PPI of
10% for wild-type mice irrespective of stress, but a striking and significant 35–40% increase for Bdr mutants from PNS dams at 78 and 86 dB, almost restoring the response to wild-type levels (genotype x drug: 76 dB, P = 0.030; 86 dB, P = 0.019; Fig. 6B). Although haloperidol had a more moderate effect than clozapine on PPI in Bdr mice, a significant increase was observed at the 86 dB pre-pulse (Fig. 6B). These data show that an enhanced PPI deficit occurs when combining the Bdr phenotype with PNS and that this behaviour is hypersensitive to psychoactive drugs.
|
| DISCUSSION |
|---|
|
|
|---|
To generate new insights into interactions between genes and the environment using synaptic protein mutations and PNS, we analysed neonatal and adult offspring from two independent Snap-25 mutant lines. The application of PNS during gestation in rodents is a well-established method for modelling the influence of environmental factors on behaviour; however, using repeated or prolonged PNS paradigms has been shown to cause habituation to the stressful conditions and limit the effectiveness of the experiment due to desensitization of the hypothalamic–pituitary–adrenal (HPA) response (48). Consequently, we chose a random, variable PNS regime similar to one used in rats that generated a range of behavioural abnormalities in the offspring (21,37,49). It was, however, necessary to adapt the stress paradigm to mice. For example, due to the size difference between the species, stress induced by prolonged exposure to a cold environment was not carried out here. Furthermore, overnight fasting was not used to avoid developmental defects in the offspring due to the potentially reduced body weight of the stressed dams (50).
Depending on the source of the environmental stressor concerned, clinical data suggests that the foetal brain is highly sensitive to insults at time points throughout pregnancy (4,6,51,52). With specific reference to neuropsychiatric disorders, maternal stress during the first and second trimester appears to have the greatest influence on an increased risk of schizophrenia, as exemplified by retrospective studies of prenatal exposure to influenza (53), war (54) and familial adverse life events (55). Indeed, in mice it has been established that the post-natal behavioural outcomes of PNS are sensitive to the timing of the stressors employed. For example, variable stress both early [E0.5–6.5 (56)] and late [E15–21 (57)] in gestation can elicit differing responses in mice. To better interpret such data, it is useful to extrapolate the timing of neurodevelopment from humans to rodents. Combining morphological (58,59), evolutionary and computer modelling methods (60) places the end of gestation in mice (typically E19.5) at
90–120 days post-conception (DPC) in humans. Here we applied the variable PNS protocol for 7 days from mid- to late gestation (E11.5 –17.5) to correspond from the end of the first (50–60 DPC) to beginning of the second (80–110 DPC) trimester in humans, consistent with the foetal developmental time points most vulnerable to PNS. During optimization of the PNS experiments, we attempted to stress the dams closer to parturition similar to related studies (37). However, this lead to spontaneous early abortions and/or the birth of underdeveloped offspring in a considerable number of litters (data not shown); therefore PNS was not applied beyond E17.5 here.
Importantly, the chosen PNS regime successfully generated measurable stress hormone enhancement, but did not elicit significant confounding pre- or post-partum behavioural defects in the treated dams that may have influenced subsequent phenotypic testing of the offspring. Other studies have also showed that gestational stress does not influence maternal behaviour (61,62), although the subtle effects of PNS on parameters not observed in the current study have been noted elsewhere, such as licking, sniffing and nursing of the pups (43,63,64). The development of affiliative behaviour between a rodent mother and her offspring is undoubtedly highly complex and other studies have attempted to circumvent such stress-induced maternal effects by cross-fostering pups from stressed dams to unstressed females. For example, a study in rats using cross-fostering in combination with variable PNS showed no effect of adoption on the social behavioural deficits observed in the offspring from stressed dams (49). However, studies in mice have demonstrated that cross-fostering itself can have significant effects on both the maternal activity (39) and the long-term emotional behaviour of the offspring, including social interaction (65). For these reasons, we avoided this particular breeding method, in addition to the potential problems of infanticide that we have observed ourselves during pilot experiments with this particular PNS protocol (data not shown).
Our study of neonates showed that PNS only had a minor effect on neurodevelopment and none of the measurements were significantly altered by weaning age. This part of the study also provided, for the first time, a description of the neurodevelopmental profile of both Snap-25 mutant lines. For example, Bdr mice are typically 70–80% of the size of wild-type littermates at adulthood (36), but we show here that this is not due to a failure to thrive or feed during the early post-natal weeks. However, some reduction in general locomotor activity was seen in mutant mice, which is likely to be the first signs of the ataxia that is more clearly observed at 4–5 weeks of age. Interestingly, a detailed developmental study of the complexin-I knockout mouse has been carried out (41). These mice display ataxia as early as P7, which understandably affected motor control and exploration although additional neurodevelopmental milestones were also altered, including those related to sensory behaviour. Importantly, we have confirmed here that the mild ataxia of adult Bdr mice does not result in significantly reduced locomotor activity in any of the apparatus used. In addition to a measure of activity, data from the open field and EPM tests show that PNS generated anxiety-related behaviour in all mice tested, regardless of genotype. This observation is consistent with several studies of both prenatal and perinatal stress in rodents (16,20,66). Moreover, one study showed that anxiolytic phenotypes in both the open field and EPM observed in rats from stressed dams were essentially reversed in pups that had been handled during neonatal development, demonstrating the sensitivity of rodents to environmental manipulation, and illustrating why neonatal mice tested here could not be used for subsequent adult behavioural studies (67).
The sociability paradigm used here was originally developed to model autistic-like behaviour, although social communication problems are common in many neuropsychiatric disorders including schizophrenia (68,69). Social defects are also common to many mutant mouse models of synaptic dysfunction or schizophrenia susceptibility genes (30,47,70). Surprisingly, during social novelty testing, Bdr mutants from stressed dams spent approximately the same time with the now familiar intruder mouse (Stranger 1) than the new intruder mouse (Stranger 2). This suggests that PNS induces deficits in social recognition memory in Bdr mutants; a phenotype not observed in PNS wild-type mice or NS Bdr animals. In addition, our data from the object novelty testing show that the activity of Bdr mutants from stressed dams was not indicative of general apathy in the social testing apparatus. In contrast to studies of anxiety and cognitive behaviour, relatively few investigations have examined the role of PNS on social interaction. Recent work has shown that wild-type rats subjected to a variable PNS paradigm exhibit social impairments during a simple open-field observational test (49). Interestingly, the same study demonstrated both pre-pubertal and adult offspring from stressed dams displayed a decline in relative physical contact as well as overall time spent with the intruder rat, suggesting a reduction in social drive that may model the initial clinical signs of schizophrenia observed in adolescents (71). It has also been shown in rats that electric shock treatment throughout pregnancy lead to an increased latency to initiate social play in the offspring (72).
