Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Buresi, C.
Right arrow Articles by Roizes, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Buresi, C.
Right arrow Articles by Roizes, G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 61-69
Structural analysis of the minisatellite present at the 3' end of the human apolipoprotein B gene: new definition of the alleles and evolutionary implications
Introduction
Results
   Sequence analysis and allele-specific PCR
   Haplotypes determination
   Analysis of the chimpanzee minisatellite
Discussion
Materials And Methods
   Subjects
   SspI digestion
   Sequence determination
   Allele-specific PCR
   Haplotyping
Acknowledgements
References

Structural analysis of the minisatellite present at the 3' end of the human apolipoprotein B gene: new definition of the alleles and evolutionary implications

Structural analysis of the minisatellite present at the 3 ' end of the human apolipoprotein B gene: new definition of the alleles and evolutionary implications Catherine Buresi1, Eric Desmarais1, Suzanne Vigneron1, Hatim Lamarti1, Nizar Smaoui2, François Cambien3 and Gérard Roizes1,*

1INSERM U 249, CNRS UPR 9008, Montpellier, France, 2Service de Génétique, Hôpital Charles Nicolle, Tunis, Tunisia and 3Service Commun no. 7, INSERM, 75005 Paris, France

Received April 13, 1995; Revised and Accepted October 18, 1995

The internal structure of different alleles of the minisatellite present at the 3' end of the apolipoprotein B (ApoB) gene has been analysed by different approaches including sequencing. The repeat unit arrangements of the minisatellite on 570 chromosomes belonging to European and African populations were thus determined. It was possible to group the alleles using this structural criterion much more clearly than by the number of repeat units which can in some cases be misleading in case-control genetic epidemiological studies using such DNA sequences as markers. We were thus able to define five types (a to e) of alleles and their subtypes and to recognize clearly those which are, respectively, specific of the African and Caucasian populations. A phylogeny of the different alleles found in all human populations could also be deduced by this approach. The different putative mutational events leading from one type, or subtype, to the other were simply determined as point mutations, expansion/contraction and conversion events. Sequencing of one chimpanzee's allele suggested that the ApoB minisatellite was present before divergence between great apes and humans. It was determined also that a particular ApoB gene haplotype was in linkage disequilibrium with the minisatellite (a) type of alleles. This and the observation that the potential scaffold attachment regions (SAR) and topoisomerase II binding sites present in this minisatellite have a different distribution between the Caucasian and the African specific alleles suggest that the minisatellite could be involved in the epidemiology of coronary diseases.

INTRODUCTION

Since their discovery, VNTRs (variable number of tandem repeats) are used as highly polymorphic markers in a wide spectrum of applications, such as genome mapping, paternity testing, population analysis and epidemiological studies. Microsatellites are relatively monotonous but minisatellites (1 ) exhibit a large range of sequence variations. Some are GC rich while others are AT rich as in the case of the minisatellite present at the 3' end of the human apolipoprotein B gene. Knott et al. (2 ) and Huang and Breslow (3 ) have sequenced five hypervariable elements (HVE) containing 34 (HVE 34) to 46 (HVE 46) repeat units. This allowed them to show that the differences between alleles were due to an extension of the repeats YX (X and Y being pure AT 15 nucleotides long repeats) and that the 3' end of the minisatellite contained variants of these two repeat units (X', X'', Y', Y'', and Y''') in which the pure AT sequence is interrupted by a C or a G. In a previous study, we have shown (4 ) that the molecular mechanism(s) that make(s) the copy number vary could be dependent on the nucleotide sequence of the repeat as variations were found to be much more frequent in the purely AT part of the minisatellite. We could also distinguish four domains (Fig. 1 ): the first one at the 5' end of the minisatellite is made of several repeat units of different kinds; the second consists in a variable number n of (YX) repeats; the third is partly dependent on the presence or absence of a Y''X repeat and the fourth is localized at the very 3' end of the minisatellite. It was finally shown that the least frequent alleles, those of intermediate sizes (38 <= HVE <= 46), have a different structure compared with those we considered as canonical. These results were essentially based on the restriction analysis of the different alleles because of the presence of a SspI site in the X, Y and X' repeat units.

The allele distribution within a black American population has been reported by Hixson et al. (5 ). In their study, they described new alleles (HVE21, 23) and the alleles of intermediate sizes (38 <= HVE <= 46) were found to be more frequent than in the white American population. Recently, we have found similar distributions and a new SspI restriction DNA fragment (120 bp long) in a large proportion of alleles in a Tunisian population (6 ). It was therefore tempting to sequence several alleles of different sizes and/or of SspI digestion patterns. The results allowed us to confirm our previous conclusions and to define some new structural characteristics of this minisatellite.


