Cloning, mapping and RNA analysis of the human methionine synthase gene
Cloning, mapping and RNA analysis of the human methionine synthase geneYunan N. Li1, Sumedha Gulati2, Priscilla J. Baker3, Lawrence C. Brody3,*, Ruma Banerjee2,* and Warren D. Kruger1,*
1Division of Population Science, Fox Chase Cancer Center, 7701 Burholme Avenue, Philadelphia PA, 19046, USA, 2Biochemistry Department, University of Nebraska, Lincoln, Nebraska 68588-0664, USA and 3Laboratory of Gene Transfer, National Center for Human Genome Research NIH, Bethesda, MD 20892-4470, USA
Received September 27, 1996;Revised and Accepted October 11, 1996
Elevated levels of plasma homocysteine is a risk factor in both birth defects and vascular disease. Methionine synthase (MS) is a cobalamin dependent enzyme which catalyzes methylation of homocysteine to methionine. Impaired MS activity is expected to lead to increased levels of plasma homocysteine. In addition, defects in this gene may underlie the methionine-dependence observed in a number of human tumor cell lines. We describe here the isolation and characterization of the human MS cDNA. It contains an open reading frame of 3798 nucleotides encoding a protein of 1265 amino acids with a predicted molecular mass of 140 kDa. The amino acid sequence of the human MS is 55% identical with that of the Escherichia coli enzyme (METH) and 64% identical with the predicted Caenorhabditis elegans enzyme. Seven peptide sequences derived from purified porcine MS have substantial similarity to the human protein. Northern analysis indicates that the MS RNA is present in a wide variety of tissues. We have mapped the human gene to chromosomal location 1q43, a region found monosomic in individuals with deletion 1q syndrome. The isolation of the MS cDNA will now allow the direct determination of whether mutations in this gene contribute to folate-related neural tube defects, cardiovascular diseases, and birth defects.
Homocysteine is a thiol-containing amino acid derived from the metabolism of methionine. Homocyst(e)ine is the sum total of both the reduced and oxidized forms of homocysteine. Moderately elevated levels of plasma homocyst(e)ine (hyperhomocyst(e)inemia) is a risk factor in human vascular disease. Since 1976, over 20 studies using more than 4600 patients have demonstrated a relationship between hyper-homocyst(e)inemia and vascular disease in coronary, cerebral and peripheral arteries (1 -6 ). A recent meta-analysis estimates that 10% of all coronary artery disease (CAD) is attributable to high homocyst(e)ine levels (7 ). The pathophysiology of homocyst(e)ine and vascular disease is not fully understood, but studies have demonstrated that homocysteine can be toxic to vascular endothelial cells (8 ,9 ).
Hyperhomocyst(e)inemia has more recently been demonstrated to be a risk factor for women giving birth to children with neural tube defects (NTDs). Studies have shown that women with high plasma homocyst(e)ine levels have a significantly increased risk of having a child with NTDs (10 ,11 ). Mills et al. have postulated that the increased plasma homocyst(e)ine levels observed in NTD mothers may be attributable to a defect in the conversion of homocysteine to methionine.
The biochemical reactions responsible for the processing of homocysteine are well understood (see Fig. 1 ). Homocysteine can either be condensed with serine to form cystathionine by the enzyme cystathionine [beta]-synthase (CBS), or it can be methylated to form methionine. In mammals there are two enzymes which can carry out methionine synthetic reaction, betaine-dependent homocysteine methyltransferase, and B12-dependent N-5-methyltetrahydrofolate homocysteine methyltransferase (EC2.1.13; methionine synthase; MS) (12 ). The MS-catalyzed conversion of homocysteine to methionine requires 5-methyltetrahydrofolate as a methyl donor and uses cobalamin (B12) as a co-factor. This pathway suggests that homocysteine levels could be elevated either by defects in the reactions catalyzed by CBS or defects in either of the two methionine synthetic reactions.
To isolate the cDNA encoding for human MS we took advantage of the evolutionary conservation in the MS gene sequence. We compared the MS coding sequences from E.coli MS (metH) and the putative C.elegans MS, and identified blocks of high DNA homology. We reasoned that these regions of high homology between E.coli and C.elegans would also have a high degree of similarity between C.elegans and H.sapiens. We designed primers to four regions and used them to PCR amplify 1st-strand cDNA derived from human lymphoid cells. One of the four primer pairs amplified a 350 basepair (bp) fragment of the expected size (data not shown). We sequenced the amplified DNA and found the fragment contained an open reading frame that had 52% identity with E.coli MS and 64% identity with the predicted C.elegans protein.
