Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Pagani, F.
Right arrow Articles by Baralle, F. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pagani, F.
Right arrow Articles by Baralle, F. E.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1611-1618
Expression of lysosomal acid lipase mutants detected in three patients with cholesteryl ester storage disease
Introduction
Results
   Analysis of the LAL mRNA by RT-PCR
   Identification of LAL mutants in patient 1
   Identification of LAL mutants in patient 2
   Identification of LAL mutants in patient 3
   Expression of recombinant LAL proteins tagged with HSV
   Acid lipase activities of recombinant LAL proteins
Discussion
Materials And Methods
   Subjects
   Fibroblast cell lines, nucleic acids extraction and cDNA synthesis
   PCR amplification, oligonucleotides and DNA sequence analysis
   Identification of XbaI polymorphism in genomic DNA
   Construction of HSV-tagged LAL mutants
   In vitro expression of LAL mutants and measurement of acid lipase activity
   Immunoblotting
References

Expression of lysosomal acid lipase mutants detected in three patients with cholesteryl ester storage disease

Expression of lysosomal acid lipase mutants detected in three patients with cholesteryl ester storage disease Franco Pagani1, Rodolfo Garcia1, Rajalakshmi Pariyarath1, Cristiana Stuani1, Bruno Gridelli2, Giovanni Paone2 and Francisco E. Baralle1,*

1International Centre for Genetic Engineering and Biotechnology, Padriciano 99, 34012 Trieste, Italy and 2Institute of Experimental Surgery and Transplantation, University of Milan, Via F. Sforza 35, 20122 Milan, Italy

Received May 6, 1996; Revised and Accepted July 5, 1996

Lysosomal acid lipase (LAL) gene mutations were identified in three patients with cholesteryl ester storage disease (CESD). Direct sequencing of genomic DNA revealed that: patient 1 was a compound heterozygote for a P181L mutation and an A to G 3' splice site substitution that causes skipping of exon 7, with a loss of 49 amino acids from LAL ([Delta]205-253); patient 2 was a compound heterozygote for a G66V mutation and a 5' splice site mutation (G to A) that leads to skipping of exon 8 ([Delta]254-277); and patient 3 was a compound heterozygote for a L273S mutation and an unidentified null allele. Furthermore, patients 2 and 3 showed a novel G-2A polymorphism that could be detected by an XbaI restriction fragment length polymorphism. All these mutants and a previously reported H274Y allele were expressed in vitro in HeLa cells using the vaccinia T7 expression system. The resulting recombinant proteins were inactive towards cholesteryl oleate and trioleylglycerol, demonstrating the direct involvement of these mutations in the pathogenesis of CESD. Immunoblotting of normal LAL expressed in HeLa cells revealed four major molecular forms, at least two of high molecular mass (54 and 50-51 kDa) and two of low molecular mass (42 and 43 kDa). L273S and P181L substitutions and [Delta]254-277 were shown to result in altered LAL molecular forms, some of which suggest that post-translational processing may interfere with the catalytic activity of LAL.

INTRODUCTION

Lysosomal acid lipase (LAL; acid cholesteryl ester hydrolase) is a key enzyme involved in intracellular hydrolysis of cholesteryl esters and triglycerides that have been internalized via receptor-mediated endocytosis of lipoprotein particles (1 ). In this process, the released free cholesterol regulates the endogenous synthesis of cholesterol, the uptake of low density lipoprotein and cholesterol esterification (1 ). The importance of LAL in the regulation of intracellular cholesterol flux is supported further by the fact that altered LAL function has been implicated in the development of atherosclerosis in the population at large (2 ,3 ).

Molecular cloning of the cDNA for LAL has revealed significant amino acid similarity with human gastric lipase and rat lingual lipase, indicating that these enzymes belong to a common family of acid lipases (4 ). LAL has been mapped on human chromosome 10 and the genomic locus consists of 10 exons spread over 36 kb (5 ,6 ).

The deduced amino acid sequence indicated that LAL has 378 amino acids, with an estimated Mr of 42.5 kDa, which include six putative N-glycosylation sites and a 21 amino acid N-terminal signal peptide (4 ). Human LAL has been purified from different sources and attributed different molecular sizes. In fact, two human hepatic acid lipases with Mrs of 29 and 58 kDa (7 ,8 ) or 41 and 56 kDa (9 ) respectively have been described. By contrast, two molecular forms of 41 and 49 kDa have been detected in fibroblasts (10 ) and, more recently, LAL expression in baculovirus produced two molecular forms of 46 and 41 kDa (11 ). Some of the different molecular forms seem to result from post-translational processing involving both glycosylation and selective proteolysis (9 -11 ).

Deficiency of lysosomal acid lipase occurs in two autosomal recessive storage disorders, cholesteryl ester storage disease (CESD) and Wolman disease. In Wolman disease, death usually occurs before the age of 6 months, and massive, widespread intracellular storage of both cholesteryl esters and triglycerides can be observed mainly in the liver, adrenal glands and intestine (1 ). On the contrary, patients with CESD have a more benign phenotype. Hepatomegaly may be noted during childhood, and often hypercholesterolaemia and hypertriglyceridaemia develop. In some patients, the hepatomegaly may progress to hepatic fibrosis or overt liver cirrhosis. Reduced or absent enzymatic activity of LAL in peripheral blood leucocytes, cultured skin fibroblasts or liver biopsy constitutes the diagnosis of LAL deficiency (1 ).