Figure 1.Structure of HVE 36: SspI restriction sites are indicated by short vertical arrows. The lengths of the SspI DNA fragments generated from PCR amplified DNA with ApoB3 and ApoB2 as primers are indicated.


Figure 2.Four to 12% gradient acrylamide gel electrophoresis of the SspI DNA fragments generated from the PCR products of a series of different alleles. Gel is stained by ethidium bromide and visualized under UV. The 91 and 61 bp fragments are present in all. Line 11: 10 bp ladder marker (Gibco BRL).Many studies of the ApoB gene, based on antigenic and DNA polymorphisms including the minisatellite (7 -9 ), have established a phylogeny of the ApoB gene found in human populations. Combining these data with the new structural characteristics of the minisatellite, we propose an evolutionary scheme for the locus with a putative ancestral type of allele which is supported also by the sequencing we have made of one chimpanzee's allele. Taking into account the structure of the minisatellite instead of the number of repeats, we show that the alleles distribution is different in Caucasian and African populations. In previous studies, associations between the ApoB gene polymorphisms and/or haplotypes with a higher risk of coronary diseases have been suggested (10 -15 ). Here we were able to associate one of these haplotypes with a subset of minisatellite alleles which all fall into the same type (a). This type of alleles is essentially absent from the African black populations which are recognized by epidemiological studies as having a lower risk of coronary diseases (16 -18 ). We therefore hypothesize that the ApoB AT rich minisatellite could be a factor in the epidemiology of coronary diseases.

RESULTS

Analysis by SspI total hydrolysis

As determined by sequencing of a set of different alleles (3 ,19 ,20 ), the ApoB 3' minisatellite is composed of two types of basic repeats, X and Y, which are uninterrupted AT stretches. Except for X' their derivatives X'', Y', Y'' and Y''' are devoid of the SspI site present in the former ones. The YX repeats are exclusively located at the 5' end of the VNTR so that the SspI sites are concentrated on one side and absent on the other (Fig. 1 ). By total SspI digestion and electrophoresis of the PCR products in 4-12% acrylamide gradient gel we detected several fragments (Fig. 2 ). Some are recurrent, i.e. the 61 and 91 bp fragments, but are not part of the HVR itself (Fig. 1 ). Similarly, the 39 bp fragment is detected in most of the cases and represents the 5' end of the locus.


Figure 3.Sequence of the first domain of three different alleles obtained after amplification with ApoB3 and ApoB2 as primers. (a) Sequence of an allele containing a mutation A to C, SspI site being absent. (b) Sequence of a 39 XY first domain. c: a mutation T to C in the 39 bp SspI fragment

The 266 bp fragment is frequently detected; sometimes 296, 236, 206, 150 or 120 bp fragments are detected instead. By this method, we have analysed the PCR products of 570 chromosomes: 180 from European individuals of the ECTIM program (21 ), 306 from a north African population and 84 from a black African group.

All the fragments already described by Desmarais et al. (4 ) in the same European population were also found to be present in the African samples. The 120 bp fragment was, however, only detected in the African populations. Another characteristic of the African groups is that, contrary to what was found in the Caucasian sampling, the 150 bp DNA fragment was not always associated with the 55 bp one (not shown).

Sequence analysis and allele-specific PCR

In order to analyse the internal structure of the alleles defined either by their lengths or by their SspI digestion patterns, 91 alleles were sequenced with the two external primers (ApoB3 and ApoB2, Fig. 1 ).

Sequencing the first domain at the 5' end revealed nucleotide variations in the 39 bp SspI fragment. First, an A to C mutation in the first unit (Fig. 3 a) changes X to X'' giving rise to a 55 bp fragment instead of the 39 one upon SspI digestion (Fig. 3 b). Second, in HVEs <= 30, a T to C mutation was sometimes detected (Fig. 3 c).

The sequences determined with ApoB2 as primer (3' end of the minisatellite, Fig. 1 ) showed a polymorphism in the 91 bp SspI fragment (Fig. 4 b), a T replacing a C. This prompted us to synthesize a new primer to analyse the PCR products by allele-specific PCR (Fig. 4 a). Four hundred and eight-two supplementary alleles were analysed by this approach.


Figure 4. (a) Allele-specific PCR analysed in BET stained agarose gels. Amplifications were obtained with the following couples of primers: Top (ApoB3-ApoB4), Bottom (ApoB3-ApoB2). (b) Sequence of the 91 bp SspI fragment showing a C/T polymorphism. A minor C band is visible in 91T due to imperfect purification of the allele after PCR from its 91C counterpart.