We used this 350 bp PCR product as a probe to screen a human hepatoma cDNA library for a longer MS cDNA. One clone, pMS-c1, was identified and found to contain a 2.6 kb insert. Sequencing of the clone indicated that it stretched from the middle of the predicted MS-ORF to a few hundred basepairs upstream of the predicted start codon.
Simultaneously, we found an EST sequence (ESTG4989) in the The Institute for Genomic Research (TIGR) database which contained significant similarity to the C-terminal end of E.coli and C.elegans MS proteins. We obtained a 3 kb clone from which this EST was derived (see Fig. 2 ) and sequenced it from each end. One end contained an ORF with significant sequence similarity to the C-terminal part of the E.coli and C.elegans MS, while the other end of the clone did not have a significant ORF and probably encodes the 3' untranslated region of the transcript. Interestingly, the sequence from the 3' untranslated region when compared to the EST database showed that there were 11 ESTs in the database that partially overlapped with our sequence (data not shown).
We used clone pMS-c1 as a probe to map the human MS gene using fluorescent in situ hybridization (Fig. 4 ). Hybridization was detected on chromosome 1 in 24 of 24 metaphase spreads examined. All fluorescent signals on chromosome 1 were located between 1q42.3-1q44, with the majority being at 1q43 or the boundary of 1q42.3 and 1q43. The mapping to chromosome 1 was also confirmed by PCR amplification of DNA isolated from chromosome specific hamster-human hybrid cell lines using an STS derived from the 3'UTR of the gene (data not shown).
The pMS-c1 probe was also used as a probe on multiple tissue Northern blots (Fig. 5 A). The 2.2 kb probe containing the 5' end of the MS coding region hybridized to two predominant RNA species, a 7.5 kb and a 10 kb transcript in human tissues. The ratio of 7.5 kb to 10 kb message appears to be constant in all tissues tested. MS RNA appears to be expressed to some degree in all tissues tested and appears to be especially abundant in the pancreas. Reduced amounts of lung, liver and kidney RNA were observed for both MS and the glyceraldehydephosphate dehydrogenase (GAPDH) control probe (Fig. 5 A and B). The human probe hybridizes to a single 5 kb message in mouse tissues (Fig. 5 C).
In this paper we describe the cloning, sequencing, mapping, and expression of the cDNA encoding the human MS protein. The strongest evidence that we have actually isolated the human MS encoding cDNA is the high degree of sequence identity between the predicted human MS protein and amino acid sequence derived from purified porcine MS. The predicted human MS protein contains sequences highly similar to all seven of the porcine peptides isolated from purified porcine protein. These peptides range from 8-24 amino acids in length and are 80-100% identical to the predicted human MS peptides. The porcine N-terminal derived peptide is identical to amino acids 3-8 in our predicted protein. In addition, the predicted human MS protein is 55% and 64% identical with the predicted E.coli and C.elegans MS proteins, respectively. Such a high degree of identity is unusual in basic metabolic enzymes. For example the human and bacterial MTHFR proteins (which catalyze the reaction preceding MS) are identical at only 35% of the residues (24 ). The large degree of identity over the entire length of protein provides additional support that the isolated cDNA encodes MS.
In addition to the sequence, mapping data also indicate we have cloned the MS gene. Mellman et al. (25 ) mapped the gene for MS to chromosome 1 by measuring cobalamin binding in human-hamster hybrid cell lines. Our FISH data and somatic cell hybrid panel also map the human MS gene to chromosome 1; thus our two results are consistent.