Initially from studies using pharmacological intervention it has been proposed that more anxious animals are less likely to engage in social activity (73,74). Furthermore, anxiolytic behaviour in rats caused by PNS has been shown to correlate with reduced social interaction and aggressiveness (75). The intricacies of social response in rodents are likely to be influenced by a considerable number of factors, including motivation and sensory cues as well as anxiety. Indeed, there are many examples of rodent models that are in fact less anxious than their respective controls, but still display social deficits (76,77). Therefore, as there was a non-significant difference in anxiety measures between Bdr mice and controls subjected to PNS and no social impairment in the same control animals, anxiety is unlikely to have influenced the social testing results described here.
Sensorimotor gating deficits are commonly reported in schizophrenic patients, and PPI is therefore considered as valuable endophenotype to study in mouse models of psychiatric disease (78). As previously described, we observed a reproducible reduction in PPI in Bdr mutants (36), although here we dissected this response further by using a range of pre-pulses. Bdr, but not HET mice, were also hypersensitive to PNS, with a significant interaction between stress and genotype on PPI at the two highest pre-pulse intensities. To assess predictive validity of these responses pharmacological studies were carried out, showing an almost complete rescue of the PPI deficits in both the NS and PNS Bdr mutants with the atypical anti-psychotic clozapine, although the typical anti-psychotic haloperidol had a more modest effect on PPI improvement. These data are consistent with a number of neurodevelopmental rodent models of schizophrenia generated by genetic mutations (79), hippocampal lesions (45) or drug administration (80). PPI defects are also associated with neuropsychiatric disease models in rodents that apply environmental stressors, including prenatal infection (81) and isolation rearing on wild-type (82) or Nurr1 mutant mice (83). Uniquely, the response of Bdr mutants to PNS shows not only that a synaptic mutation in combination with prenatal factors can significantly modulate PPI, but this interaction has predictive validity as a psychiatric disease model.
Considering the control animals screened as part of this study, PNS induced no deficits in PPI, social interaction or cognitive and depressive behaviours. These data are in disagreement with previous work in wild-type rodents demonstrating that each of these behavioural domains can be influenced by gestational factors, including the application of either chronic repetitive stress (84) or a variable stress paradigm similar to that used here (21,49,57). The fact that we only identified anxiety-like behaviour from dams subjected to PNS might suggest that our chosen stress protocol was generally less severe than those highlighted above, despite the obvious increase in blood corticosterone levels measured in all mice tested. Nonetheless, the fact that no PPI or social deficits were observed in control mice facilitated the identification of interactions between Bdr mutants and PNS; the additive effects of several behavioural abnormities would have likely confused or even masked the combined influence of genetic and environmental manipulation.
We chose to maintain the two Snap-25 mutant lines on their original genetic backgrounds to allow direct comparisons with previously published work without the potential of confounding modifier effects. Thus the general behavioural profiles of the C3H (background for the Bdr cross) and C57BL/6 (background for the HET cross) inbred strains were evident during the study. All mice from the HET cross were generally more active and less anxious than the entire Bdr group, as indicated by results from the open field and EPM; these data are consistent with former studies of the C57BL/6 and C3H strains (85,86). This is also likely to explain why that HET group required less time to retrieve their pups than mice from the Bdr cross. In addition, mice from the HET cross spent more time immobile than the Bdr group during the forced swim test, a result described previously for their respective genetic backgrounds (87). Strain comparisons in the social interaction paradigm used here have also been carried out, revealing that the C3H strain showed a more overt sociability response to the first part of the test than C57BL/6 mice (44). Conversely, in the same study, whereas mice from the C57BL/6 strain showed a significant preference for social novelty, C3H animals did not. Although we did detect a slight enhancement in sociability from the Bdr cross versus mice from the HET cross as expected, more importantly we observed a robust social novelty response from NS Bdr mutant and control animals. The effect of PNS on social activity parameters could therefore be determined in the Bdr line, despite the C3H background. It is unclear why our results differ from the original analysis of inbred strains, although it may reflect subtle differences in the size and content of the apparatus used (44). Consequently, by controlling for strain differences by using littermates from each Snap-25 cross throughout, our study demonstrates that a comparison of the behavioural data from independent mutant lines requires careful consideration of the genetic backgrounds involved (88).
The data from HET mutants did not deviate significantly from wild-type controls in any of the tests carried out here, suggesting that a 50% reduction in Snap-25 expression does not influence a range of behavioural domains. Synaptic function has been shown to be normal in HET animals, although possible functional compensation by related synaptic proteins has been considered (33,89). In mice, Snap-23, Snap-29 and Snap-47 are all expressed in neurons and are capable of supporting exocytosis, although when assayed in vitro, each displays functional idiosyncrasies distinct from Snap-25 (90–92). If complete functional compensation by related proteins does not occur in vivo, a more straightforward explanation may be that the absolute levels of Snap-25 in HET mice are not limiting to synaptic function.
Our data are apparently at odds with the description of the hyperactive coloboma mutant containing a deletion spanning four genes, including Snap-25 (93). These mice also have a 50% reduction in expression of Snap-25 protein, although genetic rescue of the hyperactivity was seen using a Snap-25b transgene (94). Considering our data from HET mice, this discrepancy may involve subtleties of the isoform-specific Snap-25 mini-gene used for transgenic rescue (94). However, it would be interesting to determine whether the additional genes deleted in coloboma influenced cognitive behaviours common to psychiatric disorders and conditions, where hyperactivity is a feature, such as attention-deficit hyperactivity disorder. The picture regarding SNAP-25 expression levels in human post-mortem tissue from schizophrenic patients is somewhat complex (23). Although there is some consensus that reduced levels of SNAP-25 occur in certain regions of the brain such as the hippocampus (26), it is possible such observations may be a result of prior neuropatholoigcal insults altering synaptic morphology or density. Nevertheless, it is intriguing that changes in neonatal Snap-25 protein levels have been reported recently in a mouse expressing a human DISC-1 transgene (95) and prenatal infection models of schizophrenia (96).
If the apparently normal phenotype of HET mice is a consequence of functional compensation, in contrast, the behavioural profile of Bdr mice is caused by changes in synaptic vesicle recycling without any reduction in the expression of Snap-25 itself (36). It is still unclear why the global synaptic deficit in Bdr mice would influence certain behavioural parameters and not others, although we hypothesise that events causing the continual, rapid firing of neurons would result in depletion of the reserve pool of vesicles, ultimately preventing normal synaptic function. Clearly sensorimotor gating and social interaction, those behavioural domains most sensitive to PNS in the Bdr mutant, are highly complex tasks that require the integration of many brain circuits (97,98), although studies are only just beginning to isolate which neurodevelopmental pathways are most susceptible to environmental factors (52,99). We can speculate, for example, that inhibitory feedback loops to the HPA axis from the hippocampus or frontal cortex are adversely affected in Bdr mice, thus perpetuating the stress response (100). Our strategy has therefore investigated the consequences of altering two-independent aspects of synaptic function relevant to the pathophysiology of psychiatric disease, namely changes in protein expression and protein interaction at the synapse.