From the above analyses, we could determine the nature of the repeat arrangements which were responsible for the different largest DNA fragments generated by SspI:Fragments5'Sequences3'266 bp(Y''X'')5X''Y'''(X''Y')2X''X'236 bp(Y''X'')4X''Y'''(X''Y')2X''X'150 bp(Y''X'')1X''Y'''(X''Y')2X''X'120 bpX''Y'''(X''Y')2X''X' [up arrow] [up arrow]SspI SspI

The results obtained by combination of the three approaches are summarized in Table 1 and allowed us to type all the alleles according to the variations found in the different domains.


Figure 5.General presentation of the apolipoprotein B gene and of the different polymorphisms analysed in this study. From 5' to 3': the microsatellite (TG)n (n = 11-18); Signal peptide (I/D); XbaI (+/-); MspI (+/-) and EcoRI (+/-); 4311 mutation (Asn/Ser) and the 3' minisatellite (HVE 21-53). When a polymorphism has been determined as corresponding to a given antigenic site, this is indicated accordingly. In the last line is indicated the haplotype found here to be in linkage disequilibrium with the minisatellite alleles of type (a).

Haplotypes determination

Several haplotyping analyses of the ApoB gene have been published by combining the genotypes of different restriction sites, the signal peptide and the (TG)n repeat present 3 kb 5' of the transcription initiation site (7 -9 ,22 -25 ). Here, we have analysed 92 individual chromosomes belonging to 52 unrelated individuals for the above polymorphisms to which we added the minisatellite of this study. A clear linkage disequilibrium was thus established between type (a) (see Discussion) and the haplotype shown in Figure 5 .

Analysis of the chimpanzee minisatellite

As the DNA polymorphisms of the ApoB gene have been reported in a number of non-human primates (7 , 26 ), but not that of the 3' ApoB minisatellite found in humans, we tested for its presence and structure in chimpanzee DNA. The alleles found in the individual we analysed were HVEs 30 and 34 as estimated from their PCR products.

In a SspI hydrolysis (not shown) a number of DNA fragments identical or close to those obtained in humans were detected, in particular the two external 61 and 91 bp ones (Fig. 1 ); 206 and 40 bp DNA fragments were detected where in the human minisatellite one generally finds 236 and 39 bp instead. Both alleles were determined by allele-specific PCR as being 91C. This was confirmed by partial sequencing which was performed and allowed us to establish the following structure for HVE 30:

5'..... 40 X (Y*X)2Y5 - - - - - - - X''Y (X''Y')2X''X'91C.....3'

with Y* being different from Y by a C instead of a T at the 12th nucleotide.

DISCUSSION


Table 1 Classification of alleles as defined by their internal structure*Caucasian alleles, - north African alleles, z black African alleles


Figure 6.Phyletic relationships between the ApoB 3' minisatellite alleles in Caucasian and African populations. The ancestral allele has been established as indicated in the text. It derives from one or several alleles of which the structure is probably to be found in Africa. The molecular events which could have occurred to generate the alleles derived from the putative ancestral are shown by the arrows. Type (c) correspond to the allele associated with the ancestral haplotype of the ApoB gene determined by Rapacz (7).The internal structure of the 3' apoB minisatellite of 570 chromosomes could be analysed by a combination of SspI restriction analysis, sequence determination and allele-specific PCR. The results are summarized in Table 1 . They confirm and extend the existence of the four domains suggested in a previous study (4 ). While the three others are variable, the fourth one is strikingly constant and it is common to all the alleles analysed in this and other studies (2 ,3 ,5 ,19 ,20 ,23 ). It consists in a core block [X''Y'''(X''Y')2X''X'] which contains a particular repeat Y''' derived by a 4 bp deletion from a Y' repeat unit. This strongly suggests that this core block is ancestral to all the alleles found to date in all human populations as it is hard to imagine that this very same deletion occurred at several occasions during the evolution of the Apo B 3' minisatellite. This is supported further by the chimpanzee minisatellite DNA sequence of this study where a Y unit is found instead of Y'''.

In Table 2 , the alleles have been grouped according to their internal structure, the number of repeats appearing as a criterion of minor importance. As a matter of fact, it appears from this study that the length can no longer be used as such to define the alleles. They are actually differentiated into five different types and their eventual subtypes.

Type (a) is characteristic of the alleles >= HVE 48 or >= HVE 50 in the European and north African populations respectively: 39XX (YX)n (Y''X'')5 (core block) 91T. Note that in our black African sample HVEs >= 48 are totally absent and that in this population alleles of that type (a) contain only 36 and 38 repeats.

Type (b), the most frequent one, includes all HVE 36 and HVE 34 from the European populations: 39XY (YX)n (Y''X)(Y''X'')5 (core block) 91C.