We report cloning of a mammalian MS encoding cDNA. The predicted protein contains 1265 amino acids and has a predicted molecular weight of 140466 daltons. This agrees reasonably well with the 151 kDa molecular weight estimated for the purified porcine MS (26 ). As mentioned above, the mammalian protein has striking similarity with E.coli and C.elegans. This similarity extends over the 1238 of the 1265 amino acids of the predicted human protein. The human protein has a 27 amino acid extension at the N-terminus divergent from the predicted bacterial and nematode proteins. The high degree of structural similarity is consistent with the known enzymology of the two proteins. Both mammalian and bacterial MS depend on AdoMet for reductive activation, have similar steady state kinetics, and bind these cofactors tightly (23 ). One difference that has been reported is that the mammalian enzyme has a thioloxidase activity associated with it that is not present in the bacterial enzyme (27 ). However, this thioloxidase activity appears to decrease with increasing enzyme purification (Chen and Banerjee, unpublished), suggesting that a contaminating protein is likely to be responsible. Given the high degree of sequence conservation, it would be difficult to imagine a novel activity resident within the mammalian enzyme.
Human MS mRNA appears to be expressed in all tissues tested: heart, brain, placenta, lung, liver, skeletal, muscle, kidney, pancreas, spleen, thymus prostate, testes, ovaries, small intestine, colon, and peripheral blood lymphocytes. In most of the tissues, two predominant mRNA species are present, a prominent band at ~7 kb, and a weaker band at ~10 kb. Our composite cDNA structure is most consistent with the 7 kb band observed on the Northern blots. Whether the 10 kb band is a preprocessed form of the 7 kb species, or represents an alternatively spliced or altered polyadenylated version of the gene is unknown. Since Western analysis detects a single protein band (26 ), alternative splicing would most likely involve the 5' or 3' untranslated region of the mRNA.
We have mapped the gene for MS to 1q43 near the telomere of chromosome 1. These mapping data are consistent with a role for MS mutations in tumor formation. Defects in MS may be responsible for the large percentage of tumor cell lines which require methionine for growth in culture (17 ). These cells cannot grow on media supplemented with homocysteine suggesting that a block in transmethylation of homocysteine to methionine may be present. A possible hypothesis to explain these findings is that these cells lack MS activity because of mutations or deletions of the MS gene. A common mechanism of allelic inactivation in tumor cells is deletion of one allele (usually along with a large portion of the flanking DNA) and point mutations in the remaining allele. Gross deletion of an entire chromosome arm is often observed. The 1q region of the genome is frequently deleted in a large percentage of breast tumors and melanoma tumors (28 -30 ). These observations would be consistent with the hypothesis that the inability of tumor cell lines to grow on media lacking methionine may be related to loss of MS activity. Obviously, direct mutation analysis of the MS gene in methionine-dependent tumors will have to be performed to determine whether MS mutations are in fact involved in tumorigenesis.
The mapping data suggest that MS may also be involved in birth defects. The area in which MS maps is deleted in patients with 1q deletion syndrome (31 ). This rare syndrome is caused by loss of the portion of chromosome 1q distal to 1q42-43. Individuals born with this chromosome abnormality have both morphological abnormalities and severe neurologic problems (32 ). Interestingly, some of these abnormalities are similar to those observed in patients with cblE and cblG mutations. Specifically, patients with both syndromes tend to exhibit hypotonia, microcephaly, seizures and abnormal EEGs (15 ,32 ). It is possible these symptoms result from insufficient MS activity during neural development. Also, three out of fifteen children born with 1q deletion syndrome (31 ) exhibited neural tube defects. This may be related to the increased incidence of NTD babies born to women with apparent defects in MS activity.
In summary, we have cloned and sequenced the cDNA encoding the human MS protein. We have mapped the gene to chromosome 1q43 and demonstrated that the RNA is ubiquitiously expressed. These results set the stage for the identification and analysis of mutations in MS which are suspected of being important in a number of human diseases.
A BLAST search using E.coliMetH gene sequence (accession: J04975), as a query identified a cDNA sequence from Caenorhabditis elegans with a score of 911 (accession: Z46828). Based on the sequence alignment, PCR primers were designed from the C.elegans gene sequence within several conserved regions. One primer set p2F/p3R (Table 1 ) was used in PCR amplifications from three first-strand cDNA synthesized from human lymphoid cell lines. Fifty [mu]l PCR reactions were performed in 1* PCR buffer [50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2] containing 20 pmol of each primer, 2.5 U Taq DNA polymerase (GIBCO BRL, Life Technologies), and 200 [mu]M each dNTP. A total of 30 amplification cycles were performed with the following parameters. The first 13 cycles 94oC for 35 s, 55oC for 55 s, and 72oC for 45 s. The next 13 cycles and the last four cycles differed from the above only by the extension time at 72oC, which were 2 and 3 min, respectively. The 30 cycles were followed by a final extension of 10 min at 72oC. A 350 bp PCR fragment was amplified by p2F/p3R from these three cDNA pools and directly sequenced.
