Mutations that disrupt the carboxyl-terminus of [gamma]-sarcoglycan cause muscular dystrophy
Mutations that disrupt the carboxyl-terminus of [gamma]-sarcoglycan cause muscular dystrophyElizabeth M. McNally+,[Dagger], David Duggan1,+, J. Rafael Gorospe1, Carsten G. Bönnemann, Marina Fanin2, Elena Pegoraro1, Hart G. W. Lidov, Satoru Noguchi3, Eijiro Ozawa3, Richard S. Finkel4, Robert P. Cruse5, Corrado Angelini2, Louis M. Kunkel*andEric P. Hoffman1
Division of Genetics and the Howard Hughes Medical Institute, Children's Hospital, 300 Longwood Avenue, Boston, MA 02115, USA, 1Departments of Human Genetics, Molecular Genetics and Biochemistry, Pediatrics and Neurology, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261 USA, 2Clinica Neurologica 1, Universita di Padova, 35128 Padova, Italy, 3Department of Cell Biology, National Institute of Neuroscience, National Center for Neurology and Psychiatry, Kodaira, Tokyo 187, Japan, 4Muscle Clinic, Division of Child Neurology, Departments of Pediatrics and Neurology, University of Colorado Health Sciences Center, The Children's Hospital, Denver, CO 80218 USA and 5Pediatric Neurology, Peoria, IL 61603 USA
Received July 25, 1996;Revised and Accepted August 19, 1996
Recently, mutations in the genes encoding several of the dystrophin-associated proteins have been identified that produce phenotypes ranging from severe Duchenne-like autosomal recessive muscular dystrophy to the milder limb-girdle muscular dystrophies (LGMDs). LGMD type 2C is generally associated with a more severe clinical course and is prevalent in northern Africa. A previous study identified a single base pair deletion in the gene encoding the dystrophin-associated protein [gamma]-sarcoglycan in a number of Tunisian muscular dystrophy patients. To investigate whether [gamma]-sarcoglycan gene mutations cause autosomal recessive muscular dystrophy in other populations, we studied 50 muscular dystrophy patients from the United States and Italy. The muscle biopsies from these 50 patients showed no abnormality of dystrophin but did show diminished immunostaining for the dystrophin-associated protein [alpha]-sarcoglycan. Four patients with a severe muscular dystrophy phenotype were identified with homozygous, frameshifting mutations in [gamma]-sarcoglycan. Two of the four have microdeletions that disrupt the distal carboxyl-terminus of [gamma]-sarcoglycan yet result in a complete absence of [gamma]- and [beta]-sarcoglycan suggesting the importance of this region for stability of the sarcoglycan complex. This region of [gamma]-sarcoglycan, like [beta]-sarcoglycan, has a number of cysteine residues similar to those in epidermal growth factor cysteine-rich regions.
The most common form of muscular dystrophy, X-linked, recessive Duchenne muscular dystrophy (DMD), arises from mutations in the dystrophin gene (1 -3 ). Autosomally inherited forms of muscular dystrophy are a less common cause of muscular dystrophy, but a subset of autosomal recessive muscular dystrophies has recently been shown to arise from mutations in the genes encoding dystrophin-associated glycoproteins (DAGs) (4 -12 ). Sarcoglycan, a major component of the DAG complex, is composed of three subunits, [alpha], [beta] and [gamma], (formerly called 50 kDa DAG or adhalin, 43 kDa DAG or A3b, and 35 kDa DAG, respectively) (13 ). Each of the sarcoglycan subunits is a transmembrane protein with a substantial extracellular domain (5 ,10 -12 ). Mutations have been found in each of the genes encoding the known sarcoglycan subunits (5 -12 ), and the phenotype associated with these mutations ranges from the severe Duchenne-like phenotype to milder, later onset and more slowly progressive forms of muscular dystrophy. The muscular dystrophies that arise from mutations in [alpha]-, [beta]- and [gamma]-sarcoglycan are now classified as the LGMD type 2D, E and C, respectively (14 ).
