Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (39)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Gladwin, A. J.
Right arrow Articles by Dixon, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gladwin, A. J.
Right arrow Articles by Dixon, M. J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1533-1539
Treacher Collins syndrome may result from insertions, deletions or splicing mutations, which introduce a termination codon into the gene
Introduction
Results
Discussion
Materials And Methods
   Families
   Identification of genomic sequence
   Single-stranded conformation polymorphism analysis
   Sequence analysis
   Confirmation of mutations
   RT-PCR
Acknowledgements
References

Treacher Collins syndrome may result from insertions, deletions or splicing mutations, which introduce a termination codon into the gene

Treacher Collins syndrome may result from insertions, deletions or splicing mutations, which introduce a termination codon into the gene Amanda J. Gladwin, Jill Dixon, Stacie K. Loftus1, Sara Edwards, John J. Wasmuth1, Raoul C. M. Hennekam2 and Michael J. Dixon*

School of Biological Sciences and Departments of Dental Medicine and Surgery, 3.239, Stopford Building University of Manchester, Oxford Road, Manchester M13 9PT, UK, 1Department of Biological Chemistry, College of Medicine, University of California, Irvine, CA 92717, USA and 2Department of Pediatrics and Institute of Human Genetics, Academic Medical Centre, University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands

Received May 13, 1996; Revised and Accepted July 2, 1996

Treacher Collins syndrome is an autosomal dominant disorder of craniofacial development the features of which include conductive hearing loss and cleft palate. Recently, the Treacher Collins syndrome gene (TCOF1) has been positionally cloned and a series of five mutations within the coding sequence of the gene identified. In the current investigation, seven exons of TCOF1 have been identified which has permitted the identification of additional mutations in the gene. The mutations that have been identified are three distinct deletions and an insertion, which cause a frameshift, and a missense mutation which inactivates a donor splice site with extension of transcription into the intron. To date, all 10 of the mutations which have been reported result in a premature termination codon and are unique to a given family. As these mutations are spread throughout the gene, these observations provide further support for the hypothesis that Treacher Collins syndrome results from haploinsufficiency, although a dominant negative effect cannot, at this stage, be excluded.

INTRODUCTION

Treacher Collins syndrome is an autosomal dominant disorder of craniofacial development which has an incidence of approximately one in 50 000 live births (1 ,2 ). The clinical features of the condition are usually bilaterally symmetrical in nature and include: (i) abnormalities of the external ears frequently with atresia of the external auditory canals and anomalies of the middle ear ossicles, which results in bilateral conductive hearing loss (3 ); (ii) hypoplasia of the facial bones, particularly the mandible and zygomatic complex; (iii) downward slanting of palpebral fissures with colobomas of the lower eyelids and a paucity of lid lashes medial to the defect; (iv) cleft palate (1 ,2 ). While nonpenetrance is rare (4 ,5 ), diagnosis and subsequent genetic counselling may be extremely difficult as expression of the gene is highly variable. An additional complication in providing counselling arises from the high rate of de novo mutations; approximately 60% of cases arise in this way (6 ), particularly where the diagnosis of either of an affected child's parents is in doubt.

In the absence of a candidate gene or appropriate mouse model for the disorder, positional cloning strategies have been used to isolate the mutated gene which underlies Treacher Collins syndrome. The Treacher Collins syndrome locus (TCOF1) was initially mapped to human chromosome 5q31-34 using restriction fragment length polymorphisms (7 ). Subsequent linkage studies, which concentrated on the use of short tandem repeat polymorphisms (STRPs), permitted the refinement of the localisation to 5q32-33.1 (8 -12 ). The creation of a combined genetic linkage and radiation hybrid map around TCOF1 (13 ) facilitated the creation of yeast artificial chromosome and cosmid contigs across the TCOF1 critical region (9 ,14 ). A transcription map of this region was subsequently created (15 ,16 ) and a previously unidentified gene, which mapped proximal to RPS14, was isolated using a combination of exon-amplification and cDNA library screening (17 ). Initial screening of this gene resulted in the identification of five mutations (one point mutation and four insertions) all of which were predicted to cause frameshifts resulting in the creation of a premature termination codon. Nevertheless, the gene appears to be widely expressed and its function is not yet known. The identification of additional mutations in the gene may provide further information as to its functionally important regions and the mechanism underlying the pathogenesis of the disorder.