Oligonucleotide primers used for PCR and sequencing of the human MS gene
The orientation of the primer sequence to the gene is indicated in parentheses (F, forward; R, reverse).
To isolate a large cDNA fragment we used the PCR product as a probe to screen a human cDNA library derived from HepG2 cells constructed in vector pAB23-BXN (35 ). Three possible MS candidate cDNAs were identified by screening of 80 000-100 000 bacterial colonies by non radioactive DIG-labeling colony hybridization (Boehringer Mannheim, Germany). Conditions for hybridization followed the manufacturer's instructions. Because the density of colonies was quite high, we pooled colonies from the region of the plate containing the positive clones. We used PCR to confirm the presence of the MS clone in the pool. Since primers p2F/p3R can also amplify the bacterial homologue, a set of internal primers p5F and p6R (see Table 1 ) was designed to obtain the human gene specific amplification from bacterial cell pools. All three cell pools showed the expected 180 bp PCR product.
Approximately 600 bacterial colonies derived from the three cell pools were patched out on agar plates and screened by colony hybridization using the 350 bp probe. One clone showed a strong hybridization signal. The final clone was designated as pMS-c1 and found to contain 2.6 kb insert.
A 3.0 kb clone designated as pMS-c3 was obtained from TIGR and was found to contain a short C-terminal region of the MS ORF and long 3' untranslated region (3'UTR). To obtain the 3' half of the ORF sequence of the gene, primers 3NGSP1 and RB-oligo, which were developed from pMS-c1 and pMS-c3, respectively, were used in PCR amplification from human liver Marathon-Ready cDNA (Clonetech Laboratories, Inc., CA). The PCR amplifications used AdvantageTM KlenTaq Polymerase Mix (Clonetech Laboratories, Inc., CA) and were carried according to the manufacturer's recommendation: first 94oC for 1 min then 30 cycles of 94oC for 30 s and 68oC for 4 min. A 1.6 kb fragment was amplified, cloned into pCR2.1 vector (Invitrogen Cooperation, CA), and sequenced. The cloned 1.6 kb PCR DNA was designated as pMS-c2.
The three clones, pMS-c1, -c2 and -c3, comprise of the entire MS ORF and 5' and 3' untranslated regions. Since pMS-c2 was derived from PCR amplified material, a second clone was sequenced as well. There were two differences between the two clones, therefore a third clone was sequenced in the regions of the two differences. The location of the three clones to the ORF and the sequencing strategies by the primers are illustrated in Figure 2 . The sequences and locations of the gene specific primers were listed in Table 1 ; t7 and rp stand for the t7 promoter primer and the m13 reverse primer, respectively. All sequencing work was done by automated sequencing (ABI PRISM, Model 377, version 2.1.1) in Fox Chase Cancer Center DNA Sequencing Facility. Sequence analysis used the Wisconsin GCG software package.
Tissue RNA was isolated from FVB/N mice using RNA STAT-60 reagent as directed by the manufacturer (Tel-Test Inc.). Total RNA (10 [mu]g/ lane) was resolved on formaldehyde-agarose gels, visualized with ethidium bromide staining and transferred to nylon membranes (Hybond-N+, Amersham). Human tissue RNA blots containing 2 [mu]g of poly A+ were purchased from a commercial supplier (Clonetech Laboratories). RNA blots were prehybridized (2 h, 7% SDS, 1% BSA, 0.25 M Na2HPO4, pH 7.4) and hybridized (overnight) with 32P random prime labeled DNA fragments. Hybridization temperatures were 65oC when a human probe was used on human RNA and 50oC when the same probe was used on mouse RNA. Blot wash (2* SSC, 1% SDS) conditions were adjusted accordingly. Probes: a 2.2 kb fragment from the pMS-c1 clone (see text) and a 2.0 kb fragment of the human GAPDH cDNA were labeled with 32P using Rediprime reagents as directed by the manufacturer (Amersham).