A single [gamma]-sarcoglycan gene mutation is thought to account for a substantial percentage of the LGMD type 2C muscular dystrophy cases in northern Africa (12 ,15 ). This mutation, [Delta]521-T, changes the reading frame at amino acid 174 resulting in 16 missense amino acids and a stop codon (12 ). Our previous study also identified one Japanese muscular dystrophy patient with a 73 bp deletion in [gamma]-sarcoglycan suggesting that mutations in [gamma]-sarcoglycan would not be restricted to northern Africa. Immunostaining for [gamma]-sarcoglycan, as detected by a monoclonal antibody was completely absent in the muscle biopsies of patients with the [Delta]521-T mutation (12 ). Additionally, immunostaining for [alpha]- and [beta]-sarcoglycan was also secondarily diminished or absent in these patients (12 ). Using selection criteria based on findings in the previously reported northern African patients (12 ,16 ), we chose a group of muscular dystrophy patients from the United States and Italy. Muscle biopsies from these patients showed no detectable dystrophin abnormality on immunocytochemical and immunoblot analysis, but these biopsies were deficient when stained with an antibody against [alpha]-sarcoglycan. We screened cDNA prepared from the muscle biopsies using PCR and single strand conformation polymorphism (SSCP) analysis to identify mutations in the [gamma]-sarcoglycan gene. Of 50 patients tested, four were identified with mutations in [gamma]-sarcoglycan. One of the four patients carries the identical mutation found in northern Africa but on a different haplotype background. Two of the four patients have different mutations that predict a disruption of the carboxyl- terminus of [gamma]-sarcoglycan suggesting that an intact carboxyl- terminus is essential for the function of the sarcoglycan complex and the prevention of the dystrophic phenotype. Database searches using this region of [gamma]-sarcoglyan show homology to [beta]-sarcoglycan and also to the cysteine-rich regions of proteins containing EGF-like cysteine-rich repeats.
Based on our previous study of a limited number of patients (12 ), we observed that patients with [gamma]-sarcoglycan mutations have a biochemical destabilization of the entire sarcoglycan complex. In particular, [alpha]-sarcoglycan deficiency has been noted as a common feature in muscular dystrophies that arise from primary mutations in all three sarcoglycan genes (5 ,10 -12 ). Muscle biopsies from patients with muscle weakness and normal dystrophin content were identified (n = 263). From this set, we identified a subset of 50 unrelated patients with childhood or early adult-onset muscular dystrophy who had abnormal [alpha]-sarcoglycan staining characterized as either partially or completely absent (Duggan et al., in preparation). The ethnic backgrounds of the patients selected for study varied and included patients from the United States and Italy.
Total mRNA was prepared from muscle biopsies, and cDNA was synthesized with reverse transcriptase. The cDNA was amplified by PCR using overlapping primer pairs that spanned the complete [gamma]-sarcoglycan coding region. SSCP analysis followed by isolation, reamplification and sequencing of SSCP variants was used to identify mutations in [gamma]-sarcoglycan. Of 50 patients meeting our selection criteria, four were found to have mutations in the [gamma]-sarcoglycan gene (Fig. 1 ). The four patients identified had four different mutations for which each patient was apparently homozygous. One mutation, [Delta]87+T, was identified as an insertion of a thymidine residue after bp 87. This insertion alters the reading frame at amino acid 30 and is predicted to add 29 missense amino acids and a stop codon ablating the majority of the [gamma]-sarcoglycan protein. A second mutation, [Delta]793-TG, deletes two residues at bp 793-800 altering the reading frame at amino acid 265. The resultant frame change is predicted to replace the carboxyl-terminal 24 amino acids with 50 missense amino acids. The third mutation, [Delta]801-TC, is a 2 bp deletion that predicts a frame change also replacing 24 amino acids at the carboxyl-terminus of [gamma]-sarcoglycan protein with 50 missense changes and a stop codon. A fourth mutation, [Delta]521-T, deletes a single thymidine residue from the five thymidine residues 521-525. This mutation is the same as that identified in a number of Tunisian families and is predicted to be prevalent in northern Africa based on linkage disequilibrium studies with a marker that lies within the [gamma]-sarcoglycan gene (21 ,28 and E.M.M. and L.M.K., unpublished results).