A consensus is emerging that to understand the pathogenic mechanisms of complex neurodevelopmental disorders will require consideration of environmental as well as multiple genetic factors; and as a consequence, improved animal models are required (101–103). We have demonstrated here that combining a synaptic mouse mutant with a controlled prenatal stressor paradigm produces both modified and completely new phenotypes relevant to the study of psychiatric disease. Our work also exemplifies the importance of studying point mutations in addition to gene knockouts to accurately model human genetic lesions (47,104). With the limitations and complexities surrounding retrospective human studies (6), the analysis of mouse mutants such as Bdr subjected to environmental manipulation will become an increasingly important tool for the study of neuropsychiatric disorders.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Breeding
Bdr males (from serial backcross to C3H/HeH >12 generations) and HET males (backcross to C57BL/6 >10 generations) were mated to virgin wild-type C3H/HeH or C567BL/6 females, respectively. The presence of a copulation plug denoted the first day of gestation (E0.5), when the females were then house individually. On the day of birth (P0), litters sizes were counted and culled to between six and eight pups, with a minimum of two males, on the second day post-partum (P1). Litters of less than six pups were not used. Pregnant females were randomly assigned to either the PNS or the NS groups in each experiment. All experiments were carried out using procedures approved by the UK Home Office and the Departmental Ethical Review Committee (University of Oxford).
Genotyping
Bdr mice were genotyped using polymorphic microsatellite markers and sequencing as previously described (36). Snap-25 HET mice were identified in a mutiplex PCR reaction using primers for specific for the neomycin resistance marker 5' ATCCATCATGGCTGATGCAATG and 5' CATGATATTCGGCAAGCAGGCA with the wild-type Snap-25 locus 5' GAAGAAGGCATGAACCATATCAAC, 5' CCCGCAGAATTTTCCTAGGTCC (33).
Random variable PNS paradigm
A repeated prenatal variable stress paradigm similar to that described by Kinnunen et al. (37) for rats was employed; however, the duration of each stressor was suitably adjusted for mice and was carried out during days E11.5–17.5 (Table 2). Restraint was carried out using a polypropylene plastic tube 4 cm in diameter for 30 min. A large (90 x 70 x 40 cm) brightly illuminated white arena was used for the open-field stressor and swim stress was conducted in a container (40 x 60 x 30 cm) containing water at 18°C for a period of 5 min. Social stress consisted of placing individual pregnant dams in a cage of four or more wild-type non-pregnant unfamiliar females overnight. Home cages were also changed at E12.5, 14.5 and 16.5. Non-stressed females were left in their own home cages throughout the stress procedures. To prevent bias in the subsequent experiments, pregnant dams were randomly assigned to the maternal, neonatal, adult behavioural battery or PPI testing groups (see below).
|
Corticosterone measurements
To measure the stress response of dams, corticosterone levels were compared 30 min after the third restraint stressor carried out at E15.5 and the second forced swim stressor at E14.5 (n = 8 each group). Blood was taken alternately from individual animals from both groups and assayed using the Corticosterone EIA kit (Immunodiagnostic Systems) according to the manufacturer's instructions.
Maternal measurements
For a quantitative measure of nesting behaviour, a single nestlet was placed in the home cage of E16.5 dams at 1600 h following normal cage cleaning, but without the addition of alternative nesting material. Nest quality was scored based on the amount of shredded material and the shape that was created overnight: (i) material not shredded; (ii) flat nest with less than 50% shredded; (iii) flat nest with more than 50% shredded; (iv) more than 90% shredded with shallow walls; (v) more than 90% shredded with walls more than 3 cm high (38). At P3, the same dams were tested for pup retrieval activity. The mothers were first sequestered on the nest using a cardboard barrier, whereas the pups were placed equally around the home cage in a 3 x 2 pattern. The barrier was then removed and each dam was scored for the total number of pups retrieved in 10 min and the latency to retrieve the first and all of the pups back to the nest (39).
Neonatal measurements
In addition to the pups being weighed every 2 days from P3–21, a range of commonly used developmental milestones were quantified (40,41).
- Eye opening: day when complete opening of both eyelids occurred.
- Ear twitch response: day when sudden ear movement was observed after stroking the pinna with a cotton bud.
- Surface righting: time taken for pups to return to an upright position after being placed supine.
- Negative geotaxis: time taken for pups placed head down on a ramp covered in rough paper inclined at 45° to turn around and begin walking up the slope.
- Forelimb strength: day when a pup suspended by the forelimbs on a wire of 1 mm in diameter could remain hanging for more than 1 s before losing grip.
- Walking: day when movement of the pup was first seen where the entire body was lifted from the floor supported by both forelimbs and hindlimbs.
- Linear movement/activity: time for a pup to demonstrate forward movement from a central area 5 x 5 cm in an empty plastic open-field chamber (30 x 30 cm). For the measure of locomotor activity, the total number of 6 cm2 squares marked on the floor that were crossed in a 180 s period was recorded.
Adult behavioural test battery
A range of tests were carried out on male mice from 8 weeks of age over a 3 weeks period (n = 14 each genotype and stress group) in the following order.
(1) Open field: mice were placed in the same corner of a brightly lit arena 50 x 50 x 30 cm with markings every 10 cm on the floor to create a 5 x 5 grid. Movement of the mice over 10 min was recorded using the Ethovision XT software (Noldus) with a monochrome camera suspended directly above the arena. Distance travelled and time spent in the central 3 x 3 squares was recorded.
(2) EPM: the EPM consisted of four arms, two open (36 x 6 x 0.5 cm) and two closed (36 x 6 x 25 cm). The mouse was placed on an open arm facing a central area where all four arms meet. Mice were observed over a 5 min period and the number of entries and time spent in open and closed arms was recorded. Entries were defined as the passing of all four paws into an arm. Activity was measured using the Ethovision system as above.
(3) Y-maze: the maze consisted of three identical arms (40 x 10 x 20 cm) placed at 120° from each other. Each mouse was placed at the end of one arm and allowed to explore the maze freely for 6 min. The total number of arm entries was recorded in addition to the calculation of the spontaneous alternation score; this was calculated as the number of alternations (entries in three different arms consecutively) divided by the total possible number of alternations (total number of arm entries—two).
(4) Olfactory test: before testing commenced, all mice were habituated to an unfamiliar food source (Chocolate Weetos, Kellogs) for 3 days. For the test, after 8 h of food deprivation, mice were placed in a clean cage with 3 cm of normal bedding and allowed to explore for 5 min. The animal was removed from the cage while a single piece of cereal was buried 1 cm below the surface. The mouse was then returned to the cage and the latency to find the hidden food was recorded.