Porcine MS (100 [mu]g) obtained after phenyl sepharose chromatography (23 ) was separated on a 5% denaturing polyacrylamide gel. The gel was stained with 0.2% coomassie brilliant blue R-250 in 20% methanol/0.5% acetic acid for 20 min, and the band corresponding to methionine synthase was excised. The gel piece was soaked in water at room temperature for 30 min. This was followed by five 20 min washes at 30oC with 150 [mu]l of 50% acetonitrile in 200 mM ammonium bicarbonate (pH 8.9) to remove SDS. Acetonitrile was decanted off and the gel piece was air dried by placing on a piece of parafilm for 10 min at room temperature. The gel was then rehydrated with 5 ml of 200 mM ammonium bicarbonate, pH 8.9 containing 0.2% Tween 20. To this, 2 ml of trypsin (250 [mu]g/ml in 200 mM ammonium bicarbonate) was added. The gel piece was then immersed in a minimum volume of ammonium bicarbonate in an Eppendorf tube.
Digestion was allowed to proceed overnight at 30oC, and the reaction was stopped with 1.5 [mu]l of trifluoroacetic acid. The digestion buffer was collected, and the peptides were extracted by macerating the gel in 100 [mu]l of 60% acetonitrile containing 0.1% trifluoroacetic acid followed by incubation at 30oC for 30 min with stirring. The supernatant was pooled with the digestion buffer and the extraction was repeated once. The pooled solution was concentrated down to 20 [mu]l in a Speed Vac. Peptides were separated by high pressure liquid chromatography and subjected to amino acid sequence analysis at the sequencing facility at the University of Nebraska, Medical Center, Omaha.
The N-terminal sequence was obtained by blotting MS on a PVDF membrane at the core facility at University of Nebraska, Lincoln.
Metaphase spreads from normal human lymphocytes were prepared according to the method of Fan et al. (33 ). The MS cDNA clone, MS-c1, was labeled with biotin-16-dUTP by nick translation. FISH and detection of immunofluorescence were performed essentially as described elsewhere (34 ). The chromosome preparations were stained with both diamidino-2-phenylindole (DAPI) and observed with a Zeiss Axiophot fluorescence microscope. Images were captured with a cooled CCD camera connected to a computer work station. Digitized images of DAPI staining and fluorescent signals were merged using Oncor Image, version 1.6, software (Oncor). For somatic hybrid mapping, DNA from a monochromosomal somatic cell hybrid panel was purchased from Coriell Institute (Camden, NJ, NIGMS version #2). PCR primers were chosen from the 3' untranslated region of the MS cDNA (top strand CCACCTCAGCCTCCCAAAATG -21mer, bottom strand GTTCCTCCCTTGCTTCTTCGTCTT - 24mer). These primers amplify a 400 bp human specific band under the following cycling conditions: initial denaturation 94oC (2 min) followed by `touchdown' program 94oC (30 s), 67oC (30 s), 67oC (40 s), where annealing temperature decreases from 67oC by 1.1oC per cycle for 12 cycles, followed by 94oC (30 s), 54oC (30 s), 72oC (30 s) for 30 cycles.
This research was supported by grants from the Pew Charitable Trust and the Fox Chase Cancer Center core grant for Y.L. and W.K., the National Institutes of Health (DK45776) and Center for Biotechnology, UNL, for R.B. We thank Drs Daphne W. Bell and Joseph R. Testa for performing the FISH mapping. We thank Anita Cywinski and Richard Hardy for the DNA sequencing and Dr Luarey D. Steinke, Dr G. Sarath, and Bruce Baggenstoss for protein sequencing. The mapping was supported by NIH grant CA-06927 (Research Cytogenetics Facility, J.R.T.) and by an appropriation from the Commonwealth of Pennsylvania.
1 Taylor, L. M., Jr., and Porter, J. M. (1993) Elevated plasma homocysteine as a risk factor for atherosclerosis. Sem. Vasc. Surg. 6, 36-45.
2 Masser, P. A., Taylor, L. M., Jr., and Porter, J. M. (1994) Importance of elevated plasma homocysteine levels as a risk factor for atherosclerosis. Ann. Thorac. Surg.58, 1240-1246.MEDLINE Abstract
3 Malinow, M. R. (1995) Plasma homocyst(e)ine and arterial occlusive diseases: a mini-review. Clin. Chem.41, 173-176.MEDLINE Abstract
4 Malinow, M. R. (1994) Homocyst(e)ine and arterial occlusive diseases. J. Internal Med.236, 603-617.MEDLINE Abstract
5 Kang, S. S., Wong, P. W., and Malinow, M. R. (1992) Hyperhomocyst(e)inemia as a risk factor for occlusive vascular disease. Ann. Rev. Nutr. 12, 279-298.