Each of these patients was found to be homozygous for the mutation identified, yet only one of these families was known to be consanguineous. From the other three families, we obtained blood samples to determine the status of the mutation in the available family members. DNA was prepared from the peripheral blood leukocytes, and selected regions of their [gamma]-sarcoglycan sequences were studied by PCR and SSCP analysis. As patients 26 and 7 have mutations in the same region of the [gamma]-sarcoglycan gene, the same primer set was used to evaluate the DNA of these patients and their families (Fig. 3 A). Both parents of patient 26 were available for study, and each parent has the [Delta]801-TC in the heterozygous state (lanes 1 and 3) while patient 26 has the mutation in a homozygous state (lane 2). For patient 7, only her mother was available for study. Figure 3 A, lane 4 shows patient 7 with the homozygous [Delta]793-TG mutation while her mother, lane 5, has both the normal allele (upper band) and the mutated allele (lower band). As this patient's father was unavailable for study, we cannot exclude the possibility of a paternal null allele, although no evidence of a larger deletion was seen in patient 7's DNA with PCR of the exons of the [gamma]-sarcoglycan sequence (data not shown). The DNA from patient 44 and her family members was evaluated with a pair of primers against the specific region of [gamma]-sarcoglycan that was abnormal in this patient. The results are shown in Figure 3 B. The parents of patient 44 (lanes 1 and 4) each have the [Delta]87+T mutation in a heterozygous state, and an unaffected sibling (lane 3) inherited two normal alleles. Patient 44, lane 2, has the [Delta]87+T mutation in a homozygous state.
The muscle biopsy from patient 7 ([Delta]793-TG) was studied with an anti-spectrin antibody, as a control, and antibodies directed at each of the sarcoglycan subunits to determine whether the sarcoglycan subunits were affected by the [gamma]-sarcoglycan gene mutation (Fig. 4 ). Immunostaining for [alpha]- and [beta]-sarcoglycan was partially diminished but not completely absent. For this study we prepared a polyclonal anti-[gamma]-sarcoglycan antibody to react potentially with more epitopes of [gamma]-sarcoglycan, yet immunostaining for [gamma]-sarcoglycan was completely negative. An identical pattern of immunostaining was seen in the muscle biopsies from patients 19, 26 and 44, and dystrophin staining was preserved in all four of these patients (data not shown).
The clinical features of the patients found with [gamma]-sarcoglycan mutations are shown in Table 1 . All four patients showed proximal muscle weakness beginning in the first decade. A Gower's manoeuver and elevated serum creatine kinase were present in each of the children. Two of the four were wheelchair bound in their second decade. Three of the four were studied for cardiac involvement by echocardiography and found to be normal. Cognitive impairment was not noted in any of the children. These criteria, particularly the age of onset of muscle weakness and the age of loss of ambulation, are typical of Duchenne-like muscular dystrophy, or severe childhood autosomal recessive muscular dystrophy (SCARMD).
The dystrophin-associated protein complex can be divided into subcomplexes (13 ,17 ). The first, dystroglycan, spans the sarcolemma linking the extracellular matrix protein, laminin, to dystrophin in the cytoplasm (18 -21 ). A second subcomplex, sarcoglycan, is composed of [alpha]-, [beta]-, and [gamma]-subunits, and its function is unknown (13 ). In the present report, we demonstrate that patients in the United States and Italy can have muscular dystrophy due to mutations in the [gamma]-sarcoglycan gene and expand the number of mutations described in the [gamma]-sarcoglycan gene that produce muscular dystrophy. We selected patients for study based on the abnormal [alpha]-sarcoglycan immunostaining in their muscle biopsies as [alpha]-sarcoglycan deficiency was observed in the patients previously reported with a [gamma]-sarcoglycan gene mutation (12 ).