(5) Sociability and preference for social novelty behaviour was assessed based on a previously described method (42). The apparatus was a rectangular, three-chambered (left and right chambers 20 x 30 x 30 cm; centre chamber 20 x 20 x 30 cm; total size 60 x 30 x 30 cm). Dividing walls were made from clear acrylic, with small square openings (4 x 4 cm) allowing access from the centre chamber into left and right chambers. Each chamber was cleaned and fresh bedding added between trials. A video camera, mounted in front of the apparatus, recorded each session. The paradigm consisted of a three-stage procedure:
- Stage 1: habituation: in the initial stage, the test mouse was first placed in the centre chamber and allowed to explore all three chambers of the apparatus for 5 min. It was then replaced in the centre chamber for a further 5 min with access to the left and right chambers denied by Plexiglasss doors.
- Stage 2: sociability: an unfamiliar BALB/c mouse (Stranger 1: age-, weight- and sex-matched) was placed in either the left or right chamber enclosed in a small, internal wire cage (10 x 10 x 12 cm) which allowed nose contact but prevented fighting; placement of Stranger 1 in the left or right chamber alternated between trials, with an empty but otherwise identical wire cage in the opposite chamber. Each stranger mouse had been habituated to placement in the small wire cage 24 h before testing. Following placement of Stranger 1 into the left or right chamber, both doors to these side chambers were then opened and the test mouse was allowed to leave the centre chamber and explore all three chambers of the apparatus for 10 min. The test mouse could therefore distribute its behaviour between the centre chamber, the chamber containing Stranger 1 or the opposite, empty chamber. Time spent in each compartment was recorded, with entry into any chamber defined as all four paws in that chamber.
- Stage 3: Preference for social novelty: each test mouse was immediately returned to the centre chamber and the doors to the side chambers were closed. Then followed a second 10 min session to quantify social novelty preference toward a novel stranger. With the initial stranger (Stranger 1; now familiar) retained in its original chamber, a second, unfamiliar mouse (Stranger 2) was placed in the previously empty but otherwise identical small wire cage in the opposite chamber. Following placement of Stranger 2 into the chamber opposite to that still containing Stranger 1, both doors to the side chambers were opened and the test mouse was allowed to leave the centre chamber and explore all three chambers of the apparatus for a second period of 10 min; it could therefore distribute its behaviour between the centre chamber, the chamber containing the previously investigated and now familiar mouse (Stranger 1) and the opposite chamber containing the novel, unfamiliar mouse (Stranger 2). All other parameters and measures were as described above for Stage 2.
- Stage 2: sociability: an unfamiliar BALB/c mouse (Stranger 1: age-, weight- and sex-matched) was placed in either the left or right chamber enclosed in a small, internal wire cage (10 x 10 x 12 cm) which allowed nose contact but prevented fighting; placement of Stranger 1 in the left or right chamber alternated between trials, with an empty but otherwise identical wire cage in the opposite chamber. Each stranger mouse had been habituated to placement in the small wire cage 24 h before testing. Following placement of Stranger 1 into the left or right chamber, both doors to these side chambers were then opened and the test mouse was allowed to leave the centre chamber and explore all three chambers of the apparatus for 10 min. The test mouse could therefore distribute its behaviour between the centre chamber, the chamber containing Stranger 1 or the opposite, empty chamber. Time spent in each compartment was recorded, with entry into any chamber defined as all four paws in that chamber.
(6) Novel object recognition: two identical objects (solid plastic cylinders 10 x 3 cm) were secured to the floor of the open-field apparatus (see above) equidistant from the walls at either end. Mice were placed in the arena and allowed to explore for 5 min, after which they were transferred to their home cage. One hour later one of the objects was replaced with a novel object (plastic doll 10 cm long) and the mouse was returned to the arena for 5 min. The time spent exploring each object was recorded from both trials. The arena and objects were cleaned between trials.
(7) Forced swim test: each mouse was placed into a transparent 4l glass beaker (45 cm high x 15 cm diameter) filled to a depth of 20 cm with water (maintained at 30°C) and remained there for 6 min. The duration of immobility, which was defined as floating in an upright position without additional activity other than that necessary for the animal to keep its head above water, was recorded during the last 4 min of the test period.
(8) Fear conditioning: Pavlovian fear conditioning was measured using apparatus composed of test chamber with the facilities for emitting white noise and electrical shock (MED Associates). The test chamber (56 x 38 x 36 cm) was made of clear Plexiglass, the bottom composed of a grid floor used to delver a mild electric shock. This was housed inside a sound-attenuated chamber with a viewing lens to allow the experimenter to see into the test chamber. A mouse was placed into the test chamber and allowed to explore freely for 2 min. A white noise (80 dB) serving as the conditioned stimulus (CS) was aired for 30 s, followed by a mild (2 s, 0.5 mA) foot shock (unconditioned stimulus, US). This CS–US pairing was repeated 2 min later and this comprised the training period. For the context text, 24 h later the mouse was placed back into the test chamber and the presence of freezing behaviour was recorded every 10 s for 5 min. Two hours later the mouse was evaluated for its response to the CS. Contextual cues for this test were altered; the shape of the test chamber was modified by insertion of a triangular piece of cardboard, the grid floor covered with Plexiglass and vanilla essence used to alter the smell. Mice were observed for freezing behaviour 3 min prior to the CS tone being turned on and for 5 min following the CS. Freezing interval was converted to percent freeze value.
PPI/antipsychotic treatment
For PPI testing (n = 14, 8-week-old male mice of each genotype and stress group), startle and pre-pulse response studies were carried out using the Med Associates Startle Reflex system. Startle response amplitude was calculated from an initial block of 10 105 dB 20 ms pulses. For the PPI testing, a second block of 32 additional identical startle trials in total were preceded 100 ms by a pure tone pre-pulse at 4, 8 and 16 dB above background. Trial types were presented in a pseudo-randomized order with eight presentations of each pre-pulse and startle combination and eight startle only trials. PPI for each frequency was calculated using the following formula: PPI = 100–[(mean startle amplitude for pre-pulse trials/mean startle amplitude for startle trials) x 100]. For drug treatments, an additional independent group of mice from the Bdr cross was used (n = 12, 8-week-old male mice from each stress group). The typical anti-psychotic clozapine and the atypical anti-psychotic haloperidol (Tocris) were administered by i.p. injection at 5 and 0.3 mg/kg, respectively, 20 min prior to testing in the PPI apparatus. Control animals were injected with vehicle (0.9% NaCl). Mice from each group were tested once every 7 days with injection of saline or either drug in a randomized order, so that each animal received each treatment only once.
Statistics
Data were analysed using two-way analysis of variance with genotype and environment as main factors with post hoc comparisons carried out using independent or paired t-tests.
| SUPPLEMENTARY MATERIAL |
|---|
|
|
|---|
Supplementary Material is available at HMG online.
| FUNDING |
|---|
|
|
|---|
This work was supported by the UK Medical Research Council.
| ACKNOWLEDGEMENTS |
|---|
We wish to thank Reuben Johnson and Niamh Kenny for assistance with pilot studies for the optimization of behavioural protocols and Alex Jeans for critical reading of the manuscript. We also thank Michael Wilson and Zoltan Molnar for access to the Snap-25 knockout mice.