Type (c), mostly represented by HVE 30 in all populations, corresponds to: 39XY (YX)n (Y''X'')4 (core block) 91C; it includes a subtype (c') which has undergone an A to C mutation in the 39 bp SspI DNA fragment (Fig. 3 c), thus becoming: 39CXY (YX)n (Y''X'')4 (core block) 91C.

Type (d) is characteristic exclusively of the African HVEs: 39XY XX (YX)n (Y''X'')1 (core block) 91C; while its subtype (d') corresponds to the HVE of intermediate sizes and is found in 15 of 67 European 40 <= HVE <= 46: 55X''Y XX (YX)n (Y''X'')1 (core block) 91C.

Type (e) is exclusively present in the African alleles: 39X (YX)n (Y''X)n' (core block) 91C, and can be subdivided into subtypes (e') and (e'') when the number of Y''X repeats are 3 and 5 respectively.

To determine the structural traits characteristic of the ancestral allele, we have taken into account the results of other studies which have tentatively established a phylogeny of the human apolipoprotein B gene (7 -9 ). By combining the data of these studies (epitopes of antigenic sites located along the ApoB polypeptide and restriction polymorphisms of the gene) (Fig. 5 ), Rapacz et al. (7 ) established that haplotype 13 (g d t y i) was ancestral to all human populations and determined that HVE 30 [here a type (c) allele] is the Caucasian ancestral allele. As an African origin of humans is now recognized, the ancestral HVE allele is, therefore, found either among those which are specific of the African populations or among those which are common to both the Caucasian and African populations. As types (d) and (e) are found exclusively in African populations, this strongly supports the phylogeny shown in Figure 6 : Type (c), common to all populations arose from type (d) which has the type (e) as a putative ancestral allele. This is suggested also by the chimpanzee DNA sequence presented here as it is closer to type (e) than to any other one.

In addition to an increase in copy number and to point mutations, one has only to consider putative conversion events to fit with this evolutionary scheme:

Conversion 1:

(e) XYX YX

[up arrow] -> (d)XYXXYX

(e) XYX

Conversion 2:

(d) XY X XYX

[up arrow] -> (c)XYYXYX

(e) X Y XYX

Conversion 3:

(c) X Y YXYX

[up arrow] -> (a)XXYXYX

(d) XYX X YXYX

These events occurred at the very first 5' repeat units as this has been recently demonstrated by Jeffreys et al. (27 ) with MS32, MS31A and MS205 minisatellites, which renders their suggestion, that a protein might bind to a mutation initiator element in the 5' flanking DNA of the VNTR, plausible also for the ApoB minisatellite.

Clearly, large (HVE >= HVE 48), intermediate (HVE 38 <= HVE <= HVE 46) and small alleles (HVE <= HVE 36) represent three distinct classes which have been separated early during the course of evolution. They only share the second domain which is prone to variations in copy number as we have already shown (4 ) and which was confirmed recently by Ellsworth et al. (23 ). They remained well separated and, apparently, meiotic unequal crossing over has not destroyed this almost perfect segregation. A confirmation of this is found in the fact that a specific haplotype has remained associated to the minisatellite alleles of type (a). Particularly striking in that respect is the complete linkage disequilibrium between the absence of EcoRI site in exon 29 and the type (a) alleles.

Strikingly, the core block of the fourth domain has remained unchanged. This can be compared with microsatellites where instability has been observed to be proportional to perfect copy number (28 ) as it is made of various types of basic repeats. The same hypothesis has been put forward to explain expansion of the CCG repeat in fragile X in affected individuals (29 ). This would also fit well with the relative variability observed in the second domain which consists of uninterrupted YX repeats.

The mutation rate in the second domain does not seem to be as high as that observed in MS32, MS31A and MS205 and, moreover, there is no indication of a bias towards gains in copy number. In spite of the absence of an estimation of the real rate of mutation by sperm pool-PCR for instance (27 ) one can, however, consider this relatively low mutation rate as expected from the relationship found between mutation rate and heterozygosity (30 ).

Clearly, differences in the allele distribution between north Africans and black Africans (Fig. 7 ) are due to an excess of type (d) and (e) in the latter and to a relative introgression into the north African population which is considered as mainly of Caucasian origin.


Figure 7.Distribution of the alleles of the minisatellite in north and black African populations. The internal structure is used as the criterion.

This fits well with the putative phylogeny shown in Figure 6 where a clear separation of the alleles as `Caucasian' types (a) and (b) or `black African' [types (d) and (e)] can be distinguished. Two alternatives can explain these differences: founder effects in the Caucasian populations and/or a protective factor associated with the alleles found preferentially in the black Africans. This might suggest that this difference has some importance in epidemiological studies.