6 Brattstrom, L., and Lindgren, A. (1992) Hyperhomocysteinemia as a risk factor for stroke. Neurological Res.14, 81-84.
7 Boushey, C. J., Beresford, S. A. A., Omenn, G. S., and Motulsky, A. G. (1995) A quantitative assessment of plasma homocysteine as a risk factor for vascular disease-Probable benefits of increasing folic acid intakes [Review]. JAMA 274, 1049-1057.MEDLINE Abstract
8 Wall, R. T., Harlan, J. M., Harker, L. A., and Striker, G. E. (1980) Homocysteine-induced endothelial cell injury in vitro: a model for the study of vascular injury. Thromb. Res. 18, 113-121.MEDLINE Abstract
9 Clarke, R., Naughten, E., Cahalane, S., Sullivan, K. O., Mathias, P., McCall, T., and Graham, I. (1992) The role of free radicals as mediators of endothelial cell injury in hyperhomocysteinemia. Irish J. Med. Sci. 161, 561-564.MEDLINE Abstract
10 Mills, J. L., McPartlin, J. M., Kirke, P. N., Lee, Y. J., Conley, M. R., Weir, D. G., and Scott, J. M. (1995) Homocysteine metabolism in pregnancies complicated by neural-tube defects. Lancet345, 149-151.MEDLINE Abstract
11 Steegers-Theunissen, R. P., Boers, G. H., Trijbels, F. J., Finkelstein, J. D., Blom, H. J., Thomas, C. M., Borm, G. F., Wouters, M. G., and Eskes, T. K. (1994) Maternal hyperhomocysteinemia: a risk factor for neural-tube defects? Metab.:Clin. and Exp. 43, 1475-1480.
12 Finkelstein, J. D., Kyle, W. E., and Harris, B. J. (1971) Methionine metabolism in mammals. Regulation of homocysteine methyltransferases in rat tissues. Arch. Biochem. Biophys.146, 84-92.MEDLINE Abstract
13 Mudd, S. H., Levy, H. L., and Skovby, F. (1995) In The metabolic basis of inherited disease (Scriver, C. R., Beaudet, A., Sly, W., and Valle, D., eds), pp. 693-734, McGraw-Hill, New York.
14 Frosst, P., Blom, H. J., Milos, R., Goyette, P., Sheppard, C. A., Matthews, R. G., Boers, G. J., den Heijer, M., Kluijtmans, L. A., van den Heuvel, L. P. et al. (1995) A candidate genetic risk factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase [letter]. Nature Genet. 10, 111-113.MEDLINE Abstract
15 Rosenblatt, D. S. (1995) In The metabolic basis of inherited disease (Scriver, C. R., Beaudet, A., Sly, W., and Valle, D., eds), pp. 3111-3128, McGraw-Hill, New York.