Several mutations have been reported in patients with LAL deficiency. A splicing defect resulting in a loss of 24 amino acids has been observed in three unrelated patients with CESD (12 -14 ). Point mutations resulting in single amino acid substitutions have also been described (6 ,15 ), and in two cases insertion or deletion of nucleotides in LAL cDNA changes the reading frame introducing a premature stop codon (6 ,13 ). None of these studies analysed the enzymatic activity of the LAL mutants expressed in mammalian cells. This is particulary important since the sorting of LAL to the lysosomes is achieved by a complex mechanism characteristic of these cells which does not take place in other systems, e.g. insect cells (16 ).

We previously have reported a family in which the homozygosity for H274Y replacement in LAL caused CESD (17 ). In the present study, the molecular basis of LAL deficiency was investigated further in three additional patients affected by CESD, leading to the identification of three different novel missense mutations and a new splicing defect. In addition, we have expressed these LAL mutants in a mammalian system in order to characterize the different molecular forms of the proteins expressed, as well as to know how the mutations affect the catalytic efficiency.

RESULTS

Analysis of the LAL mRNA by RT-PCR

Mutant alleles responsible for LAL deficiency in CESD patients were first identified through nucleotide sequencing of single clones derived from reverse transcription-polymerase chain reaction (RT-PCR) of LAL mRNA. The presence of each mutation in genomic DNA and the pattern of inheritance in each family were then analysed by direct sequencing of genomic DNA. For RT-PCR, total RNA isolated from liver tissue, cultured fibroblast cells or peripheral leucocytes obtained from the three CESD patients was reverse transcribed and amplified with F1 and RC1274 primers and compared with a normal control (Fig. 1 ). The expected band of 1274 bp, corresponding to the entire coding region of LAL, was present in all cases. However, patients 1 and 2 showed two additional smaller bands (Fig. 1 , lanes 1 and 2 respectively). The bands of either normal or small size from the three CESD patients and the normal control were eluted from the agarose gel and cloned. In each case, at least five independent clones were isolated and entirely sequenced.


Figure 1. Agarose gel electrophoresis of RT-PCR products from LAL cDNA amplifications with F1 and RC1274 primers in CESD patient 1 (lane 1), patient 2 (lane 2), patient 3 (lane 3) and a control subject (c). The size of the PCR fragments is indicated in bp. M is a 1 kb molecular weight marker.

Identification of LAL mutants in patient 1

Sequence analysis of the smaller sized cDNA from patient 1 revealed the absence of the 147 bp of exon 7 (Fig. 2 a) which results in the loss of amino acids 205-253 ([Delta]205-253). To investigate the genomic alteration leading to synthesis of this cDNA, the exon-intron junctions of exon 7 were analysed. Genomic DNA from the patient was amplified with ex7F and ex7R and sequenced. Patient 1 was found to be heterozygote for a A -> G substitution in intron 6 (Fig. 2 b). This substitution is located in position -2 of the 3' splice acceptor site, suggesting a splicing defect that leads to skipping of exon 7. In the same patient, sequencing of normal sized cDNA revealed in all clones a C -> T mutation at nucleotide position 645, which predicts a missense substitution P181L. The C -> T substitution of LAL mRNA is located in exon 6. LAL exon 6 DNA from patient 1 was amplified with ex6F and ex6R primers. Direct sequencing of the resulting PCR products revealed that the proband is heterozygote for this missense mutation (Fig. 2 c). Therefore, patient 1 is a compound heterozygote for a missense substitution (P181L) and for a 3' splice site mutation that causes skipping of exon 7.


Figure 2. Detection of mutations in LAL cDNA and genomic DNA in patient 1. (a) Nucleotide sequence of the smaller sized PCR-amplified cDNA from patient 1 showing the exon 6-8 junction missing the 147 bp corresponding to exon 7. Skipping of the exon results in the loss of amino acids 205-253 in mature LAL. The junction maintains the open reading frame. (b) Direct sequencing of intron 6-exon 7 junction. The A -> G mutation in intron 6 detected in patient 1 is indicated by an asterisk. Genomic DNA was amplified with ex7F and ex7R primers and the resulting 301 bp fragment sequenced with RC801. Intronic sequences are indicated by lower case letters. The patient is heterozygote for the mutation. (c) Direct sequencing of exon 6. The missense mutation detected at position 645 of LAL cDNA changes a C into T (P181L). Genomic DNA was amplified with ex6F and ex6R primers and the resulting 238 bp fragment sequenced with ex6F primer. The predicted amino acid sequence is presented in three letter code.

Identification of LAL mutants in patient 2

In patient 2, sequencing of the normal sized cDNA revealed a G -> T substitution at nucleotide position 300 in all clones, predicting a G66V change, whereas sequencing of the smaller sized cDNA revealed the absence of 72 bp corresponding to exon 8 which results in the loss of 24 amino acids of the protein ([Delta]254-277). In addition, the normal sized cDNA clones presented a G -> A polymorphic variant at position 107 that creates a new XbaI site in exon 2 of the LAL gene (see below).

Direct sequencing of the PCR product derived from amplification of exon 4 showed that the patient was heterozygote for G66V (Fig. 3 ). Direct sequencing of exon 8 and the corresponding intron-exon junctions revealed a previously reported G -> A mutation in the last nucleotide of exon 8 that suggests a 5' splice donor site defect, with a consequent skipping of exon 8 ([Delta]254-277) (12 ). The above analysis indicated that patient 2 is a compound heterozygote for G66V and a 5'splice site mutation.