All of the [gamma]-sarcoglycan gene mutations identified in this study predict a disruption of the reading frame of the protein. Two of the four patients (patients 7 and 26) had two different bp deletions that disrupt a small region of [gamma]-sarcoglycan's distal carboxyl-terminus yet result in complete loss of [gamma]-sarcoglycan immunostaining in the muscle. This region of [gamma]-sarcoglycan is predicted to be extracellular and contains a number of conserved cysteine resides (12 ,22 ). An electronic database search using the entire [gamma]-sarcoglycan amino acid sequence shows homology between [gamma]-sarcoglycan and [beta]-sarcoglycan (23% identity, 51% homology). The homology between [gamma]- and [beta]-sarcoglycan is more marked in the distal carboxyl-terminus at the site of the cysteine residues that are disrupted in patients 26 and 7 (Fig. 5 A). A search of the database using only the cysteine-containing region reveals that this portion of these sarcoglycan genes has homology to EGF-like cysteine-containing repeats (Fig. 5 B), although [beta]- and [gamma]-sarcoglycan have four instead of six cysteine residues (23 ). Also, unlike other proteins that contain EGF-like cysteine-rich regions, [beta]- and [gamma]-sarcoglycan each have only one cysteine-rich repeat in their extracellular domains. The overall topology of [gamma]-sarcoglycan places the cysteine-rich region extracellularly where it may play a part in interacting with a ligand that, like other dystrophin-associated proteins, may be a component of the extracellular matrix (19 ). Whether the homology to the EGF-like cysteine-rich region implies that these proteins may have function regulating growth and/or maintenance of striated muscle remains to be elucidated. The complete absence of [gamma]-sarcoglycan and the deficiency of [alpha]- and [beta]-sarcoglycan in the muscle of patients with mutations that disrupt only this carboxyl-terminal region of [gamma]-sarcoglycan suggests that this region of the protein is important for processing and/or stability of not just [gamma]-sarcoglycan, but also [alpha]- and [beta]-sarcoglycan. The association of mutations in EGF-like repeats has been seen in other human genetic disorders including both the Marfan and Marfan-like syndrome and, more recently, in laminin [alpha]2 associated with congenital muscular dystrophy suggesting a more general and critical role of these motifs in protein function and stability (24 -26 ).
One of these patients identified in this study carries the same mutation found in Tunisian LGMD 2C patients, but does so on a different genetic background. The rare 122 bp allele of the polymorphic marker D13S232 has been found in the affected individuals in one Egyptian and nine Tunisian LGMD 2C families (15 ). In our study, patient 19, who is of Palestinian ancestry, carries the [Delta]521-T mutation but not the 122 bp allele of D13S232 suggesting that the mutation and the 122 bp allele may not always be coinherited. Therefore, 122 bp allele of D13S232 alone cannot be used as an reliable indicator of the [Delta]521-T mutation.
Overall, the identification of 4 of 50 [alpha]-sarcoglycan deficient patients with primary mutations in the [gamma]-sarcoglycan gene suggests that, in this population of [alpha]-sarcoglycan-deficient muscular dystrophy patients, primary [gamma]-sarcoglycan gene mutations are a relatively rare cause of muscular dystrophy. However, the four patients identified in this study with mutations in the [gamma]-sarcoglycan gene are partially, as opposed to completely, deficient for [alpha]-sarcoglycan immunostaining. By shifting our selection criteria to include a complete or partial deficiency of [gamma]-sarcoglycan immunostaining, we may find a greater percentage of the patients with [gamma]-sarcoglycan gene mutations. The [alpha]-sarcoglycan antibody used in this study is commercially available and is now being used by diagnostic laboratories as a general screen for `sarcoglycanopathies'. The finding of residual [alpha]-sarcoglycan staining in patients with primary [gamma]-sarcoglycan mutations suggests that a [gamma]-sarcoglycan antibody should also be used when initially evaluating patients with muscular dystrophy to increase the sensitivity and accuracy of molecular diagnosis of muscular dystrophy.