In the current investigation, the partial characterisation of the genomic organisation of TCOF1 has enabled us to screen the gene for additional mutations. This analysis has resulted in the identification of three deletions, one insertion and a highly unusual splicing mutation, all of which are unique to the affected family.

RESULTS

The intronic sequence flanking the previously trapped exons spanning nucleotides 254-327; 328-514; 515-588 and 2197-2376 (17 ) was determined. In addition, the portion of the cDNA between nucleotides 802 and 1206 was found to be encoded by two exons, encompassing nucleotides 802-996 and 997-1206, whereas that between nucleotides 2059 and 2196 was encoded by a single exon. The intron/exon boundary sequences that have been identified conform to the published consensus sequences (18 ) with the exception of the splice donor site of the exon which terminates at nucleotide 2196, which displays the sequence GC rather than the expected GT (Table 1 ). The remainder of this splice junction does, however, display a very close match to the consensus sequence. As the two exons encompassing nucleotides 2059-2196 and 2197-2376 were found to reside on the same cloned fragment it was possible to determine the entire sequence of the intervening intron which was found to be 138 bp long (Fig. 1 ).


Figure 1. Sequence of the intron lying between the exons spanning nucleotides 2095-2196 and 2197-2376. Upper case indicates exonic and lower case intronic sequence. Note that the 5' splice donor site has a GC in place of the more usual GT, but the surrounding sequence is a close match with the consensus AG/gtaagt. The stop codon is italicised and the cryptic splice site underlined. Compare with the sequence depicted in Figure 5f.

Table 1 . Partial genomic organisation of the TCOF1 locus
cDNA position

 Splice acceptor

 Splice donor
254- 327

 tttcttgcagCCCCA

 CCAAGgtgagtggga
328- 514

 ttctctgtagGCAGA

 GCCTGgtaagaagtc
515- 588

 cgatcctcagGGATG

 TGGAGgtaattgcca
802- 996

 gtttctccagGCGAA

 CTCAGgtgaggcaga
997-1206

 ctcactccagGCGAA

 CTCAGgtgaggctgg
2059-2196

 ctccactcagGTGAA

 CCAAGgcaagtgggg
2197-2376

 tgcaattcagGTGAA

 CTCAGgtgaggggga
Intronic sequence is indicated in lower case, exonic sequence in upper case. The cDNA position of the intron/exon boundaries is defined relative to the sequence indicated by the Treacher Collins Syndrome Collaborative Group (17).

Oligonucleotide primers designed from the intronic sequence were used to amplify each exon from genomic DNA and, in all cases, produced a single product of the predicted size (Table 2 ). Exons were subsequently amplified from the DNA of one individual from each of 33 Treacher Collins syndrome families and screened for mutations using single-stranded conformation polymorphism (SSCP) analysis. Mobility shifts were detected in four of the exons screened using this methodology. Screening of the exon spanning nucleotides 328-514 of the cDNA sequence presented by the Treacher Collins Syndrome Collaborative Group (17 ) identified mobility shifts in family 14 (Fig. 2 a,b). Sequence analysis identified a deletion of nucleotides 354 and 355 (Fig. 2 c), which creates a frameshift and premature stop codon after 38 amino acid residues. This mutation deletes a BsrI site allowing confirmation that the mutation was present in all of the affected, but none of the unaffected, members of the family (Fig. 2 d). In family SP19, which is a sporadic case of Treacher Collins syndrome (Fig. 3 a), SSCP analysis of the exon spanning nucleotides 515-588 identified a mobility shift that was unique to the affected son (Fig. 3 b). Sequencing of the underlying mutation revealed an AG deletion at nucleotides 579/580 (Fig. 3 c) which is predicted to cause a frameshift with premature termination of the protein after only seven amino acid residues. This mutation creates a PmlI site allowing confirmation of the mutation by restriction digestion (Fig. 3 d). In the case of this family (and family 25 detailed below) paternity was confirmed using the short tandem repeat polymorphisms D5S372, D5S519, ANX6 and SPARC (data not shown).