16 Hoffman, R. M. (1985) Altered methionine metabolism and transmethylation in cancer. Anticancer Res.5, 1-30.MEDLINE Abstract
17 Hoffman, R. M. (1982) Methionine dependence in cancer cells-A review. In Vitro18, 421-428.MEDLINE Abstract
18 Ashe, H., Clark, B. R., Chu, F., Hardy, D. N., Halpern, B. C., Halpern, R. M., and Smith, R. A. (1974) N5-methyltetrahydrofolate: homocysteine methyltransferase activity in extracts from normal , malignant and embryonic tissue culture cells. Biochem. Biophys. Res. Comm. 57, 417-425.MEDLINE Abstract
19 Kamely, D., Weissbach, H., and Kerwar, S. S. (1977) Methionine biosynthesis in normal and transformed fibroblasts. Arch. Biochem. Biophys. 179, 43-45.MEDLINE Abstract
20 Balinska, M., and Grzelakowska-Sztabert, B. (1978) Biosynthesis of methionine in mouse cells cultured in vitro. Biochem. Biophys. Res. Comm. 85, 1165-1172.MEDLINE Abstract
21 Laird, P. W., and Jaenisch, R. (1994) DNA methylation and cancer. Hum. Mol. Genet. 3, 1487-1495.MEDLINE Abstract
22 Drennan, C. L., Matthews, R. G., and Ludwig, M. L. (1994) Cobalamin-dependent methionine synthase: the structure of a methylcobalamin-binding fragment and implications for other B12-dependent enzymes. Curr. Opin. Struct. Biol.4, 919-929.MEDLINE Abstract
23 Chen, Z., Crippen, K., Gulati, S., and Banerjee, R. (1994) Purification and kinetic mechanism of a mammalian methionine synthase from pig liver. J. Biol. Chem. 269, 27193-27197.MEDLINE Abstract
24 Goyette, P., Sumner, J. S., Milos, R., Duncan, A. M., Rosenblatt, D. S., Matthews, R. G., and Rozen, R. (1994) Human methylenetetrahydrofolate reductase: isolation of cDNA mapping and mutation identification. Nature Genet.7, 551-554.MEDLINE Abstract
25 Mellman, I. S., Lin, P. F., Ruddle, F. H., and Rosenberg, L. E. (1979) Genetic control of cobalamin binding in normal and mutant cells: assignment of the gene for 5-methyltetrahydrofolate:L-homocysteine S-methyltransferase to human chromosome 1. Proc. Natl. Acad. Sci. USA76, 405-409.MEDLINE Abstract
26 Chen, Z., Chakraborty, S., and Banerjee, R. (1995) Demonstration that mammalian methionine synthases are predominantly cobalamin-loaded. J Biol. Chem. 270, 19246-19249.MEDLINE Abstract
27 Matthews, R. G., Jencks, D. A., Frasca, V., and Matthews, K. D. (1986) In: Chemistry and Biology of Pteridines 1986. Pteridines and Folic Acid Derivatives, pp. 697-707, Walterde Gruyter & Co., New York.
28 Chen, L. C., Kurisu, W., Ljung, B. M., Goldman, E. S., Moore, D. d., and Smith, H. S. (1992) Heterogeneity for allelic loss in human breast cancer. J. Natl. Cancer Inst. 84, 506-510.MEDLINE Abstract
29 Kopf, I., Stierner, U., Islam, Q., Delle, U., Kindblom, L. G., and Martinsson, T. (1992) Characterization of four melanoma cell lines with electron microscopy, immunocytochemistry, cytogenetics, flow cytometry, and southern analysis. Cancer Genet. Cytogenet. 62, 111-123.MEDLINE Abstract
30 Yin, M., Yoshida, M. A., Tonomura, A., and Kasuga, T. (1992) Cytogenetic studies of human malignant melanoma cell lines. Bul. Tokyo Med. Den. University39, 43-54.
31 Johnson, V. P., Heck, L. J., Carter, G. A., and Flom, J. O. (1985) Deletion of the distal long arm of chromosome 1: a definable syndrome. Am. J. Med. Genet. 22, 685-694.MEDLINE Abstract
32 Murayama, K., Greenwood, R. S., Rao, K. W., and Aylsworth, A. S. (1991) Neurological aspects of del(1q) syndrome. Am. J. Med. Genet. 40, 488-492.
33 Fan Y.-S., Davis L. M., and Shows, T. B. (1990) Mapping small DNA sequences by fluorescence in situ hybridization directly on banded metaphase chromosomes. Proc. Natl. Acad. Sci.USA 87, 6223-6227.
34 Bell, D. W., Taguchi, T., Jenkins, N. A., Gilbert, D. J., Copeland, N. G., Gilks, C. B., Zweidler-McKay, P., Grimes, H., Tsichlis, P. N., and Testa, J. R. (1995) Chromosomal localization, in man and rodents, of a gene (GFI1) encoding a novel zinc finger protein reveals a new syntenic region between mouse and man. Cytogenet. Cell Genet.70, 263-267.MEDLINE Abstract
35 Schilde, D., Brake, A. J., Kiefer, M. L., Young, D., Barr, P. J. (1990) Cloning of three human multifunctional de novo purine biosynthetic genes by functional complementation of yeast mutations. Proc. Natl. Acad. Sci. USA87, 2916-2920.
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Sun Jan 12 13:36:46 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