Conflict of Interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Harrison P.J., Weinberger D.R. Schizophrenia genes, gene expression, and neuropathology: on the matter of their convergence. Mol. Psychiatry (2005) 10:40–68.[CrossRef][Web of Science][Medline]
- Gogos J.A., Gerber D.J. Schizophrenia susceptibility genes: emergence of positional candidates and future directions. Trends Pharmacol. Sci. (2006) 27:226–233.[CrossRef][Medline]
- Rapoport J.L., Addington A.M., Frangou S., Psych M.R. The neurodevelopmental model of schizophrenia: update 2005. Mol. Psychiatry (2005) 10:434–449.[CrossRef][Web of Science][Medline]
-
van Os J., Rutten B.P., Poulton R. Gene–environment interactions in schizophrenia: review of epidemiological findings and future directions. Schizophr. Bull. (2008) 34:1066–1082.
[Abstract/Free Full Text] -
Patterson P.H. Neuroscience. Maternal effects on schizophrenia risk. Science (2007) 318:576–577.
[Abstract/Free Full Text] - Kofman O. The role of prenatal stress in the etiology of developmental behavioral disorders. Neurosci. Biobehav. Rev. (2002) 26:457–470.[CrossRef][Web of Science][Medline]
- Caspi A., Moffitt T.E. Gene–environment interactions in psychiatry: joining forces with neuroscience. Nat. Rev. Neurosci. (2006) 7:583–590.[Web of Science][Medline]
- Koenig J.I. Schizophrenia: a unique translational opportunity in behavioral neuroendocrinology. Horm. Behav. (2006) 50:602–611.[CrossRef][Medline]
-
Fatemi S.H., Folsom T.D. The neurodevelopmental hypothesis of schizophrenia, revisited. Schizophr. Bull. (2009) 35:528–548.
[Abstract/Free Full Text] - Huizink A.C., Mulder E.J., Buitelaar J.K. Prenatal stress and risk for psychopathology: specific effects or induction of general susceptibility? Psychol. Bull. (2004) 130:115–142.[CrossRef][Web of Science][Medline]
-
Richardson H.N., Zorrilla E.P., Mandyam C.D., Rivier C.L. Exposure to repetitive versus varied stress during prenatal development generates two distinct anxiogenic and neuroendocrine profiles in adulthood. Endocrinology (2006) 147:2506–2517.
[Abstract/Free Full Text] - Alonso S.J., Damas C., Navarro E. Behavioral despair in mice after prenatal stress. J. Physiol. Biochem. (2000) 56:77–82.[Web of Science][Medline]
- Estanislau C., Morato S. Behavior ontogeny in the elevated plus-maze: prenatal stress effects. Int. J. Dev. Neurosci. (2006) 24:255–262.[CrossRef][Web of Science][Medline]
-
Chung S., Son G.H., Park S.H., Park E., Lee K.H., Geum D., Kim K. Differential adaptive responses to chronic stress of maternally stressed male mice offspring. Endocrinology (2005) 146:3202–3210.
[Abstract/Free Full Text] - Nishio H., Tokumo K., Hirai T. Effects of perinatal stress on the anxiety-related behavior of the adolescence mouse. Int. J. Dev. Neurosci. (2006) 24:263–268.[CrossRef][Web of Science][Medline]
- Dickerson P.A., Lally B.E., Gunnel E., Birkle D.L., Salm A.K. Early emergence of increased fearful behavior in prenatally stressed rats. Physiol. Behav. (2005) 86:586–593.[CrossRef][Medline]
- Lehmann J., Stohr T., Feldon J. Long-term effects of prenatal stress experiences and postnatal maternal separation on emotionality and attentional processes. Behav. Brain Res. (2000) 107:133–144.[CrossRef][Web of Science][Medline]
-
Lemaire V., Koehl M., Le Moal M., Abrous D.N. Prenatal stress produces learning deficits associated with an inhibition of neurogenesis in the hippocampus. Proc. Natl Acad. Sci. USA (2000) 97:11032–11037.
[Abstract/Free Full Text] -
Son G.H., Geum D., Chung S., Kim E.J., Jo J.H., Kim C.M., Lee K.H., Kim H., Choi S., Kim H.T., et al. Maternal stress produces learning deficits associated with impairment of NMDA receptor-mediated synaptic plasticity. J. Neurosci. (2006) 26:3309–3318.
[Abstract/Free Full Text] - Tazumi T., Hori E., Uwano T., Umeno K., Tanebe K., Tabuchi E., Ono T., Nishijo H. Effects of prenatal maternal stress by repeated cold environment on behavioral and emotional development in the rat offspring. Behav. Brain Res. (2005) 162:153–160.[CrossRef][Web of Science][Medline]
- Koenig J.I., Elmer G.I., Shepard P.D., Lee P.R., Mayo C., Joy B., Hercher E., Brady D.L. Prenatal exposure to a repeated variable stress paradigm elicits behavioral and neuroendocrinological changes in the adult offspring: potential relevance to schizophrenia. Behav. Brain Res. (2005) 156:251–261.[CrossRef][Web of Science][Medline]
- Ayhan Y., Sawa A., Ross C.A., Pletnikov M.V. Animal models of gene–environment interactions in schizophrenia. Behav. Brain Res. (2009) doi:10.1016/j.bbr.2009.04.010.
- Johnson R.D., Oliver P.L., Davies K.E. SNARE proteins and schizophrenia: linking synaptic and neurodevelopmental hypotheses. Acta. Biochim. Pol. (2008) 55:619–628.[Web of Science][Medline]
- Fatemi S.H., Earle J.A., Stary J.M., Lee S., Sedgewick J. Altered levels of the synaptosomal associated protein SNAP-25 in hippocampus of subjects with mood disorders and schizophrenia. Neuroreport (2001) 12:3257–3262.[CrossRef][Web of Science][Medline]
-
Honer W.G., Falkai P., Bayer T.A., Xie J., Hu L., Li H.Y., Arango V., Mann J.J., Dwork A.J., Trimble W.S. Abnormalities of SNARE mechanism proteins in anterior frontal cortex in severe mental illness. Cereb. Cortex (2002) 12:349–356.
[Abstract/Free Full Text] - Barr A.M., Young C.E., Sawada K., Honer W.G. Molecular Mechanisms of Synaptogenesis—Dityatev A., El-Husseini A., eds. (2006) New York: Springer Verlag. 391–408.
- Lewis C.M., Levinson D.F., Wise L.H., DeLisi L.E., Straub R.E., Hovatta I., Williams N.M., Schwab S.G., Pulver A.E., Faraone S.V., et al. Genome scan meta-analysis of schizophrenia and bipolar disorder, part II: Schizophrenia. Am. J. Hum. Genet. (2003) 73:34–48.[CrossRef][Web of Science][Medline]
-
Glynn D., Bortnick R.A., Morton A.J. Complexin II is essential for normal neurological function in mice. Hum. Mol. Genet. (2003) 12:2431–2448.