Figure 2. Identification of a TG deletion in TCOF1 family 14. (a) Pedigree of the family; solid symbols denote affected individuals. (b) SSCP analysis. A shift can be seen in individuals 1, 5, 6 and 7. (c) Sequence analysis of the normal (N) and mutant (M) alleles of individual 5. The mutation is arrowed. (d) The deletion removes a BsrI site allowing confirmation of the mutation. BsrI cleaves the 307 bp PCR product into fragments of 27, 109 and 171 bp in the case of the wildtype allele, and 136 and 171 bp in the case of the mutant allele.


Figure 3. AG deletion of nucleotides 579/580 in family SP19, which is a sporadic case of Treacher Collins syndrome. (a) Pedigree of the family. (b) SSCP analysis: a mobility shift is present in the affected child only. (c) Sequence of the normal (N) and mutant (M) alleles of the affected child, with the mutation arrowed. (d) The deletion creates a PmlI site which cleaves the 167 bp PCR product into 104 and 63 bp fragments that are only present in the affected child.

Table 2 . Primer sequences used in the current study
cDNA position of exon

 Primer sequences (5'-3')

 Size (bp)
254- 327

TCATCTGGCTCCTTTAGCAG
 

 TAGGCAATAGCTTGGAAGGC

 141
328- 514

 TTGGGTTCAGATGCAAGTGG
 

 AAGTTCTGGGGACTAGGTTC

 297
515- 588

 TGGAAAGGGAGTCCCTCAGT
 

 GTTCCTGGAAGGGTTAGAGG

 167
802- 996

 GTGTCCTGTGTCTCCTCAC
 

 TTTAGGCATGGGGCTACTCT

 298
997-1206

 ACCTTTGCCACATCCAGCTC
 

 TCTTTTGAGGCAGGGCACAG

 328
2059-2196

 CAATCTCACCTTCTCCCTCCT
 

 AACCCTCCACACCTCCTGTG

 219
2197-2376

 GGGAGTGGGACCTGAAAGAA
 

 CCCATGTAGGGGATGATCTC

 277

In the case of the exon spanning nucleotides 997-1206, different mobility shifts were identified in two small nuclear families. In family 6 (Fig. 4 a,b), the mutation identified was a single base pair insertion in codon 389 (Fig. 4 c), whilst that in family 23 was due to a single base pair deletion from codon 356 (data not shown). Again, both mutations are predicted to cause premature termination of the protein after three and 43 amino acids, respectively. Both of these mutations were confirmed as being disease-specific by ASO analysis in family 6 (Fig. 4 d) and by sequencing in family 23 (data not shown).


Figure 4.A residue insertion in TCOF1 family 6. (a) Pedigree of the family. (b) SSCP analysis reveals a mobility shift which is present in individuals 2, 3 and 4. (c) Sequence analysis of the normal (N) and mutant (M) alleles of individual 2, with the mutation arrowed. (d) Confirmation of the mutation in the family by ASO analysis.

SSCP analysis of the exon spanning nucleotides 2059 to 2196 revealed a mobility shift in family 25 (Fig. 5 a) which was present in an affected male, but not in his unaffected parents or sibling (Fig. 5 b). Sequencing of the underlying nucleotide alteration revealed a G to A transition in the last base of codon 732 (Fig. 5 c). Confirmation that this sequence change was disease-specific was provided by restriction digestion as the G to A transition resulted in the deletion of a StyI site (Fig. 5 d). As this apparently silent polymorphism (AAG-AAA) occurred in the last base of the exon the possibility that it interfered with splicing was raised. The sequence of the two exons flanking the exon containing the sequence alteration was therefore used to construct oligonucleotide primers for use in the PCR. RT-PCR analysis of RNA extracted from the patient's lymphoblasts revealed the presence of two bands, one of 213 bp and the other of approximately 300 bp (Fig. 5 e). The smaller band, which would be predicted to correspond with the normal allele, was also present in unaffected individuals, whilst the larger band was only found in the individual in whom the SSCP mobility shift had been identified (Fig. 5 e). Sequence analysis confirmed that the smaller of the two bands corresponded with the normal allele with the three exons being correctly spliced together (Fig. 5 f). In contrast, the larger band was found to contain the G to A transition of the last base of the exon. This nucleotide alteration prevented the following intron from being spliced out such that a termination codon occurred after 14 amino acids (Figs 1 ,5 f). Interestingly, a cryptic splice site was encountered after a further 36 nucleotides. Splicing occurred at this point so that the remaining part of the intron was spliced out and the exon spanning nucleotides 2197-2376 was spliced together with the truncated intron (Figs 1 ,5 f). Interestingly, RT-PCR analysis suggested that the mutant allele was reduced in transcript level compared with the wild-type allele (Fig. 5 e).