Total mRNA was prepared from 50 to 100 mg of muscle tissue by homogenization in 5 M guanidinium isothiocyanate and cDNA was reverse transcribed as described (7 ,12 ). PCR and SSCP analysis was performed using the four identical primer pairs as reported (12 ) with the exception that the P5 primer was replaced with the following primer (5'AAATGGTAGAAGTCCAGAATCAACA3'). Additionally, a fifth primer pair consisting of P5 (see above) and P14 (5'GGGATTCTAATCTAAGGTCTTGA3') was also used under identical conditions. After denaturation for 5 min at 95oC, 4 [mu]l of each reaction was separated by electrophoresis under nondenaturing conditions using 0.5* MDE (FMC Bioproducts, Rockland, ME) and 0.6* TBE (0.9 M Tris-borate, 2 mM EDTA, pH 8.0) at 600 V at room temperature for 8-16 h. Alternative conditions for electrophoresis included 0.5* TBE, 5% acrylamide (49:1 acrylamide:bisacrylamide), 5% glycerol run at 20 W for 5-6 h at room temperature or at 0.5* TBE, 5% acrylamide (49:1 acrylamide:bisacrylamide) at 30 W for 2-3 h at 4oC. Gels were dried for one hour and autoradiographed for 12-72 h at -80oC. SSCP variants were excised, amplified and sequenced as described (7 ,12 ). Sequencing was performed an ABI 373 sequencer. The sequence was analyzed using Sequencher (Gene Codes, Ann Arbor, MI) and the GCG software analysis programs.
To confirm the presence of mutations in the DNA of the patients and their parents, DNA was isolated from peripheral blood leukocytes or muscle biopsies (29 ). For patients 26 and 7, the primers E8-5 (5'CCTTAACTCTTCGTCTCCCATCTT3') and P10 (see above) were used to confirm the mutations. For patient 19, the primers E6-5b (5'TGGTGTCACTTATTTTACTTCTGC3') and E6-3b (5'CTAACATTATTCCAGCACATACCC3') were used to confirm the mutation. For patient 44, the primers E2-5 (5'CTCTCTCCTCTCGTGAACACACTC3') and E2-3 (5'CATGCTTACCAGAAAATAATGATAC3') were used to confirm the mutations in patient 44. The conditions for PCR were identical to those described above.
The entire coding region of [gamma]-sarcoglycan was used in a BLAST search of the following databases: genpept (translation of GenBank, update February, 1996), SWISS-PROT (release December 1995), spupdate (Swiss-prot weekly update), Kabat Sequences of Proteins of Immunological Interest, (June 1995), TFD transcription factor database release, (August, 1995), and alu. The amino acid sequence YEICVCPDGKLYLS was used in a search of the same databases using BEAUTY (BLAST Enhanced Alignment Utility) at http://dot.imgen.bcm.tmc.edu:9331/seq-search/protein-search.html using the search mode BEAUTY/CRSeqAnnot.
An anti-[gamma]-sarcoglycan polyclonal antibody was raised in rabbits immunized with the entire [gamma]-sarcoglycan coding region fused to glutathione-S-transferase. The [gamma]-sarcoglycan coding region was amplified with the following two primers 35X1 (5'AGCTCGAGCGTGAGCAGTACACTACA3') and 35N1 (5'TGCGGCCGCGAGGCAGATGTGGCTGTGCTC). The resulting PCR product was digested with XhoI and NotI and subcloned into pGEX-4T-1 (Pharmacia, Upsala, Sweden). The fusion protein was expressed in Escherichia coli, purified and injected into rabbits. Affinity-purified anti-[gamma]-sarcoglycan was prepared using immobilized fusion protein coupled to cyanogen bromide-activated Sepharose 4B (Pharmacia). The affinity-purified antibody was characterized by immunoblotting and immunocytochemical analysis of normal skeletal muscle and produced results consistent with the known properties of [gamma]-sarcoglycan (data not shown). Muscle biopsies were sectioned into 4-6 [mu]m sections at -20oC, briefly fixed in anhydrous acetone, and then stained with antibodies directed at spectrin, as a control, and the sarcoglycan subunits. A monoclonal anti-[beta]-spectrin antibody (NCL-SPEC1) and a monoclonal anti-[alpha]-sarcoglycan (NCL-50DAG) antibody were obtained from Novocastra. The anti-[beta]-sarcoglycan was previously reported (10 ). Staining was performed essentially as described (10 ,12 ). Goat antirabbit, goat antimouse or goat anti-guinea-pig conjugated to Cy3 (Jackson ImmunoResearch Laboratories, West Grove, PA ) were used to visualize the results using a Zeiss microscope.