[Abstract/Free Full Text] -
Glynn D., Drew C.J., Reim K., Brose N., Morton A.J. Profound ataxia in complexin I knockout mice masks a complex phenotype that includes exploratory and habituation deficits. Hum. Mol. Genet. (2005) 14:2369–2385.
[Abstract/Free Full Text] -
Drew C.J., Kyd R.J., Morton A.J. Complexin 1 knockout mice exhibit marked deficits in social behaviors but appear to be cognitively normal. Hum. Mol. Genet. (2007) 16:2288–2305.
[Abstract/Free Full Text] - Johansson J.U., Ericsson J., Janson J., Beraki S., Stanic D., Mandic S.A., Wikstrom M.A., Hokfelt T., Ogren S.O., Rozell B., et al. An ancient duplication of exon 5 in the Snap25 gene is required for complex neuronal development/function. PLoS Genet. (2008) 4:e1000278.[CrossRef][Medline]
-
Fujiwara T., Mishima T., Kofuji T., Chiba T., Tanaka K., Yamamoto A., Akagawa K. Analysis of knock-out mice to determine the role of HPC-1/syntaxin 1A in expressing synaptic plasticity. J. Neurosci. (2006) 26:5767–5776.
[Abstract/Free Full Text] - Washbourne P., Thompson P.M., Carta M., Costa E.T., Mathews J.R., Lopez-Bendito G., Molnar Z., Becher M.W., Valenzuela C.F., Partridge L.D., et al. Genetic ablation of the t-SNARE SNAP-25 distinguishes mechanisms of neuroexocytosis. Nat. Neurosci. (2002) 5:19–26.[Web of Science][Medline]
-
Schoch S., Deak F., Konigstorfer A., Mozhayeva M., Sara Y., Sudhof T.C., Kavalali E.T. SNARE function analyzed in synaptobrevin/VAMP knockout mice. Science (2001) 294:1117–1122.
[Abstract/Free Full Text] -
Verhage M., Maia A.S., Plomp J.J., Brussaard A.B., Heeroma J.H., Vermeer H., Toonen R.F., Hammer R.E., van den Berg T.K., Missler M., et al. Synaptic assembly of the brain in the absence of neurotransmitter secretion. Science (2000) 287:864–869.
[Abstract/Free Full Text] -
Jeans A.F., Oliver P.L., Johnson R., Capogna M., Vikman J., Molnar Z., Babbs A., Partridge C.J., Salehi A., Bengtsson M., et al. A dominant mutation in Snap25 causes impaired vesicle trafficking, sensorimotor gating, and ataxia in the blind-drunk mouse. Proc. Natl Acad. Sci. USA (2007) 104:2431–2436.
[Abstract/Free Full Text] - Kinnunen A.K., Koenig J.I., Bilbe G. Repeated variable prenatal stress alters pre- and postsynaptic gene expression in the rat frontal pole. J. Neurochem. (2003) 86:736–748.[CrossRef][Web of Science][Medline]
- Deacon R.M. Assessing nest building in mice. Nat. Protoc. (2006) 1:1117–1119.[CrossRef][Web of Science][Medline]
- Meek L.R., Dittel P.L., Sheehan M.C., Chan J.Y., Kjolhaug S.R. Effects of stress during pregnancy on maternal behavior in mice. Physiol. Behav. (2001) 72:473–479.[CrossRef][Medline]
- Meek L.R., Burda K.M., Paster E. Effects of prenatal stress on development in mice: maturation and learning. Physiol. Behav. (2000) 71:543–549.[CrossRef][Medline]
- Glynn D., Sizemore R.J., Morton A.J. Early motor development is abnormal in complexin 1 knockout mice. Neurobiol. Dis. (2007) 25:483–495.[CrossRef][Web of Science][Medline]
- Moy S.S., Nadler J.J., Perez A., Barbaro R.P., Johns J.M., Magnuson T.R., Piven J., Crawley J.N. Sociability and preference for social novelty in five inbred strains: an approach to assess autistic-like behavior in mice. Genes Brain Behav. (2004) 3:287–302.[CrossRef][Web of Science][Medline]
- Patin V., Lordi B., Vincent A., Thoumas J.L., Vaudry H., Caston J. Effects of prenatal stress on maternal behavior in the rat. Brain Res. Dev. Brain Res. (2002) 139:1–8.[CrossRef][Medline]
- Moy S.S., Nadler J.J., Young N.B., Perez A., Holloway L.P., Barbaro R.P., Barbaro J.R., Wilson L.M., Threadgill D.W., Lauder J.M., et al. Mouse behavioral tasks relevant to autism: phenotypes of 10 inbred strains. Behav. Brain Res. (2007) 176:4–20.[CrossRef][Web of Science][Medline]
- Le Pen G., Moreau J.L. Disruption of prepulse inhibition of startle reflex in a neurodevelopmental model of schizophrenia: reversal by clozapine, olanzapine and risperidone but not by haloperidol. Neuropsychopharmacology (2002) 27:1–11.[CrossRef][Web of Science][Medline]
- Kusljic S., Brosda J., van den Buuse M. Effects of haloperidol and clozapine on sensorimotor gating deficits induced by 5-hydroxytryptamine depletion in the brain. Br. J. Pharmacol. (2006) 147:800–807.[CrossRef][Web of Science][Medline]
- Clapcote S.J., Lipina T.V., Millar J.K., Mackie S., Christie S., Ogawa F., Lerch J.P., Trimble K., Uchiyama M., Sakuraba Y., et al. Behavioral phenotypes of Disc1 missense mutations in mice. Neuron (2007) 54:387–402.[CrossRef][Web of Science][Medline]
- Simpkiss J.L., Devine D.P. Responses of the HPA axis after chronic variable stress: effects of novel and familiar stressors. Neuro. Endocrinol. Lett. (2003) 24:97–103.[Medline]
- Lee P.R., Brady D.L., Shapiro R.A., Dorsa D.M., Koenig J.I. Prenatal stress generates deficits in rat social behavior: Reversal by oxytocin. Brain Res. (2007) 1156:152–167.[CrossRef][Web of Science][Medline]
-
Watkins A.J., Ursell E., Panton R., Papenbrock T., Hollis L., Cunningham C., Wilkins A., Perry V.H., Sheth B., Kwong W.Y., et al. Adaptive responses by mouse early embryos to maternal diet protect fetal growth but predispose to adult onset disease. Biol. Reprod. (2008) 78:299–306.
[Abstract/Free Full Text] - Weinstock M. Alterations induced by gestational stress in brain morphology and behavior of the offspring. Prog. Neurobiol. (2001) 65:427–451.[CrossRef][Web of Science][Medline]
- Weinstock M. The long-term behavioral consequences of prenatal stress. Neurosci. Biobehav. Rev. (2008) 32:1073–1086.[CrossRef][Web of Science][Medline]
-
Mednick S.A., Machon R.A., Huttunen M.O., Bonett D. Adult schizophrenia following prenatal exposure to an influenza epidemic. Arch. Gen. Psychiatry (1988) 45:189–192.