None of the mutations detailed above were detected in 200 normal chromosomes from a Caucasian background.

DISCUSSION

We have previously described the isolation of a novel gene from chromosome 5q32. Although the function of this gene is currently not known, the identification of five different mutations in the coding sequence of the gene strongly suggested that the Treacher Collins syndrome gene had been isolated (17 ). In order to confirm this observation, and provide further information about the spectrum of disease-causing mutations, additional genomic sequence has now been identified. This sequence information has enabled us to identify five further mutations in the Treacher Collins syndrome gene. All of these mutations are different from the originally identified mutations and also from one another. Unlike the mutations detailed in the initial paper, which consisted of one point mutation and four small insertions (17 ), those detailed in the current study include three deletions of either one or two nucleotides, an insertion of a single nucleotide and an unusual splicing mutation. All 10 of the mutations that have been presented to date are nonsense/frameshift mutations that would be predicted to result in the premature termination of the protein product, Treacle. However, as has been emphasised by McIntosh et al. (19 ), the result of these mutations is likely to be a severe reduction in the level of mRNA produced from the mutant allele, although the levels of transcript produced from the normal and mutant allele have not been measured in the current study. In Marfan syndrome such mutations, when associated with greater levels of transcript from the mutant allele, have been associated with milder forms of the disorder and a dominant negative mechanism of disease production has been proposed for such mutations (20 ,21 ). Whilst it is early days, such genotype/phenotype correlations do not appear to be emerging in Treacher Collins syndrome, marked inter- and intra-familial variability in the clinical features being noted (5 ). As the mutations that have been identified to date are nonsense/frameshift mutations, which are spread throughout the gene, our observations appear to provide further support for the hypothesis that the disease results from haploinsufficiency. Nevertheless, in the absence of any motif data or evidence against dimerisation or interaction with other proteins, a dominant negative mechanism cannot be excluded.

Of particular interest is the unusual splicing mutation that has been identified in this study. Whilst this mutation did not cause an amino acid change it did disrupt correct splicing as shown by RT-PCR and sequence analysis. In this particular case the 5' splice donor site immediately following the G to A transition is GC rather than the more usual GT. In vitro studies have shown that this substitution is the only one which will allow the 5' splice site to be accurately cleaved, albeit more slowly than the usual GT sequence (22 ). In the current case the wild-type splice donor site was AG/gcaagt, the sequence surrounding the GC showing a very close match to the consensus sequence. This has been noted for other splice donor sites which have GC in place of the more usual GT and provides them with greater complementarity to U1 RNA than the average consensus splice (23 ). Jacob and Gallinaro (24 ) have shown that mismatches between the splicing substrate and U1 RNA can be tolerated in splice sites either 5' or 3' of the cleavage site, but not both. This appears to have been the case in the present study where the G at the -1 position is replaced by an A; interestingly 96% of GC splice donor sites display a G at the -1 position (23 ).


Figure 5. The unusual splicing mutation detected in TCOF1 family 25, which is a sporadic case of Treacher Collins syndrome. (a) Pedigree of the family. (b) SSCP analysis indicates that a mobility shift is present in the affected child alone. (c) Genomic sequence of the normal (N) and mutant (M) alleles of the affected child indicating a G to A transition in the last base of the exon (arrowed). (d) The G to A transition deletes a StyI site allowing confirmation that the sequence change is disease-specific. (e) RT-PCR analysis indicates that whilst a product of the predicted size (213 bp) is present in both control individuals (C) and the affected child (X), the latter also displays an additional band of approximately 320 bp. A negative control reaction is indicated as -ve. (f) Sequence of the normal (N) and mutant (M) RT-PCR products, indicating that in the presence of the mutation (arrowed) normal splicing is disrupted.