In spite of higher risk factors such as hypertension, diabetes, dyslipidemia in black populations, these ethnic groups seem to be protected from coronary pathologies (16 -18 ). The incidence of these multifactorial diseases is correlated with the level of LDL cholesterol and the apolipoprotein B gene is a candidate for these affections. Among the numerous epidemiological studies which have been done some have associated the `large' alleles (HVE >= HVE 48) to a higher risk of myocardial infarction in European populations (10 -12 ,14 ). The apolipoprotein B 3500 mutation which has been found in familial hypercholesterolemia with defective apolipoprotein B100 (24 ,25 ) is associated with the same haplotype which has been found associated with type (a) alleles of rare occurrence in the African black population.

It is tempting, therefore, to suggest that the minisatellite present at the 3' end of the apolipoprotein B gene might be involved in the control of its expression as this has been already demonstrated in a number of cases such as Hras 1 gene, transcription factor rel/NF[kappa]B, or insulin gene (31 -35 ).

In this line, it is also interesting to note that the whole Apo B gene is DNase I sensitive (36 ), including the minisatellite which contains one hypersensitive site in the middle (37 ). This is indicative of the potential binding site for various proteins among which topoisomerase II is obviously a candidate. Moreover, the minisatellite contains also a matrix attachment region (MAR).

As shown in Figure 8 , MAR or SAR (scaffold attachment region)-AATATTTT-sites are indeed present within the repeat units X and X', but topoisomerase II sites-ATATTT-are present in the repeat units Y, X and derivatives (X' and X''). Again, a segregation holds between African and Caucasian populations, as the distance of the two most distal SAR sites is larger in types (a) (b) and (c) than in types (d) and (e). These facts, again, strongly suggest that the structure of the minisatellite could be implied in the expression of the Apo B gene.


Figure 8.Position of different SAR sites (AATATTT) and topoisomerase II sites (ATATTT) according to the internal structure of the minisatellite. (a) to (e) are the different types of alleles described in Figure 6.

Table 2 PCR primers and annealing temperatures
Names

 Sequences

 Names

 Sequences

 Annealing temp.
ApoB3

 AACGGAGAAATTATGGAGGG

 Apo B2

GCACATGAAGACACCAGAGG

 60oC
"

 "

 Apo B4

CCTGAGATCAATAACCTCG

 57oC
BEC1:

 CTGGCTTGCTAACCTCTCTG

 BEC2:

 GAGAAGCTTCCTGAAGCTCG

 62oC
BMS1:

 TCTCGGGAATATTCAGGAACTATTG

 BMS2:

 CTAAGGATCCTGCAATGTCAAGGT

 62oC
BXB1:

 AAATAACCTTAATCATCAATTGGT

 BXB2:

 GGTTCTTAGCAGCAAGAGTCC

 54oC
SP1:

 AGCTGGCGATGGACCCGCCG

 SP2:

 TTCGGCCCTGGCGCCCGCCAG

 68oC
TG1:

 ATTTCTTTCCTGATAGTTCTC

 TG2:

 CGTGTCAAGGTAGATGTTAC

 57oC

MATERIALS AND METHODS

Subjects

Genomic DNA was provided by the ECTIM program (21 ) for the 180 European individuals (Belfast, Ireland; Lille, Strasbourg and Toulouse, France). Genomic DNA from 123 unrelated Tunisian and 60 unrelated Moroccan individuals was extracted from white blood cells by phenol/chloroform.

DNA from 42 black African individuals was kindly provided by Dr G. Lucotte (Paris) and Dr G. Lefranc (Montpellier).

The length of the different alleles has been estimated by Moreel (21 ) for the ECTIM individuals and by Buresi et al. (6 ) for the African ones.

SspI digestion

Ten to 20 [mu]l of PCR products were digested overnight with 7.5 units of SspI (Biolabs). The digested products were run on a 4-12% gradient acrylamide gel in TBE 0.5*; 447 alleles were thus analysed.

Sequence determination

After electrophoresis in 2% W/V Seaplaque GTG (Low Melting Point Agarose)/TBE 0.5*, the PCR products corresponding to each allele to be sequenced were extracted from the gel under UV light and purified using the Gene-Clean Kit (Bio101). They were resuspended in 20-40 [mu]l H2O. Three [mu]l of these purified samples were run on agarose gel to estimate their concentration and 1-8 [mu]l were used for sequencing, which was done according to Casanova et al. (38 ). Ninety-one samples were sequenced.

Allele-specific PCR

A C or a T was determined by sequencing to be present 38 nucleotides after the last repeat at the 3' end of the locus (Fig. 1 ). An oligonucleotide primer was therefore synthesized (ApoB4) to discriminate this sequence difference. Controls consisting in alleles of known sequence (with a T or a C at this position) were tested in parallel in each experiment to ensure that the PCR was really allele specific. This method allowed us to extend the observation made through the sequencing of a relatively limited number of alleles (91) to 570 in all. Five [mu]l of amplified DNA was electrophoresed in 1.4% agarose gel at 100 V for 2-3 h and PCR products were visualized under UV light after ethidium bromide staining.