Figure 3. Detection of LAL gene mutations in patient 2. Direct sequencing of exon 4. The G -> T mutation in position 300 of LAL cDNA converts G66V. Genomic DNA was amplified with ex4F and ex4R and the resulting 311 bp fragment sequenced with ex4F. The predicted amino acid sequence is presented in three letter code. The patient is a heterozygote for the mutation.

Identification of LAL mutants in patient 3

In the normal sized cDNA of patient 3, a single T -> C mutation at nucleotide position 921 was observed consistently in the DNA sequence of eight cloned PCR products from independent PCR reactions. This T -> C transition results in the change L273S. In addition, all the clones revealed the same G -> A polymorphism at position 107 detected in patient 2. This missense substitution changes the amino acid G-2A and creates a new XbaI site in exon 2 of the LAL gene. Subsequent experiments showed that this substitution is a common polymorphism present in the population with an allelic frequency of 0.19 (estimated from the analysis of 30 normal subjects). The segregation of L273S was investigated in family members. Direct sequencing of the PCR product of exon 8 revealed that the patient is a heterozygote for this substitution (Fig. 4 a). The same substitution was observed by direct sequencing of exon 8 in one of the mother's alleles, while the father was normal (data not shown).


Figure 4. Detection of LAL gene mutation in patient 3. (a) Direct sequencing of exon 8 in patient 3. The missense mutation detected in position 921 of LAL cDNA converts a T to C changing L273S. Genomic DNA was amplified with ex8R and ex8F primers and the resulting 203 bp fragment sequenced with ex8R. The predicted amino acid sequence is presented in three letter code. (b) Detection of the XbaI polymorphism in the LAL gene. Genomic DNA from patient 3 (lane 7) and from normal subjects (lanes 1-6) was amplified with ex2F and ex2R primers, the resulting products digested with XbaI and resolved on a 2% agarose gel. Digestion of the 242 bp exon 2 DNA at the polymorphic XbaI site produced 143 and 99 bp fragments. Patient 3 is a heterozygote. (c) Detection of the XbaI polymorphism in LAL cDNA in patient 3. cDNAs from the CESD patient 3 (lane 3), from a normal control subject with no XbaI site in the genomic DNA (lane 1) and from a normal control heterozygote for the polymorphism at the DNA level (lane 2) were amplified with F1 and RC1057 primers. The resulting fragments of 1057 bp were digested with XbaI and resolved on a 1% agarose gel. The digestion of the 1057 bp amplified cDNA produced two fragments of 864 and 194 bp originating from the digestion of LAL cDNA at the constant XbaI site in position 863 of LAL cDNA. The presence of the polymophic XbaI site in LAL cDNA produced an additional 757 bp band. M = 1 kb molecular weight marker.

Since all the cDNA clones obtained from patient 3 showed only the change L273S while the patient is a heterozygote for the substitution, we have evaluated the possibility of a null allele segregating in the family. The polymorphic XbaI restriction site in exon 2 was used to follow the pattern of expression of the two alleles in the patient. This polymorphism was analysed in both genomic DNA and in RT-PCR products amplified from patient 3 and from controls. Amplification of exon 2 from the patient's genomic DNA followed by digestion with XbaI showed that the patient is a heterozygote for the polymorphism (Fig. 4 b, lane 7). On the contrary, RT-PCR on RNA extracted from peripheral leucocytes digested with XbaI revealed that the patient's LAL mRNA codes exclusively for the XbaI allele (Fig. 4 c, lane 3). Comparison between genomic DNA amplification and RT-PCR indicates that only one allele carrying the XbaI polymorphism along with L273S is expressed and found in LAL mRNA. Therefore, patient 3 is a compound heterozygote for L273S and a null allele.

Expression of recombinant LAL proteins tagged with HSV

In order to assess the functional significance of the six mutations detected in CESD patients (five reported in this study and H274Y reported previously) (17 ), we performed transient expression in HeLa cells with the T7 vaccinia expression system. This system was chosen because the vaccinia infection has the advantage of reducing the background deriving from both endogenous LAL and other fatty acyl hydrolase activities, which is not the case when classic eukaryotic expression vectors are used (4 ). Furthermore, eukaryotic proteins made in vaccinia virus-infected cells are properly processed, glycosylated and targeted to their correct cellular location (18 -20 ).

In order to distinguish the transfected LALs from the endogenous one, the recombinant proteins were tagged with a herpes simplex virus (HSV) epitope that was added to the carboxy-terminus of LALs (see Materials and Methods). The cells were also co-transfected with a chloramphenicol acetyltransferase (CAT)-containing vector as an internal control of transfection efficiency. Cell extracts were assayed for acid lipase activity and Western blotted.

Immunoblotting using an anti-HSV antibody showed four major molecular forms of normal LAL: two of higher apparent Mr (54 and 50-51 kDa) and a double band at 42-43 kDa (Fig. 5 , pLAL). The two missense substitutions G66V and H274Y presented the same pattern as normal LAL, while in the P181L mutant, the two forms of 54 and 50-51 kDa were strongly decreased (Fig. 5 ). In L273S an even higher Mr form of 56 kDa was observed consistently in several experiments. The immunoblots of [Delta]254-277 and [Delta]205-253 demonstrated the presence of proteins smaller than normal LAL. The [Delta]254-277 mutant showed two major bands at 49 and 40-41 kDa, while the [Delta]205-253 gave bands at 49 and 38-40 kDa (Fig. 5 ). Due to the deletion of 24 and 49 amino acids, the expected reduction in size for [Delta]254-277 and [Delta]205-253 is of 2.5 and 5 kDa respectively. The molecular sizes observed for [Delta]205-253 are compatible with such a deletion of all the LAL forms. On the contrary, the high Mr form of 49 kDa detected for [Delta]254-277 was smaller than expected. In the same sample, the low molecular mass forms seemed normally deleted.