[Abstract/Free Full Text] -
van Os J., Selten J.P. Prenatal exposure to maternal stress and subsequent schizophrenia. The May 1940 invasion of The Netherlands. Br. J. Psychiatry (1998) 172:324–326.
[Abstract/Free Full Text] -
Khashan A.S., Abel K.M., McNamee R., Pedersen M.G., Webb R.T., Baker P.N., Kenny L.C., Mortensen P.B. Higher risk of offspring schizophrenia following antenatal maternal exposure to severe adverse life events. Arch. Gen. Psychiatry (2008) 65:146–152.
[Abstract/Free Full Text] -
Mueller B.R., Bale T.L. Sex-specific programming of offspring emotionality after stress early in pregnancy. J. Neurosci. (2008) 28:9055–9065.
[Abstract/Free Full Text] - Mueller B.R., Bale T.L. Early prenatal stress impact on coping strategies and learning performance is sex dependent. Physiol. Behav. (2007) 91:55–65.[CrossRef][Medline]
- O'Rahilly R. Early human development and the chief sources of information on staged human embryos. Eur. J. Obstet. Gynecol. Reprod. Biol. (1979) 9:273–280.[CrossRef][Web of Science][Medline]
- Bayer S.A., Altman J., Russo R.J., Zhang X. Timetables of neurogenesis in the human brain based on experimentally determined patterns in the rat. Neurotoxicology (1993) 14:83–144.[Web of Science][Medline]
- Clancy B., Finlay B.L., Darlington R.B., Anand K.J. Extrapolating brain development from experimental species to humans. Neurotoxicology (2007) 28:931–937.[CrossRef][Web of Science][Medline]
- Poltyrev T., Gorodetsky E., Bejar C., Schorer-Apelbaum D., Weinstock M. Effect of chronic treatment with ladostigil (TV-3326) on anxiogenic and depressive-like behavior and on activity of the hypothalamic-pituitary-adrenal axis in male and female prenatally stressed rats. Psychopharmacology (Berl) (2005) 181:118–125.[CrossRef][Medline]
- Fameli M., Kitraki E., Stylianopoulou F. Maternal behavior of dams treated with ACTH during pregnancy. Physiol. Behav. (1995) 57:397–400.[CrossRef][Medline]
- Moore C.L., Power K.L. Prenatal stress affects mother-infant interaction in Norway rats. Dev. Psychobiol. (1986) 19:235–245.[CrossRef][Web of Science][Medline]
- Baker S., Chebli M., Rees S., Lemarec N., Godbout R., Bielajew C. Effects of gestational stress: 1. evaluation of maternal and juvenile offspring behavior. Brain Res. (2008) 1213:98–110.[CrossRef][Web of Science][Medline]
- Lu L., Mamiya T., Lu P., Niwa M., Mouri A., Zou L.B., Nagai T., Hiramatsu M., Nabeshima T. The long-lasting effects of cross-fostering on the emotional behavior in ICR mice. Behav. Brain Res. (2009) 198:172–178.[CrossRef][Web of Science][Medline]
- Estanislau C., Morato S. Prenatal stress produces more behavioral alterations than maternal separation in the elevated plus-maze and in the elevated T-maze. Behav. Brain Res. (2005) 163:70–77.[CrossRef][Web of Science][Medline]
-
Vallee M., Mayo W., Dellu F., Le Moal M., Simon H., Maccari S. Prenatal stress induces high anxiety and postnatal handling induces low anxiety in adult offspring: correlation with stress-induced corticosterone secretion. J. Neurosci. (1997) 17:2626–2636.
[Abstract/Free Full Text] - Crawley J.N. Mouse behavioral assays relevant to the symptoms of autism. Brain Pathol. (2007) 17:448–459.[CrossRef][Web of Science][Medline]
- Pinkham A.E., Hopfinger J.B., Pelphrey K.A., Piven J., Penn D.L. Neural bases for impaired social cognition in schizophrenia and autism spectrum disorders. Schizophr. Res. (2008) 99:164–175.[CrossRef][Web of Science][Medline]
- O'Tuathaigh C.M., Babovic D., O'Sullivan G.J., Clifford J.J., Tighe O., Croke D.T., Harvey R., Waddington J.L. Phenotypic characterization of spatial cognition and social behavior in mice with knockout of the schizophrenia risk gene neuregulin 1. Neuroscience (2007) 147:18–27.[CrossRef][Web of Science][Medline]
- Iyer S.N., Boekestyn L., Cassidy C.M., King S., Joober R., Malla A.K. Signs and symptoms in the pre-psychotic phase: description and implications for diagnostic trajectories. Psychol. Med. (2008) 38:1147–1156.[Web of Science][Medline]
- Takahashi L.K., Haglin C., Kalin N.H. Prenatal stress potentiates stress-induced behavior and reduces the propensity to play in juvenile rats. Physiol. Behav. (1992) 51:319–323.[CrossRef][Medline]
- File S.E., Hyde J.R. Can social interaction be used to measure anxiety? Br. J. Pharmacol. (1978) 62:19–24.[Web of Science][Medline]
- File S.E., Hyde J.R. A test of anxiety that distinguishes between the actions of benzodiazepines and those of other minor tranquilisers and of stimulants. Pharmacol. Biochem. Behav. (1979) 11:65–69.[CrossRef][Web of Science][Medline]
- Patin V., Lordi B., Vincent A., Caston J. Effects of prenatal stress on anxiety and social interactions in adult rats. Brain. Res. Dev. Brain. Res. (2005) 160:265–274.[CrossRef][Medline]
- Liu Z.H., Smith C.B. Dissociation of social and nonsocial anxiety in a mouse model of fragile X syndrome. Neurosci. Lett. (2009) 454:62–66.[CrossRef][Web of Science][Medline]
- Halene T.B., Ehrlichman R.S., Liang Y., Christian E.P., Jonak G.J., Gur T.L., Blendy J.A., Dow H.C., Brodkin E.S., Schneider F., et al. Assessment of NMDA receptor NR1 subunit hypofunction in mice as a model for schizophrenia. Genes Brain Behav. (2009) doi: 10.1111/j.1601-183X.2009.00504.x.
- Powell S.B., Zhou X., Geyer M.A. Prepulse inhibition and genetic mouse models of schizophrenia. Behav. Brain Res. (2009) doi:10.1016/j.bbr.2009.04.021.
- McOmish C.E., Burrows E., Howard M., Scarr E., Kim D., Shin H.S., Dean B., van den Buuse M., Hannan A.J. Phospholipase C-beta1 knockout mice exhibit endophenotypes modeling schizophrenia which are rescued by environmental enrichment and clozapine administration. Mol. Psychiatry (2008) 13:661–672.[CrossRef][Web of Science][Medline]
-
Swerdlow N.R., Bakshi V., Geyer M.A. Seroquel restores sensorimotor gating in phencyclidine-treated rats. J. Pharmacol. Exp. Ther. (1996) 279:1290–1299.