Haplotyping

5' (TG)n polymorphism: PCR was performed with primers TG1 and TG2. The PCR product were run on a 10% acrylamide gel at 250 V for 5 h. Fragments were visualised under UV light after ethidium bromide staining. Two alleles (TG)14 and (TG)15 were sequenced to determine the exact number of repeats (26 ).Signal peptide polymorphism: PCR was performed with primers SP1 and SP2. The PCR product, was run on a 10% acrylamide gel at 250 V for 3 h. Fragments of 83 and/or 92 bp were visualized under UV light after ethidium bromide staining (39 ).4311 mutation: PCR was performed with primers BEC1 and BEC2. The PCR product, 920 bp in length, was analysed by Denaturing Gradient Gel Electrophoresis (DGGE), at 150 V for 3 h. Fragments were visualized under UV light after ethidium bromide staining (40 ).Restriction polymorphisms of XbaI, MspI, EcoRI: After PCR with primers BXB1-BXB2, BMS1-BMS2, and BEC1-BEC2 respectively, eight [mu]l of the PCR products were digested with 5 units of restriction endonucleases overnight and run on 1.4% agarose gel (41 ).

ACKNOWLEDGEMENTS

The authors would like to thank G. Lefort (Montpellier) for helpful discussion. This work was supported by grants from Merck/INSERM, CNRS, ARC and AFM.

REFERENCES

1 Jeffreys, A.J., Wilson, V., and Thein, S.L. (1985) Hypervariable `minisatellite' region in human DNA. Nature 314, 67-70. MEDLINE Abstract

2 Knott, T.J., Wallis, S.C., Pease, R.J., Powell, L.M., and Scott, J. (1986) A hyper-variable region 3' to the human apolipoprotein B gene. Nucleic Acids Res. 14, 9215-9216. MEDLINE Abstract

3 Huang, L.S. and Breslow, J.L. (1987) A unique AT-rich hyper-variable minisatellite 3' to the ApoB Gene. J. Biol. Chem. 262, 8952-8955. MEDLINE Abstract

4 Desmarais, E., Vigneron, S., Buresi, C., Cambien, F., Cambou, J.P., and Roizes, G. (1993) Variant mapping of the Apo (B) rich minisatellite. Dependence on nucleotide sequence of the copy number variations. Instability of the non-canonical alleles. Nucleic Acids Res. 21, 2179-2184. MEDLINE Abstract

5 Hixson, J., Powers, P., and McMahan, C.A. (1993) The human apolipoprotein B 3' hypervariable region: detection of eight new alleles and comparisons of allele frequencies in Blacks and Whites. Hum. Genet. 91, 475-479. MEDLINE Abstract

6 Buresi, C., Desmarais, E., Vigneron, S., Ben Rayana, C., Chaabouni, H., and Roizes, G. (1995) Genet.Epidemiol. 12, 381-389.

7 Rapacz, J., Chen, L., Butler-Brunner, E., Wu, M.J., Hasler-Rapacz, J.O., Butler, R., and Schumaker, V.N. (1991) Identification of the ancestral haplotype for apolipoprotein B suggests an African origin of Homo sapiens sapiens and traces their subsequent migration to Europe and the Pacific. Proc. Natl Acad. Sci. USA 88, 1403-1406. MEDLINE Abstract

8 Renges, H.H., Peacock, R., Dunning, A.M., Talmud, P., and Humphries, S. (1992) Genetic relationship between the 3'-VNTR and diallelic apolipoprotein B gene polymorphisms: Haplotype analysis in individuals of European and South Asian origin. Ann. Hum. Genet. 56, 11-33. MEDLINE Abstract

9 Dunning, A.M., Renges, H.H., Hamsten, A., Talmud, P., and Humphries, S. (1993) A postulated phylogenic tree for the human apolipoprotein B gene: unpredicted haplotypes are associated with elevated apo B levels. B B A. 1165, 271-278.