Figure 5. Immunoblots of normal and mutant LALs expressed in HeLa cells. Extracts of HeLa cells expressing normal (pLAL) or mutant LALs (40 [mu]g protein per lane) were subjected to 12% polyacrylamide gel electrophoresis and Western blotted, and the blots were probed with anti-HSV peptide. The estimated molecular masses of the different forms detected in normal LAL (pLAL) are indicated (Mr*10-3). The position of molecular weight standards is shown on the right.

Acid lipase activities of recombinant LAL proteins

The different recombinant LAL proteins were assayed for their cholesteryl esterase and triacylglycerol hydrolase activity in vaccinia-infected HeLa cells transfected with normal and mutated LALs. Transfection with normal LAL increased both activities 8-10 times above the level obtained after transfection with the control plasmid alone (Fig. 6 ). The lipase activity in the control extracts was 2.5 +- 0.8 and 8.1 +- 1.1 pmol/[mu]g protein per h for cholesteryl oleate esterase and trioleylglycerol hydrolase, respectively. The polymorphic LAL with the G-2A allele as well as LAL tagged with HSV had the same activity as normal LAL without the HSV epitope, indicating that neither the HSV epitope nor the polymorphic substitution interfered with the catalytic functions. On the contrary, all the other LAL mutants were inactive both towards cholesteryl oleate and trioleylglycerol (Fig. 6 ).

DISCUSSION

Here we describe the molecular basis of CESD in three patients. Mutations were identified by sequence analysis of LAL cDNA and genomic DNA, and their role as the direct cause of the disease was confirmed by measuring the enzymatic activity of extracts from cells transfected with these LAL mutants. The three CESD patients were found to be compound heterozygotes. Altogether we have identified three different missense mutations, two splicing defects that do not alter the open reading frame and a null allele.

The A -> G substitution at the AG 3' splice site consensus sequence of intron 6 that was detected in patient 1 results in skipping of exon 7 with a loss of 49 amino acids from LAL (Fig. 2 a and b). Four cysteine residues and a putative N-linked glycosylation site are expected to be missing from the resulting [Delta]205-253 protein. The P181L and G66V substitutions, detected in patients 1 (Fig. 2 c) and 2 (Fig. 3 ) respectively, are located within regions of LAL highly conserved in the two related lingual and gastric lipases. On the contrary, the leucine at position 273 that changes to serine in patient 3 (Fig. 4 a) is not conserved among this group of proteins.


Figure 6. Cholesteryl esterase and triacylglycerol lipase activities in vaccinia-infected HeLa cells transfected with normal and mutated LALs determined with cholesteryl oleate and trioleylglycerol oleate substrates. Values (mean +- SD) are expressed as relative activities, taking the activity of vaccinia-infected cells transfected with the control plasmid as 1. At least three transfection experiments were performed with each LAL mutant, using two different plasmid preparations in each case.

The G -> A mutation at the 5' splice junction of exon 8 of the LAL gene leads to the removal of a Ser/Thr-rich region of the protein, as well as a putative N-glycosylation site. This deletion was shown to be the underlying defect in other CESD patients. Two of them were homozygote for the mutation (13 ,14 ) while in another patient the 5' splice mutation was associated with a null allele (12 ). Regarding the null allele detected in patient 3, sequence analysis of the LAL proximal promoter region and the first exon revealed no differences with respect to a normal control (data not shown), suggesting that this allele may originate from substitutions in more distant control regions or in pre-mRNA sequences (intronic or in the 3' untranslated region) that may produce an unstable mRNA.

In order to characterize the different molecular forms of LAL associated with each mutant, as well as their catalytic activity, we have developed a strategy using mammalian cells. Since LAL is ubiquitously expressed (1 ), transfected mutant proteins must be distinguished from the endogenous background. The vaccinia system has the advantage of reducing the endogenous acid lipase activity by half while enhancing the expression of the transfected vectors, which by a convenient epitope tagging produced recombinant proteins that can be distinguished from endogenous LAL. The carboxy-terminus of LAL was extended by an 11 amino acid sequence belonging to the HSV glycoprotein D. The mutant proteins expressed in transfected cells were detected specifically on Western blots by means of a monoclonal antibody to the HSV peptide. Expression of normal LAL revealed two high Mr forms (54 and 50-51 kDa) and two low Mr forms (42 and 43 kDa) (Fig. 5 ). These sizes are in general agreement with those obtained previously for purified or expressed forms of human acid lipases (7 -11 ). In the light of our results, which show a complex pattern of LAL expression, the discrepancies between reported molecular forms of LAL could be explained by purification procedures that select single molecular forms or by the type of expression system used. The baculovirus system utilized in a recent study (11 ) has the disadvantage that, in insect cells, the targeting of lysosomal enzymes is not regulated by the mannose 6-phosphate receptor (16 ), and hence the glycosylation may be aberrant and not related to normal function. In fact, the activity of hepatocyte- and fibroblast-derived LALs was shown to be independent of glycosylation (9 ,10 ), in contrast to that described in insect cells (11 ).