To date molecular pre- and postnatal diagnostic predictions have only been possible using linked markers (3 ,25 ). Diagnosis performed in this way is not suitable for the majority of families with a history of Treacher Collins syndrome which tend to be either small, and therefore not unequivocally linked to chromosome 5, or are de novo cases. The isolation of the Treacher Collins syndrome gene makes possible simple and accurate pre- and postnatal diagnostic predictions. Nevertheless, the mutations that have been identified to date have been unique to each family. Whilst this observation is not entirely surprising given the high rate of de novo cases observed in the condition, this has not been the finding in achondroplasia where an even higher rate of new mutations is observed, but a common mutation is responsible for the majority of cases (26 ,27 ). Moreover, this pattern of mutations will complicate molecular diagnosis as it will be necessary to identify the mutation in any given family prior to undertaking diagnostic predictions for that family. Elucidation of the intron/exon organization of the entire gene, and the continued characterization of disease-causing mutations, will shed further light on how difficult this is likely to be. In addition, this process may provide information on which areas of the gene are important for its function in the development of the craniofacial complex.

MATERIALS AND METHODS

Families

The pedigrees of the families used in the current study have been presented previously (7 ,11 ,17 ), with the exception of families 25 and SP19 which are sporadic cases.

Identification of genomic sequence

The isolation of the cosmid clones and exon-trapped products used in the current study has been presented previously (17 ). In order to determine the sequence of the introns flanking the trapped exons, the cosmid clones from which they had been isolated were digested to completion with Sau3A1 or AluI and the resulting fragments cloned into M13mp18. Recombinant plaques were plated and screened with end-labelled oligonucleotides designed from the sequence of the exons. Single-stranded DNA prepared from positive plaques was sequenced via the dideoxy chain termination method (28 ) using the Sequenase version 2.0 kit (US Biochemical Corp.). These sequence data were compared with the published cDNA sequence and intron-exon boundaries identified by comparison with the published consensus sequences (18 ).

Single-stranded conformation polymorphism analysis

The coding exons and the flanking splice junctions of one affected individual from 33 TCOF1 families and 100 unaffected individuals (200 normal chromosomes) were PCR amplified according to previously described methods (10 ) using the primers detailed in Table 1 . The amplified products were extracted once with chloroform, 1.5 [mu]l were mixed with an equal volume of formamide loading buffer, heated to 95oC for 3 min and quenched on ice prior to loading on a non-denaturing glycerol-containing gel (5% acrylamide: 10% glycerol: 0.5 * TBE). The gels were run at a constant 20 W with cooling, transferred to Whatmann 3 MM filter paper and dried. Autoradiography was performed for 48 h using Fuji RX film.

Sequence analysis

Where the SSCP analysis showed a mobility shift, PCR of the coding exon and the flanking intronic sequences was performed in a 25 [mu]l reaction using 10 ng of genomic DNA and 50 pmol of each primer as described previously (14 ). The PCR products were gel purified, cloned into M13 and sequenced as above using dGTP and, where appropriate to relieve compressions, dITP. At least 12 independent templates were sequenced from the individual displaying the mobility shift.

Confirmation of mutations

BsrI, PmlI or StyI digestion of amplified PCR products was performed according to the manufacturer's instructions (New England Biolabs) and the resulting restriction fragments were separated on 3% agarose gels or 6% polyacrylamide gels. For allele-specific oligonucleotide (ASO) hybridization amplified PCR products were resolved on a 3% agarose gel and Southern blotted using standard methodology. The membranes were hybridised with end-labelled ASOs at 5oC below the predicted melt temperature of the oligonucleotide and washed as follows: Normal ASO, family 6, 5'-CGAGGAGTCAGACAGTGA-3', 2* SSC/0.1% SDS, 51oC; Mutant ASO, family 6, 5'-GGAGTCAAGACAG-3', 1* SSC/0.1% SDS, 37oC.