We thank Richard Bennett and Gigi Bang for expert technical assistance with sequencing. E.M.M. is supported by NIH HL03448. The financial support of Telethon-Italy (#695 to M.F. and #552 to C.A.) is gratefully acknowledged. L.M.K is an investigator of the Howard Hughes Medical Institute and is supported by NIH NS23740. E.P.H. is supported by NIH NS28430 and is an Established Investigator of the American Heart Association.
1 Monaco, A.P., Neve, R.L., Colletti-Feener, C., Bertelson, C.J., Kurnit, D.M. and Kunkel, L.M. (1986) Isolation of candidate cDNAs for portions of the Duchenne muscular dystrophy gene. Nature, 323, 646-650.MEDLINE Abstract
2 Burghes, A.H., Logan, C., Hu, X., Belfall, B., Worton, R.G. and Ray, P.N. (1987) A cDNA clone from the Duchenne/Becker muscular dystrophy gene. Nature, 328, 434-6.MEDLINE Abstract
3 Koenig, M., Hoffman, E.P., Bertelson, C.J., Monaco, A.P., Feener, C. and Kunkel, L.M. (1987) Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell, 50, 509-517.MEDLINE Abstract
4 Online Mendelian Inheritance in Man, OMIM (TM). Center for Medical Genetics, Johns Hopkins University (Baltimore, MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, MD), 1996. Numbers: 159000, 253600, 253700, 310200 World Wide Web URL: http://www3.ncbi.nlm.nih.gov/omim/.
5 Roberds, S.L., Leturcq, F., Allamand, V., Piccolo, F., Jeanpierre, M., Anderson, R.D., Lim, L.E., Lee, J.C., Tomé, F.M., Romero, N.B., Fardeau, M., Beckmann, J.S., Kaplan, J.-C, and Campbell, K.P. (1994) Missense mutations in the adhalin gene linked to autosomal recessive muscular dystrophy. Cell, 78, 625-633.MEDLINE Abstract
6 Piccolo, F., Roberds, S.L., Jeanpierre, M., Leturcq, F., Azibi, K., Beldjord, C., Carrié, A., Récan, D., Chaouch, M., Reghis, A., El Kerch, F., Sefiani, A., Voit, T., Merlini, L., Collin, H., Eymard, B., Beckmann, J.S., Romero, N.B., Tomé, F.M.S., Fardeau, M., Campbell, K.P. and Kaplan, J-C. (1995) Primary adhalinopathy: a common cause of autosomal recessive muscular dystrophy of variable severity. Nature Genet., 10, 243-245.MEDLINE Abstract
7 Ljunggren, A., Duggan, D., McNally, E., Boylan, K.B., Gama, C.H., Kunkel, L. M.and Hoffman, E.P. (1995) Primary adhalin deficiency as a cause of muscular dystrophy in patients with normal dystrophin. Ann. Neurol., 38, 367-372.MEDLINE Abstract
8 Kawai, H., Akaike, M., Endo, T., Adachi, K., Inui, T., Mitsui, T., Kashiwagi, S., Fujiwara, T., Okuno, S., Shin., S., Miyoshi, K., Campbell, K.P., Yamada, H., Shimizu, T., Matsumua, K. and Saito, S. (1995) Adhalin gene mutations in patients with autosomal recessive childhood onset muscular dystrophy with adhalin deficiency. J. Clin. Invest., 96, 1202-1207.MEDLINE Abstract
9 Passos-Bueno, M.R., Moreira, E.S., Vainzof, M., Chamberlain, J., Maria, S.K., Pereira, L., Aklyama, J., Roberds, S.L., Campbell, K.P. and Zatz, M. (1995) A common missense mutation in the adhalin gene in three unrelated Brazilian families with a relatively mild form of autosomal reessive limb-girdle muscular dystrophy. Hum. Mol. Genet., 4, 1163-1167.