Three of the CESD alleles reported here result in a different pattern of expression of LAL molecular forms. In [Delta]254-277, the lower Mr forms of 40 and 41 kDa are consistent with the loss of 24 amino acids, whereas the 49 kDa form may be lacking some post-translational modification that accounts for the difference from 54 kDa. In fact, the missing region contains Ser/Thr-rich motifs where a glycosylation may occur. In the other two alleles, a single missense substitution is sufficient to modify selectively the pattern of expression. P181L diminishes substantially the molecular mass of the 54 and 50-51 kDa forms, while L273S shifts these bands to a higher 56 kDa form (Fig. 5 ). These single amino acid substitutions may affect some post-translational event such as glycosylation or partial proteolysis. Interestingly, L273S creates a new putative N-glycosylation site (N-M-S). A new oligosaccharide chain linked to this position could explain the higher molecular mass of the mutant protein.

The absence of LAL activity of all the CESD mutants expressed in mammalian cells (Fig. 6 ) demonstrates that the mutations interfere with the catalytic activity of the enzyme. All six CESD alleles analysed lacked both trioleylglycerol lipase and cholesteryloleate esterase activity, suggesting that the substrate specificity is directed toward the fatty acid portion of lipids. Similar results have been obtained when LAL is expressed in a heterologous system (11 ). The loss of catalytic funtion may be related to conformational changes in the protein structure or to an effect on the post-translational processing of the enzyme. In fact, both glycosylation occupancy in the proper folding of the active site and limited proteolysis of LAL have been observed during lysosomal processing (9 ,11 ). Our results concerning the expression of L273S and P181L mutants discussed above suggest that post-translational processing events may indeed be affecting the catalytic function.

It has been suggested that a residual activity of LAL may exist in CESD which would account for the different phenotypic expression of this disease as compared with Wolman's (1 ). Such an activity may originate in some patients from a small quantity of normal mRNA being correctly spliced. In fact, a compound heterozygote patient with the same exon 8 splicing defect as we found in patient 2 and a null allele has been reported recently to produce a small amount of normally spliced mRNA (21 ). On the other hand, the splicing defect in exon 7 observed in patient 1 is very unlikely to give rise to a normal LAL because the mutation changes an AG 3' splice site essential for correct RNA processing (22).

Our expression studies indicate that CESD alleles produce proteins which are catalytically inactive. Similar results have been reported for other LAL mutants expressed in a heterologous system (11 ). Nevertheless, we cannot exclude a very low residual enzymatic activity (<4%, i.e. within experimental error) for some LAL mutants. On the other hand, the in vitro assay may not adequately reflect the in vivo situation. Different mutants may be subjected to tissue-specific post-translational modifications that result in differential enzymatic activities. Further studies on the role of glycosylation and N-terminal proteolysis of LAL in mammalian cells are necessary to clarify the mechanism leading to the loss of catalytic activity of the mutant proteins.

MATERIALS AND METHODS

Subjects

Patient 1 is a male from southern Italy with clinical manifestations of CESD. The patient is the second child of healthy unrelated parents. His sister and parents were asymptomatic. At the age of 5 years the patient presented hepatomegaly, elevated liver function test hypercholesterolaemia and hypertriglyceridaemia. At the age of 10 years, a liver biopsy revealed cirrhosis with vacuolization and massive storage of birefringent material in hepatocytes. LAL activity was measured in leucocytes isolated from members of the family, both parents showing a reduced level. At the age of 11, orthotopic liver transplantation was performed and the patient is well 2 years after the procedure.

Patient 2 is a male from Sicily and presented hepatosplenomegaly at the age of 6 years. Hypercholesterolaemia and hypertriglyceridaemia were noted at the age of 21 years, and a liver biopsy revealed widespread vacuolized hepatocytes. LAL deficiency was diagnosed in liver biopsy, cultured skin fibroblasts and peripheral leucocytes. Only cultured skin fibroblasts were available for subsequent analysis.

Patient 3 presented with hepatosplenomegaly at the age of 5 years. Mildly elevated liver function tests, hypercholesterolaemia and hypertriglyceridaemia were noted at 15 years of age. The diagnosis was confirmed by increased cholesteryl ester content of a liver biopsy and by a decreased LAL activity of a cultured fibroblast cell line. The parents were asymptomatic. Subsequent analysis was carried out on DNA and RNA extracted from frozen blood from the propositus and his parents.

Fibroblast cell lines, nucleic acids extraction and cDNA synthesis

Fibroblast cell lines were grown in Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and 500 [mu]g/ml gentamycin. Total RNA was extracted from frozen liver tissue obtained during liver transplantation (patient 1), from cultured skin fibroblasts (patient 2), from peripheral leucocytes (patient 3) and from normal skin fibroblasts (controls) by the acid guanidinium thiocyanate-phenol-chloroform method (23 ). Genomic DNA was extracted from the same samples with standard procedures (24 ). The synthesis of cDNA was carried out in a 50 [mu]l reaction volume containing 1-10 [mu]g of total RNA, 2.5 pM of random primers and Moloney leukaemia virus reverse transcriptase (BRL), used under the conditions suggested by the suppliers with the omission of dactinomycin.