RT-PCR

Cytoplasmic RNA was isolated from lymphoblastoid cell lines using standard methods (29 ) and used for first strand cDNA synthesis by incubating 1 [mu]g of total RNA and 100 ng of random primer at 70oC for 10 min. The samples were chilled on ice and MMLV reverse transcriptase buffer, 10 mM DTT, 1 mM dNTPs (all BRL) and 0.5 U RNAsin (Promega) were added. The reactions were equilibrated at 37oC for 2 min, 100 U MMLV reverse transcriptase added and the samples incubated at 37oC for 1 h. The samples were then heated to 95oC for 5 min and 3 [mu]l of cDNA were used in the PCR as described previously (14 ). Briefly, 35 cycles each of 92oC for 30 s, 55oC for 30 s and 72oC for 30 s followed by a final extension phase at 72oC for 10 min were used.

ACKNOWLEDGEMENTS

We should like to thank the Treacher Collins syndrome families, without whose help the study would not have been possible, and all of those clinicians who have collected samples on our behalf. We should also like to thank Prof. A. P. Read for advice and Dr R. Shiang for comments on the manuscript. The financial support of the Wellcome Trust, grant number 044684/Z/95/Z (MJD), the Hearing Research Trust, grant number 150:MAN:MD (MJD), the European Community (MJD), and NIH grants AR42377-019 and HG00834 (JJW) is gratefully acknowledged. SKL and JD were supported, in part, by NIH training grant GM07134 and a HUGO travel award, respectively.

REFERENCES

1 Rovin,S., Dachi,S.F., Borenstein,D.B. and Cotter,W.B. (1964) Mandibulofacial dysostosis, a familial study of five generations. J. Pediatr., 65, 215-221.

2 Fazen,L.E., Elmore,J. and Nadler,H.L. (1967). Mandibulo-facial dysostosis (Treacher Collins syndrome). Am. J. Dis. Child., 113, 406-410.

3 Phelps,P.D., Poswillo,D. and Lloyd,G.A.S. (1981) The ear deformities in mandibulofacial dysostosis. Clin. Otolaryngol., 6, 15-28. MEDLINE Abstract

4 Dixon,M.J., Marres,H.A.M., Edwards,S., Dixon,J. and Cremers,C.W.R.J. (1994) Treacher Collins syndrome: Correlation between clinical and genetic linkage studies. Clin. Dysmorph., 3, 96-103. MEDLINE Abstract

5 Marres,H.A.M., Cremers,C.W.R.J., Dixon,M.J., Huygen,P.L.M. and Joosten,F.B.M. (1995) The Treacher Collins syndrome: A clinical, radiological and genetic linkage study on two pedigrees. Arch. Otol., 121, 509-514.

6 Jones,K.L., Smith,D.W., Harvey,M.A., Hall,B.D. and Quan,L. (1975) Older paternal age and fresh gene mutation: data on additional disorders. J. Pediatr., 86, 84-88. MEDLINE Abstract

7 Dixon,M.J., Read,A.P., Donnai,D., Colley,A., Dixon,J. and Williamson,R. (1991) The gene for Treacher Collins syndrome maps to the long arm of chromosome 5. Am. J. Hum. Genet., 49, 17-22. MEDLINE Abstract

8 Jabs,E.W., Li,X., Coss,C.A., Taylor,E.W., Meyers,D.A. and Weber,J.L. (1991) Mapping the Treacher Collins syndrome locus to 5q31.3-q33.3. Genomics, 11, 193-198. MEDLINE Abstract

9 Jabs,E.W., Li,X., Lovett,M., Yamaoka,L.H., Taylor,E., Speer,M.C., Coss,C., Cadle,R., Hall,B., Brown,K., Kidd,K.K., Dolganov,G., Polymeropoulos,M.H. and Meyers,D. (1993) Genetic and physical mapping of the Treacher Collins syndrome locus with respect to loci in the chromosome 5q3 region. Genomics, 18, 7-13. MEDLINE Abstract