10 Bönnemann, C.G, Modi, R., Noguchi, S., Mizuno, Y., Yoshida, M., Gussoni, E., McNally, E.M., Duggan, D.J., Angelini, C., Hoffmann, E.P., Ozawa, E. and Kunkel, L.M. (1995) [beta]-sarcoglycan mutations cause autosomal recessive muscular dystrophy with loss of the sarcoglycan complex. Nature Genet., 11, 266-273.MEDLINE Abstract
11 Lim, L.E., Duclos, F., Broux, O., Bourg, N., Sunada, Y., Allamand, V., Meyer, J., Richard, I., Moomaw, C., Slaughter, C., Tomé, F.M.S., Fardeau, M., Jackson, C.E., Beckmann, J.S. and Campbell, K.P (1995) [beta]-sarcoglycan: Characterization and role in limb-girdle muscular dystrophy linked to 4q12. Nature Genet., 11, 257-265.MEDLINE Abstract
12 Noguchi, S., McNally, E. M., Ben Othmane, K., Hagiwara, Y., Mizuno, Y., Yoshida, M., Yamamoto, H., Bönnemann, C.G., Gussoni, E., Denton, P.H., Kyriakides, T., Middleton, L., Hentati, F., Ben Hamida, V, Nonaka, I., Vance, J.M., Kunkel, L.M. and Ozawa, E. (1995) Mutations in the dystrophin-associated protein [gamma]-sarcoglycan in chromosome 13 muscular dystrophy. Science, 270, 819-822.MEDLINE Abstract
13 Yoshida, M., Suzuki, A., Yamamoto, H., Noguchi, S., Mizuno, Y. and Ozawa, E. (1994) Dissociation of the complex of dystrophin and its associated proteins into several unique groups by n-octyl, [beta]-D-glucoside. Eur. J. Biochem.,222, 1055-1061.MEDLINE Abstract
14 Bushby, K.M. and Beckmann, J.S. (1995) The limb girdle muscular dystrophies-proposal for a new nomenclature. Neuromusc. Disord., 4, 337-343.
15 Ben Othmane, K., Speer, M.C., Stauffer, J., Blel, S., Middleton, L., Ben Hamida, C., Etribi, A., Loeb, D., Hentati, F., Roses, A.D., Ben Hamida, M., Pericak-Vance, M.A. and Vance, J.M. (1995) Evidence for linkage disequilibrium in chromosome 13-linked Duchenne-like muscular dystrophy. Am. J. Hum. Genet.,57, 732-733.MEDLINE Abstract
16 Ben Hamida, M., Fardeau, M. and Attia, N. (1983) Severe childhood muscular dystrophy affecting both sexes and frequent in Tunisia. Muscle Nerve, 6, 469-480.MEDLINE Abstract
17 Ozawa, E., Yoshida, M., Suzuki, A., Mizuno, Y., Hagiwara, Y. and Noguchi, S. (1995) Dystrophin-associated proteins in muscular dystrophy. Hum. Mol. Genet.,4, 1711-1716.MEDLINE Abstract
18 Suzuki, A., Yoshida, M., Yamamoto, H. and Ozawa, E. (1992) Glycoprotein-binding site of dystrophin is confined to the cysteine-rich domain and the first half of the carboxyl-terminal domain. FEBS Lett.,308, 154-160.MEDLINE Abstract
19 Ibraghimov-Beskrovnaya, O., Ervasti, J.M., Levielle, C.J., Slaughter, C.A., Sernett, S.W. and Campbell K.P. (1992) Primary structure of dystrophin-associated glycoproteins linking dystrophin to the extracellular matrix. Nature, 355, 696-702.MEDLINE Abstract