PCR amplification, oligonucleotides and DNA sequence analysis

Amplification of first strand cDNA was performed using Taq polymerase (Boeringher Manneheim) according to Saiki et al. (25 ). Ten [mu]l of the first strand cDNA mixture were incubated in a total volume of 100 [mu]l with 50 pM of each corresponding set of oligonucleotides and 5 U of Taq polymerase for 35 cycles (45 s at 93oC, 60 s at 52oC and 90 s at 72oC). The same amplification conditions were used to amplify genomic DNA and for the construction of HSV LAL clones. The sequence of the oligonucleotides used in PCRs of genomic DNA and for RT-PCR were as follows: LAL F1, ACTGCGACTCGAGACAGCGGC; LAL F895, TGCTGGAACTTCTGTGCA; LAL RC1057, ACTGCAGTCGGCACAAGCAT; LAL RC1274, ATAAGCTTGGTGGTACACAGCTCAAGT; ex2F, GTGGGAGCATTAAGTTACC; ex2R, TGGATCGGGAAATAGATGC; ex4F, GAAGCTTGGTGCTACTGCC; ex4R, CTGGAAGCCTGTTGTCTGC; ex6F, GGAAATCCCAGATGATGG; ex6R, TCTCAGGAGGAAATCTGC; ex7F, TATGCACCAGAGTGAAATGC; ex7R, AGTTCTGATGAGGTCATTCC; ex8F, TCAATGCCACCTTAATGC; ex8R, GGAAAGGGTTTTGCATGCC; J1, ACCTCCGCCAGATCCCTGATATTTCCTCATTAGA; HSV1, GGATCTGGCGGAGGTCAGCCTGAACTCGCTCCAG; HSV2, GATCCCTGCAGAGGT- CAGG.

Plasmid DNA, purified on miniprep Spun Columns (Pharmacia Biotech, Sweden), or PCR products, purified on a MicroSpin S400 HR column (Pharmacia Biotech, Sweden), were sequenced according to the dideoxy chain terminating method (24 ) using [[alpha]-35S]dATP and modified T7 DNA polymerase (Pharmacia Biotech, Sweden).

Identification of XbaI polymorphism in genomic DNA

The G -> A substitution in position 107 that changes the amino acid Gly to Arg in position 2 creates a new XbaI site in exon 2 of the LAL gene. For the analysis of this polymorphism, genomic DNA was amplified with ex2F and ex2R primers, the resulting product was digested with XbaI and resolved on 2% agarose gel. Digestion of the 242 bp exon 2 DNA at the polymorphic XbaI site produced 143 and 99 bp fragments.

Construction of HSV-tagged LAL mutants

Normal LAL cDNA was synthesized by RT-PCR on RNA from normal fibroblasts using the primers LALF1 and LALRC1274, and the resulting fragment was digested with XhoI-HindIII and cloned in pBS SKvector. The nucleotide sequence was verified by sequencing. In order to distinguish the endogenous from transfected LAL, all the constructs were tagged with an 11 amino acid peptide (EPELAPEDPED) derived from HSV glycoprotein D. This peptide was linked to the carboxyl end of LAL by a five amino acid connecting segment (GSGGG), using the PCR-based overlap extension method (27 ). Firstly, normal LAL was amplified with LALF895 and J1, and pGDtag (a plasmid containing the sequence coding for the HSV peptide followed by a stop codon) was amplified with HSV1 and HSV2. Secondly, the two resulting fragments were joined, reamplified with LALF895 and HSV2, digested with PstI and cloned in pBS vector. The resulting plasmid contains the 3' end of LAL in-frame with the connecting segment and the HSV epitope. This insert was PstI subcloned in the normal and mutant LAL constructs, replacing the normal 3' coding region of LAL with the tagged one. A 397 bp BamHI fragment containing the polyadenylation signal of pRC/CMV was then added to the 3' end of LALs by subcloning into the NotI site. The nucleotide sequences of the cloned junctions and PCR amplified regions were verified by sequencing.

In vitro expression of LAL mutants and measurement of acid lipase activity

Recombinant vaccinia virus vTF7-3, bearing the bacteriophage T7 1 gene, was a generous gift of T. Fuerst and B. Moss (19 ). HeLa cells were grown in DMEM containing 10% FBS in 6 cm plates. Cells at 80% confluence were infected with vTF7-3 at a multiplicity of 30 plaque-forming units per cell, in serum-free medium. The virus was allowed to adsorb for 30 min at 37oC, with occasional rocking of the plate. The inoculum was then removed and replaced with 5 ml of serum-free medium. Cells were transfected with 2.8 [mu]g of each LAL plasmid DNA plus 0.2 [mu]g of a CAT-expressing plasmid (pULB), complexed with 20 [mu]g of cationic liposome DOTAP (Boeringher Manneheim). CAT activity was determined in all samples according to a standard procedure (24 ), and only efficient transfections were analysed further. Cells were harvested at 16-24 h after infection-transfection. In each experiment, controls consisting of vaccinia-infected cells transfected with pULB and of non-infected cells were included. After being harvested, cells were resuspended with 0.16 ml of 100 mM sodium acetate buffer (pH 4.8) containing the protease inhibitors leupeptin (15 [mu]g/ml), aprotinin (15 [mu]g/ml), pepstatin (5 [mu]g/ml), phenylmethylsulphonyl fluoride (0.25 mM) and EGTA (0.7 mM), at 0oC. Cell extracts were prepared by sonication for 10 s at an amplitude of 10 [mu]m (Soniprep 150, MSE), and the subsequent addition of Triton X-100 [0.2% (w/v) final concentration). The reaction mixtures, modified from Ameis et al. (9 ), contained cell extract (30-50 [mu]g of protein), 100 mM sodium acetate buffer (pH 4.8), 0.2% (w/v) Triton X-100 and either cholesteryl [14C]oleate (0.2 mM, 5 mCi/ml) or tri-[14C]oleyl-glycerol (0.3 mM, 5 mCi/ml), in a total volume of 0.1 ml. After incubation at 37oC for 30 min, the reaction product ([14C]oleate) was separated by extraction of the reaction mixtures with benzene-chloroform-methanol (10:5:12 by vol.) containing 0.3 mM oleic acid, as described by Pittman et al. (28 ). The aqueous upper phases containing the partitioned [14C]oleate were counted for [beta]-radioactivity. Cholesteryloleate esterase and trioleylglycerol hydrolase activities are expressed as relative to the activity of vaccinia-infected cells transfected with the pULB (control plasmid), taken as 1.