[Abstract/Free Full Text] -
Shi L., Fatemi S.H., Sidwell R.W., Patterson P.H. Maternal influenza infection causes marked behavioral and pharmacological changes in the offspring. J. Neurosci. (2003) 23:297–302.
[Abstract/Free Full Text] - Varty G.B., Powell S.B., Lehmann-Masten V., Buell M.R., Geyer M.A. Isolation rearing of mice induces deficits in prepulse inhibition of the startle response. Behav. Brain Res. (2006) 169:162–167.[CrossRef][Web of Science][Medline]
- Eells J.B., Misler J.A., Nikodem V.M. Early postnatal isolation reduces dopamine levels, elevates dopamine turnover and specifically disrupts prepulse inhibition in Nurr1-null heterozygous mice. Neuroscience (2006) 140:1117–1126.[CrossRef][Web of Science][Medline]
- Yang J., Li W., Liu X., Li Z., Li H., Yang G., Xu L., Li L. Enriched environment treatment counteracts enhanced addictive and depressive-like behavior induced by prenatal chronic stress. Brain Res. (2006) 1125:132–137.[CrossRef][Web of Science][Medline]
- Solberg L.C., Valdar W., Gauguier D., Nunez G., Taylor A., Burnett S., Arboledas-Hita C., Hernandez-Pliego P., Davidson S., Burns P., et al. A protocol for high-throughput phenotyping, suitable for quantitative trait analysis in mice. Mamm. Genome (2006) 17:129–146.[CrossRef][Web of Science][Medline]
- Crawley J.N., Belknap J.K., Collins A., Crabbe J.C., Frankel W., Henderson N., Hitzemann R.J., Maxson S.C., Miner L.L., Silva A.J., et al. Behavioral phenotypes of inbred mouse strains: implications and recommendations for molecular studies. Psychopharmacology (Berl) (1997) 132:107–124.[CrossRef][Medline]
- Ducottet C., Belzung C. Correlations between behaviors in the elevated plus-maze and sensitivity to unpredictable subchronic mild stress: evidence from inbred strains of mice. Behav. Brain Res. (2005) 156:153–162.[CrossRef][Web of Science][Medline]
- Contet C., Rawlins J.N., Deacon R.M. A comparison of 129S2/SvHsd and C57BL/6JOlaHsd mice on a test battery assessing sensorimotor, affective and cognitive behaviors: implications for the study of genetically modified mice. Behav. Brain Res. (2001) 124:33–46.[CrossRef][Web of Science][Medline]
-
Molnar Z., Lopez-Bendito G., Small J., Partridge L.D., Blakemore C., Wilson M.C. Normal development of embryonic thalamocortical connectivity in the absence of evoked synaptic activity. J. Neurosci. (2002) 22:10313–10323.
[Abstract/Free Full Text] - Sorensen J.B., Nagy G., Varoqueaux F., Nehring R.B., Brose N., Wilson M.C., Neher E. Differential control of the releasable vesicle pools by SNAP-25 splice variants and SNAP-23. Cell (2003) 114:75–86.[CrossRef][Web of Science][Medline]
-
Pan P.Y., Cai Q., Lin L., Lu P.H., Duan S., Sheng Z.H. SNAP-29-mediated modulation of synaptic transmission in cultured hippocampal neurons. J. Biol. Chem. (2005) 280:25769–25779.
[Abstract/Free Full Text] -
Holt M., Varoqueaux F., Wiederhold K., Takamori S., Urlaub H., Fasshauer D., Jahn R. Identification of SNAP-47, a novel Qbc-SNARE with ubiquitous expression. J. Biol. Chem. (2006) 281:17076–17083.
[Abstract/Free Full Text] - Wilson M.C. Coloboma mouse mutant as an animal model of hyperkinesis and attention deficit hyperactivity disorder. Neurosci. Biobehav. Rev. (2000) 24:51–57.[CrossRef][Web of Science][Medline]
- Steffensen S.C., Henriksen S.J., Wilson M.C. Transgenic rescue of SNAP-25 restores dopamine-modulated synaptic transmission in the coloboma mutant. Brain Res. (1999) 847:186–195.[CrossRef][Web of Science][Medline]
- Pletnikov M.V., Ayhan Y., Nikolskaia O., Xu Y., Ovanesov M.V., Huang H., Mori S., Moran T.H., Ross C.A. Inducible expression of mutant human DISC1 in mice is associated with brain and behavioral abnormalities reminiscent of schizophrenia. Mol. Psychiatry (2008) 13:173–186.[CrossRef][Web of Science][Medline]
- Fatemi S.H., Sidwell R., Kist D., Akhter P., Meltzer H.Y., Bailey K., Thuras P., Sedgwick J. Differential expression of synaptosome-associated protein 25 kDa [SNAP-25] in hippocampi of neonatal mice following exposure to human influenza virus in utero. Brain Res. (1998) 800:1–9.[CrossRef][Web of Science][Medline]
- Swerdlow N.R., Geyer M.A., Braff D.L. Neural circuit regulation of prepulse inhibition of startle in the rat: current knowledge and future challenges. Psychopharmacology (Berl) (2001) 156:194–215.[CrossRef][Medline]
- Swerdlow N.R., Weber M., Qu Y., Light G.A., Braff D.L. Realistic expectations of prepulse inhibition in translational models for schizophrenia research. Psychopharmacology (Berl) (2008) 199:331–388.[CrossRef][Medline]
- Lupien S.J., McEwen B.S., Gunnar M.R., Heim C. Effects of stress throughout the lifespan on the brain, behavior and cognition. Nat. Rev. Neurosci. (2009) 10:434–445.[CrossRef][Web of Science][Medline]
- Denver R.J. Structural and functional evolution of vertebrate neuroendocrine stress systems. Ann. N. Y. Acad. Sci. (2009) 1163:1–16.[CrossRef][Web of Science][Medline]
- Arguello P.A., Gogos J.A. Modeling madness in mice: one piece at a time. Neuron (2006) 52:179–196.[CrossRef][Web of Science][Medline]
- Tordjman S., Drapier D., Bonnot O., Graignic R., Fortes S., Cohen D., Millet B., Laurent C., Roubertoux P.L. Animal models relevant to schizophrenia and autism: validity and limitations. Behav. Genet. (2007) 37:61–78.[CrossRef][Web of Science][Medline]
- Desbonnet L., Waddington J.L., O'Tuathaigh C.M. Mutant models for genes associated with schizophrenia. Biochem. Soc. Trans. (2009) 37:308–312.[CrossRef][Web of Science][Medline]
-
Oliver P.L., Bitoun E., Davies K.E. Comparative genetic analysis: the utility of mouse genetic systems for studying human monogenic disease. Mamm. Genome (2007) 18:412–424.[CrossRef][Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