20 Suzuki, A., Yoshida, M., Hayashi, K., Mizuno, Y., Hagiwara, Y. and Ozawa, E. (1994) Molecular organization at the glycoprotein complex-binding site of dystrophin-three dystrophin-associated proteins bind directly to the carboxyl-terminal portion of dystrophin. Eur. J. Biochem.,220, 283-292.MEDLINE Abstract
21 Jung, D., Yang, B., Meyer, J., Chamberlain, J.S. and Campbell, K.P. (1995) Identification and characterization of the dystrophin anchoring site on beta-dystroglycan. J. Biol. Chem.,270, 27305-27310.MEDLINE Abstract
22 McNally, E.M., Bönnemann, C.G., Bhattacharya, S. and Kunkel L. M. (1996) Dystrophin associated protein in cardiomyopathy and muscular dystrophy. N. Engl. J. Med. 334, 1610-1611.MEDLINE Abstract
23 Engel, J. (1989) EGF-like domains in extracellular matrix proteins: localized signals for growth and differentiation. FEBS Lett.,251, 1-7.MEDLINE Abstract
24 Dietz, H.C., Saraiva, J.M., Pyeritz, R.E., Cutting, G.R. and Francomano, C.A. (1992) Clustering of fibrillin mutations in Marfan syndrome patients at cysteine residues in EGF-like domains. Hum. Mutat.,1, 366-374.MEDLINE Abstract
25 Putnam, E.A., Zhang, H., Ramirez, F. and Milewicz, D. M. (1995) Fibrillin2 (FBN2) mutations result in t he Marfan-like disorder, congenital contractural arachnodactyly. Nature Genet.,11, 456-458.MEDLINE Abstract
26 Nissinene, M., Helbling-Leclerc, A., Zhang, X., Evangelista, T., Topaloglu, H., Cruaud, C., Weissenbach, J., Fardeau, M., Tomé, F.M.S., Schwarz, K., Tryggvason, K., Guicheney, P. (1996) Substitution of conserved cysteine-996 in a cysteine-rich motif of the laminin a2-chain in congenital muscular dystrophy with partial deficiency of the protein. Am. J. Hum. Genet., 58, 1177-1184.
27 Hoffman, E.P., Arahata, K., Minetti, C., Bonilla, E., and Rowland, L.P. (1992) Dystrophinopathy in isolated cases of myopathy in females. Neurology, 42, 967-975.MEDLINE Abstract
28 Pegoraro, E., Schimke, R.N., Garcia, C., Stern, H., Cadaldini, M., Angelini, C., Barbosa, E., Carroll, J., Marks, W.A., Neville, H.E., Marks, H., Appleton, S., Toriello, H., Wessel, H.B., Donnelly, J., Bernes, S. M., Taber, J.W., Weiss, L. and Hoffman, E.P. (1995) Genetic and biochemical normalization in female carriers of Duchenne muscular dystrophy: evidence for failure of dystrophin production in dystrophin-competent myonuclei. Neurology, 45, 677-690.MEDLINE Abstract
29 Miller, S.A., Dykes, D.D. and Polesky, H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res.,16, 1215.
A fourth component of the sarcoglycan complex was recently described [Nigro et al., (1996) Hum. Mol. Genet., 5, 1179-1186] and is mutated in LGMD 2F (Nigro et al., Nature Genet., in press).
*To whom correspondence should be addressed
+These authors contributed equally
}Present address: University of Chicago, Section of Cardiology, 5841 S. Maryland, MC 6088, Chicago, Illinois 60637 USA
This page is maintained by OUP admin. Last updated Thu Oct 31 15:28:51 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