Immunoblotting

SDS-PAGE was performed according to the method of Laemmli (29 ). Extracts of HeLa cells (40 [mu]g protein) expressing normal or mutant LALs were resuspended in denaturing sample buffer containing 4% SDS and 3% dithiothreitol. After 5 min at 100oC, the samples were loaded on to 12% polyacrylamide gels and subjected to electrophoresis. Western blotting of the proteins to nitrocellulose membrane was performed for 2 h at 200 mA. After transfer, the membranes were stained with Ponceau Red S, washed and blocked for 1 h in Tris-buffered saline containing 5% skimmed milk. Tag antigens were detected using an HSV tag monoclonal antibody (Novagen, Madison, WI) followed by an alkaline phophatase-conjugated goat anti-mouse IgG.

REFERENCES

1 Assman, G. and Seedorf, U. (1995) Acid lipase deficiency: Wolman disease and cholesteryl ester storage disease. In Scriver, C.R., Beadet, A.L., Sly, W.S. and Valle, D. (eds), The Metabolic Basis of Inherited Disease. McGrawHill, New York, pp. 2563-2587.

2 Coates, P. M., Langer, T. and Cortner, J. A. (1986) Genetic variation of human mononuclear leukocyte lysosomal acid lipase activity. Relationship to atherosclerosis. Atherosclerosis, 62, 11-20. MEDLINE Abstract

3 Yatsu, F. M., Hagemenas, F. C., Manaugh, L. C. and Galambos, T. (1980) Cholesteryl ester hydrolase activity in human symptomatic atherosclerosis. Lipids, 15, 1019-1022. MEDLINE Abstract

4 Anderson, R. A. and Sando, G. N. (1991) Cloning and expression of cDNA encoding human lysosomal acid lipase/cholesteryl ester hydrolase. Similarities to gastric and lingual lipases. J. Biol. Chem.,266, 22479-22484. MEDLINE Abstract

5 Aslanidis, C., Klima, H., Lackner, K. J. and Schmitz, G. (1994) Genomic organization of the human lysosomal acid lipase gene (LIPA). Genomics, 20, 329-331. MEDLINE Abstract

6 Anderson, R. A., Byrum, R. S., Coates, P. M. and Sando, G. N. (1994) Mutations at the lysosomal acid cholesteryl ester hydrolase gene locus in Wolman disease. Proc. Natl Acad. Sci. USA, 91, 2718-2722. MEDLINE Abstract

7 Warner, T. G., Dambach, L. M., Shin, J. J. and O'Brien, J. S. (1981) Purification of the lysosomal acid lipase from human liver and its role in lysosomal lipid hydrolysis. J. Biol. Chem.,256, 2952-2957. MEDLINE Abstract

8 Sjoberg, E. R., Hatton, J. D. and O'Brien, J. S. (1987) Purification and characterization of a second form of acid lipase in human liver. Biochem. J., 248, 139-144. MEDLINE Abstract

9 Ameis, D., Merkel, M., Eckerskorn, C. and Greten, H. (1994) Purification, characterization and molecular cloning of human hepatic lysosomal acid lipase. Eur. J. Biochem., 219, 905-914. MEDLINE Abstract

10 Sando, G. N. and Rosenbaum, L. M. (1985) Human lysosomal acid lipase/cholesteryl ester hydrolase. J. Biol. Chem.,260, 15186-15193. MEDLINE Abstract

11 Sheriff, S., Du, H. and Grabowski, G. A. (1995) Characterization of lysosomal acid lipase by site-directed mutagenesis and hetererologous expression. J. Biol. Chem.,270, 27766-27772. MEDLINE Abstract

12 Klima, H., Ullrich, K., Aslanidis, C., Fehringer, P., Lackner, K. J. and Schmitz, G. (1993) A splice junction mutation causes deletion of a 72-base exon from the mRNA for lysosomal acid lipase in a patient with cholesteryl ester storage disease. J. Clin. Invest., 92, 2713-2718. MEDLINE Abstract

13 Ameis, D., Brockmann, G., Knoblich, R., Merkel, M., Ostlund, R. E., Jr, Yang, J. W., Coates, P. M., Cortner, J. A., Feinman, S. V. and Greten, H. (1995) A 5' splice-region mutation and a dinucleotide deletion in the lysosomal acid lipase gene in two patients with cholesteryl ester storage disease. J. Lipid. Res., 36, 241-250. MEDLINE Abstract