10 Hegele, R., Huang, L.S., Herbert, P., Blum, C., Buring, J., Hennekens, C., and Breslow, J. (1986) Apolipoprotein B-gene DNA polymorphisme associated with myocardial infarction. N. Engl. J. Med. 315, 1509-1515. MEDLINE Abstract

11 Talmud, P., Barni, N., Kessling, A., Carlsson, P., Darfors, C., Bjursell, G., Galton, D., Wynn, V., Kirk, H., Hayden, M., and Humphries, S. (1987) Apolipoprotein B gene variants are involved in the determination of serum cholesterol levels: a study in normo-and hyperlipidaemic individuals. Atherosclerosis 67, 81-89. MEDLINE Abstract

12 Friedl, W., Ludwig, E., Paulweber, B., Danshofer, F., and McCarthy, B. (1990) Hypervariability in a minisatellite 3' of the apolipoprotein B gene in patients with coronary heart disease compared with normal controls. J. Lipid Res. 31, 659-665. MEDLINE Abstract

13 Paulweber, B., Friedl, W., Krempler, F., Humphries, S., and Sandhofer, F. (1990) Association of DNA polymorphism at the apolipoprotein B gene locus with coronary heart disease and serum very low density lipoprotein levels. Arteriosclerosis 10, 17-24. MEDLINE Abstract

14 Cambien, F., Evans, A.E., Cambou, J.P., Arveiler, D., Luc, G., Moreel, J.F.R., Jouin E., Desmarais, E., Bard, J.M., Poirier, O., Fruchart, J.C., Tiret, L. (1992) Body mass is associated with myocardial infarction in individuals carrying the 48 repeats allele of the ApoB 3' hypervariable region. Am. J. Hum. Genet. 51, A146.

15 Wu, J., Wen, M., Lo, S., and Chern, M. (1994) Increased frequency of apolipoprotein B signal peptide sp24/24 in patients with coronary artery disease. General allele survey in the population of Taiwan and comparison with Caucasians. Clin. Genet. 45, 250-254. MEDLINE Abstract

16 Gillum, R. and Grant, C. (1982) Coronary heat disease in Black populations. Am. Heart J. 104, 852-861. MEDLINE Abstract

17 Strong, J., Oalmann, M., Newman, W., Tracy, R., Malcom, G., Johson, W., McMahan, L., Rock, W., and Guzman, M. (1984) Coronary heart disease in young Black and White males in New Orleans: community pathology study. Am. Heart J. 108, 747-753. MEDLINE Abstract

18 Maynard, C., Fisher, L., Passamani, E., and Pullum, T. (1986) Blacks in the coronary artery surgery study: risk factors and coronary artery disease. Circulation 74, 64-71. MEDLINE Abstract

19 Ludwig, E.H., Friedl, W., and Mc Carthy, B.J. (1989) High resolution analysis of a hypervariable region in the human apolipoprotein B gene. Am. J. Hum. Genet. 45, 458-446. MEDLINE Abstract

20 Boerwinkle, E., Xiong, W., Fourest, E., and Chan, L. (1989) Rapid typing of tandemly repeated hypervariable loci by the polymerase chain reaction: Application to the Apolipoprotein B 3' hypervariable region. Proc. Natl Acad. Sci. USA 86, 212-216. MEDLINE Abstract

21 Moreel, J.F., Roizes, G., Evans, A.E., Arveiler, D., Cambou, J.P., Sourian, C., Parra, H.J. Desmarais, E., Fruchart, J.C., Ducimetiere, P., and Cambien, F. (1992) The polymorphism ApoB/4311 in patients with myocardial infarction and controls: the ECTIM study. Hum. Genet. 89, 169-175. MEDLINE Abstract

22 Jenner, K., Sidoli, A., Ball, M., Rodriguez, J.R., Pagani, F., Giudici, G., Vergani, C. et al., (1988) Characterization of genetic markers in the 3' end of the apo B gene and their use in family and population studies. Atherosclerosis 69, 39-49. MEDLINE Abstract

23 Elseworth, D., Shriver, M., and Boerwinkle, E. (1995) Nucleotide sequence analysis of the apolipoprotein B 3' VNTR. Hum. Mol. Genet. 4, 937-944. MEDLINE Abstract

24 Innerarity, T.L., Mahley, R.W., Weisgraber, K.H., Bersot, T.P., Krauss, R.M., Vega, G.L., Grundy, S.M., Friedl, W., Davignon, J., and McCarthy, B.J. (1990) Familial defective apolipoprotein B-100: a mutation of apolipoprotein B that causes hypercholesterolemia. J. Lipid Res. 31, 1337-1349. MEDLINE Abstract

25 Ludwig, E.H. and McCarthy B.J. (1990) Haplotype analysis of the human apolipoprotein B mutation associated with familial defective apolipoprotein B100. Am. J. Hum. Genet. 47, 712-720. MEDLINE Abstract

26 Ludwig, E.H., Haubold, K., McCarthy, B.J. (1991) Analysis of two different tandem repetitive elements within the human apolipoprotein B gene. J. Lipid Res. 32, 374-379. MEDLINE Abstract