10 Dixon,M.J., Dixon,J., Raskova,D., Le Beau,M.M., Williamson,R., Klinger,K. and Landes,G.M. (1992) Genetic and physical mapping of the Treacher Collins syndrome locus: Refinement of the localization to chromosome 5q32-33.2. Hum. Mol. Genet., 1, 249-253. MEDLINE Abstract

11 Dixon,M.J., Dixon,J., Houseal,T., Bhatt,M., Ward,D.C., Klinger,K. and Landes,G.M. (1993) Narrowing the position of the Treacher Collins syndrome locus to a small interval between three new microsatellite markers at 5q32-33.1. Am. J. Hum. Genet., 52, 907-914. MEDLINE Abstract

12 Edery,P., Manach,Y., Le Merrer,M., Till,M., Vignal,A., Lyonnet,S. and Munnich,A. (1994) Apparent genetic homogeneity of the Treacher Collins-Franceschetti syndrome. Am. J. Med. Genet., 52, 174-177. MEDLINE Abstract

13 Loftus,S.K., Edwards,S.J., Scherpbier-Heddema,T., Buetow,K.H., Wasmuth,J.J. and Dixon,M.J. (1993) A combined genetic and radiation hybrid map surrounding the Treacher Collins syndrome locus on chromosome 5q. Hum. Mol. Genet., 2, 1785-1792. MEDLINE Abstract

14 Dixon,J., Gladwin,A.J., Loftus,S.K., Riley,J., Perveen, R., Wasmuth, J.J., Anand,R. and Dixon,M.J. (1994) A yeast artificial chromosome contig encompassing the Treacher Collins syndrome critical region at 5q31.3-32. Am. J. Hum. Genet., 55, 372-378. MEDLINE Abstract

15 Dixon,J., Loftus,S.K., Gladwin,A.J., Scambler,P.J., Wasmuth,J.J. and Dixon,M.J. (1995) Cloning of the human heparan sulfate-N-deacetylase/N-sulfotransferase gene from the Treacher Collins syndrome candidate region at 5q32-33.1. Genomics, 26, 239-244. MEDLINE Abstract

16 Loftus,S.K., Dixon,J., Koprivnikar,K., Dixon,M.J. and Wasmuth,J.J. (1996) Transcriptional map of the Treacher Collins candidate gene region. Genome Res., 6, 26-34. MEDLINE Abstract

17 The Treacher Collins Syndrome Collaborative Group (1996) Positional cloning of a gene involved in the pathogenesis of Treacher Collins syndrome. Nature Genet., 12, 130-136.

18 Breathnach,R. and Chambon,P. (1981) Organization and expression of eukaryotic split genes coding for proteins. Annu. Rev. Biochem.,50, 349-383. MEDLINE Abstract

19 McIntosh,I., Hamosh,A. and Dietz,H.C. (1993) Nonsense mutations and diminished mRNA levels. Nature Genet., 4, 219. MEDLINE Abstract

20 Dietz,H.C., Valle,D., Francomano,C.A., Kendzior,R.J.Jr., Pyeritz,R.E. and Cutting,G.R. (1993) The skipping of constitutive exons in vivo induced by nonsense mutations. Science, 259, 680-683. MEDLINE Abstract

21 Dietz,H.C., McIntosh,I., Sakai,L.Y., Corson,G.M., Chalberg,S.C., Ryeritz,R.E. and Francomano,C.A. (1993) Four novel FBN1 mutations: Significance for mutant transcript level and EGF-like domain calcium binding in the pathogenesis of Marfan syndrome. Genomics, 17, 468-475. MEDLINE Abstract

22 Aebi,M., Hornig,H. and Weissmann,C. (1987) 5' cleavage site in eukaryotic pre-mRNA splicing is determined by the overall 5' splice region, not by the conserved GU. Cell, 50, 237-246. MEDLINE Abstract

23 Jackson,I.J. (1991) A reappraisal of non-consensus mRNA splice sites. Nucleic Acids Res., 19, 3795-3798. MEDLINE Abstract

24 Jacob,M. and Gallinaro,H. (1989) The 5' splice site: phylogenetic evolution and variable geometry of association with u1RNA. Nucleic Acids Res., 17, 2159-2180. MEDLINE Abstract