14 Muntoni, S., Wiebusch, H., Funke, H., Ros, E., Seedorf, U. and Assmann, G. (1995) Homozygosity for a splice junction mutation in exon 8 of the gene encoding lysosomal acid lipase in a Spanish kindred with cholesterol ester storage disease (CESD). Hum. Genet., 95, 491-494. MEDLINE Abstract

15 Seedorf, U., Wiebusch, H., Muntoni, S., Christensen, N. C., Skovby, F., Nickel, V., Roskos, M., Funke, H., Ose, L. and Assmann, G. (1995) A novel variant of lysosomal acid lipase (Leu336 -> Pro) associated with acid lipase deficiency and cholesterol ester storage disease. Arterioscler. Thromb. Vasc. Biol., 15, 773-778. MEDLINE Abstract

16 Aeed, P. A. and Elhammer, A. P. (1994) Glycosylation of recombinant prorenin in insect cells: the insect cell line Sf9 does not express the mannose 6-phosphate recognition signal. Biochemistry, 33, 8793-8797. MEDLINE Abstract

17 Pagani, F., Zagato, L., Merati, G., Paone, G., Gridelli, B. and Maier, J. A. (1994) A histidine to tyrosine replacement in lysosomal acid lipase causes cholesteryl ester storage disease. Hum. Mol. Genet., 3, 1605-1609. MEDLINE Abstract

18 Elango, N., Prince, G. A., Murphy, B. R., Venkatesan, S., Chanock, M. R. and Moss, B. (1986) Resistance to human respiratory syncytial virus (RSV) infection induced by immunization of cotton rats with a recombinant vaccinia virus expressing the RSV G glycoprotein. Proc. Natl Acad. Sci. USA, 83, 1906-1910. MEDLINE Abstract

19 Fuerst, T. R., Earl, P. L. and Moss, B. (1987) Use of a hybrid vaccinia virus-T7 RNA polymerase system for expression of target genes. Mol. Cell. Biol., 7, 2538-2544. MEDLINE Abstract

20 Aslanidis, C., Ries, S., Fehringer, P., Buchler, C., Klima, H. and Schmitz, G. (1996) Genetic and biochemical evidence that CESD and Wolman disease are distinguished by residual lysosomal acid lipase activity. Genomics, 33, 85-93. MEDLINE Abstract

21 Shapiro, M. and Periannan, S. (1987) RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res.,15, 7155-7174. MEDLINE Abstract

22 Stephens, E. B., Compans, R. W., Earl, P. and Moss, B. (1986) Surface expression of viral glycoproteins is polarized in epithelial cells infected with recombinant vaccinia viral vectors. EMBO J., 5, 237-245. MEDLINE Abstract

23 Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156-159. MEDLINE Abstract

24 Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

25 Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B. and Erlich, H. A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 239, 487-491. MEDLINE Abstract

26 Sanger, F., Nicklen, S. and Coulson, A. R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl Acad. Sci. USA, 74, 5463-5467. MEDLINE Abstract

27 Higuchi, R., Krummel, B. and Saiki, R. K. (1988) A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids. Res., 16, 7351-7367. MEDLINE Abstract

28 Pittman, R. C., Khoo, J. C. and Steinberg, D. (1975) Cholesterol esterase in rat adipose tissue and its activation by cyclic adenosine 3':5'-monophosphate-dependent protein kinase. J. Biol. Chem.,250, 4505-4511. MEDLINE Abstract

29 Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680-685. MEDLINE Abstract

*To whom correspondence should be addressed

This page is maintained by OUP admin. Last updated Thu Oct 31 15:27:49 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
S. Muntoni, H. Wiebusch, M. Jansen-Rust, S. Rust, U. Seedorf, H. Schulte, K. Berger, H. Funke, and G. Assmann
Prevalence of Cholesteryl Ester Storage Disease
Arterioscler Thromb Vasc Biol, August 1, 2007; 27(8): 1866 - 1868.
[Full Text] [PDF]

Home page
 J. Lipid Res.Home page
P. Lohse, S. Maas, P. Lohse, M. Elleder, J. M. Kirk, G. T. N. Besley, and D. Seidel
Compound heterozygosity for a Wolman mutation is frequent among patients with cholesteryl ester storage disease
J. Lipid Res., January 1, 2000; 41(1): 23 - 31.
[Abstract] [Full Text]

Home page
 CirculationHome page
Y. von Kodolitsch, R. E. Pyeritz, and P. K. Rogan
Splice-Site Mutations in Atherosclerosis Candidate Genes : Relating Individual Information to Phenotype
Circulation, August 17, 1999; 100(7): 693 - 699.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Roussel, S. Canaan, M.-P. Egloff, M. Riviere, L. Dupuis, R. Verger, and C. Cambillau
Crystal Structure of Human Gastric Lipase and Model of Lysosomal Acid Lipase, Two Lipolytic Enzymes of Medical Interest
J. Biol. Chem., June 11, 1999; 274(24): 16995 - 17002.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
P. Lohse, S. Maas, P. Lohse, A. C. Sewell, O. P. van Diggelen, and D. Seidel
Molecular defects underlying Wolman disease appear to be more heterogeneous than those resulting in cholesteryl ester storage disease
J. Lipid Res., February 1, 1999; 40(2): 221 - 228.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Pagani, F.
Right arrow Articles by Baralle, F. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pagani, F.
Right arrow Articles by Baralle, F. E.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?