27 Jeffreys, A.J., Tamaki, K., MacLeod, A., Monckton, D.G., Nei, D.L., and Armour, J.A.L. (1994) Complex gene conversion events in germline mutation at human minisatellites. Nature Genet. 6, 136-145. MEDLINE Abstract

28 Weber, J.L. (1990) Informativeness of human (dC.dA)n.(dG.dT)n polymorphisms. Science 252, 524-530.

29 Richards, R.I. and Sutherland, G.R. (1992) Dynamic mutations: a new class of mutations causing human disease. Cell 70, 709-712. MEDLINE Abstract

30 Jeffreys, A J., Royle, N J., Wilson, V., and Wong, Z. (1988) Spontaneous mutation rates to new length allelees at tandem-repetitive hypervariable loci in human DNA. Nature 332, 278-281. MEDLINE Abstract

31 Krontiris, T.G., Dimartino, N.A., Colb, M., and Parkinson, D.R. (1985) Unique allelic restriction fragments of the human Ha-ras 1 locus in leukocyte and tumors DNAs of cancer patients. Nature 313, 369-374. MEDLINE Abstract

32 Spandidos, D. and Holmes, L.(1987) Transcriptional enhancer activity in the variable tandem repeat DNQ sequence downstream of the human Ha-ras 1 gene. FEBS Lett. 218, 41-46. MEDLINE Abstract

33 Trepicchio, W.L. and Krontiris, T.G. (1992) Members of the rel/NF-kappa B family of transcriptional regulatory proteins bind the HRAS 1 minisatellite DNA sequence. Nucleic Acids Res. 20, 2427-2434. MEDLINE Abstract

34 Bennett, S.T., Lucassen, A.M., Gough, S.C.L., Powell, E.E., Undlien, D.E., Pritchard, L.E., Merriman, M.E., Kawaguchi, Y., Dronsfield, M.J., Pociot, F., Nerup, J., Bouzekri, N., Cambon-Thomsen, A., Ronningen, K.S., Barnett, A.H., Bain, S.C., and Todd, J.A. (1995) Susceptibility to human type 1 diabetes at IDDM2 is determined by tandem repeat variation at the insulin gene minisatellite locus. Nature Genet. 9, 284-292. MEDLINE Abstract

35 Lucassen, A.M., Julier, C, Beressi, J.P., Boitard, C., Froguel, P., Lathrop, M., and Bell, J.H. (1995) Susceptibility to insulin dependent diabetes mellitus maps to a 4.1 kb segment of DNA spanning the insulin gene and associated VNTR. Nature Genet. 9, 305-310. MEDLINE Abstract

36 Levy-Wilson, B. and Fortier, C. (1989) The limits of the DNAse-sensitive domain of the human apolipoprotein B gene coincide with the locations of chromosomal anchorage loops and define the 5' and 3' boundaries of the gene. J. Biol. Chem. 264, 21196-21204. MEDLINE Abstract

37 Levy-Wilson, B. (1990) DNAse I hypersensitive sites at the 3' end of the human apolipoprotein gene. Biochem. Biophys. Res. Commun. 171, 162-168. MEDLINE Abstract

38 Casanova, J.L., Pannetier, C., Jaulin, C., and Kourislsky, P. (1990) Optimal conditions for directly sequencing double-stranded PCR products with Sequenase. Nucleic Acids Res. 18, 4028. MEDLINE Abstract

39 Boerwinkle, E. and Chan, L. (1989) A three codon insertion/deletion polymorphism in the signal peptide region of the human apolipoprotein B (APOB) gene directly typed by the polymerase chain reaction. Nucleic Acids Res. 17, 4003. MEDLINE Abstract

40 Navarajas, M., Laurent A.M., Moreel, J.F., Ragab, A., Cambou, J.P., Cuny, G., Cambien, F., Roizès, G. (1990) Detection by denaturing gel electrophoresis of a new polymorphism in the apolipoprotein B gene. Hum. Genet. 86, 91-93. MEDLINE Abstract

41 Priestley, L., Wallis, S., Powell, L., Pease, R., Brunt, H., Scott, J. (1985) RFLP for the human apolipoprotein B gene. V; XbaI. Nucleic Acids Res. 13, 6793. MEDLINE Abstract

*To whom correspondence should be addressed at: INSERM U249, Institut de Biologie, Boulevard Henri IV, 34090 Montpellier, France

Journal Home Page

Home

Journals Home Page

Journals

OUP Home Page

OUP Home

Search

Search

Help

Help

jnl.info{at}oup.co.uk

-->

This page is maintained by OUP admin. Last updated Thu Oct 31 15:08:29 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Buresi, C.
Right arrow Articles by Roizes, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Buresi, C.
Right arrow Articles by Roizes, G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?