25 Edwards,S.J., Fowlie,A., Cust,M.P., Liu,D.T.Y., Young,I.D. and Dixon,M.J. (1996) Prenatal diagnosis in Treacher Collins syndrome using combined linkage analysis and ultrasound imaging. J. Med. Genet., 33, 603-606. MEDLINE Abstract

26 Shiang,R., Thompson,L.M., Zhu,Y.-Z., Church,D.M., Fielder,T.J., Bocian,M., Winokur,S.T. and Wasmuth,J.J. (1994) Mutations in the transmembrane domain of FGFR3 cause the most common genetic form of dwarfism, achondroplasia. Cell, 78, 335-342. MEDLINE Abstract

27 Bellus,G.A., Hefferon,T.W., Ortiz de Luna,R.I., Hecht,J.T., Horton,W.A., Machado,M., Kaitila,I., McIntosh,I. and Francomano,C.A. (1995) Achondroplasia is defined by recurrent G380R mutations of FGFR3. Am. J. Hum. Genet., 56, 368-373. MEDLINE Abstract

28 Sanger,F., Nicklen,S. and Coulson,A.R. (1977) DNA sequencing with chain terminating inhibitors. Proc. Natl Acad. Sci. USA, 74, 5463-5467. MEDLINE Abstract

29 Chomczynski,P. and Sacchi,N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156-159. MEDLINE Abstract

*To whom correspondence should be addressed

This page is maintained by OUP admin. Last updated Thu Oct 31 15:27:49 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
T. Hayano, M. Yanagida, Y. Yamauchi, T. Shinkawa, T. Isobe, and N. Takahashi
Proteomic Analysis of Human Nop56p-associated Pre-ribosomal Ribonucleoprotein Complexes: POSSIBLE LINK BETWEEN Nop56p AND THE NUCLEOLAR PROTEIN TREACLE RESPONSIBLE FOR TREACHER COLLINS SYNDROME
J. Biol. Chem., September 5, 2003; 278(36): 34309 - 34319.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
K. S. Solomon, T. Kudoh, I. B. Dawid, and A. Fritz
Zebrafish foxi1 mediates otic placode formation and jaw development
Development, March 1, 2003; 130(5): 929 - 940.
[Abstract] [Full Text] [PDF]

Home page
 J. Orthod.Home page
P. E. Ellis, M. Dawson, and M. J. Dixon
Mutation testing in Treacher Collins Syndrome
J. Orthod., December 1, 2002; 29(4): 293 - 298.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
A Splendore, E W Jabs, and M R Passos-Bueno
Screening of TCOF1 in patients from different populations: confirmation of mutational hot spots and identification of a novel missense mutation that suggests an important functional domain in the protein treacle
J. Med. Genet., July 1, 2002; 39(7): 493 - 495.
[Full Text] [PDF]

Home page
 CROBMHome page
M. Mina
Regulation of Mandibular Growth and Morphogenesis
Critical Reviews in Oral Biology & Medicine, January 1, 2001; 12(4): 276 - 300.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
J. Dixon, C. Brakebusch, R. Fassler, and M. J. Dixon
Increased levels of apoptosis in the prefusion neural folds underlie the craniofacial disorder, Treacher Collins syndrome
Hum. Mol. Genet., June 12, 2000; 9(10): 1473 - 1480.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. A. Wise, L. C. Chiang, W. A. Paznekas, M. Sharma, M. M. Musy, J. A. Ashley, M. Lovett, and E. W. Jabs
TCOF1 gene encodes a putative nucleolar phosphoprotein that exhibits mutations in Treacher Collins Syndrome throughout its coding region
PNAS, April 1, 1997; 94(7): 3110 - 3115.
[Abstract] [Full Text] [PDF]

Home page
 Genome ResHome page
J Dixon, S J Edwards, I Anderson, A Brass, P J Scambler, and M J Dixon
Identification of the complete coding sequence and genomic organization of the Treacher Collins syndrome gene.
Genome Res., March 1, 1997; 7(3): 223 - 234.
[Abstract] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (39)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Gladwin, A. J.
Right arrow Articles by Dixon, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gladwin, A. J.
Right arrow Articles by Dixon, M. J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?