Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (88)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Picketts, D. J.
Right arrow Articles by Gibbons, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Picketts, D. J.
Right arrow Articles by Gibbons, R. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1899-1907 © Oxford University Press

ATRX encodes a novel member of the SNF2 family of proteins: mutations point to a common mechanism underlying the ATR-X syndrome
Introduction
Results
   Characterisation of the full-length cDNA
   Characterisation of the predicted protein
   Genomic structure of the ATRX gene
   Analysis of 5' flanking region
   Identification of novel splicing defects in ATR-X patients
Discussion
Materials And Methods
   Clinical details
   cDNA cloning and 5' RACE analysis
   Primer extension analysis
   Primers
   Analysis of genomic structure
Acknowledgements
References


ATRX encodes a novel member of the SNF2 family of proteins: mutations point to a common mechanism underlying the ATR-X syndrome

ATRX encodes a novel member of the SNF2 family of proteins: mutations point to a common mechanism underlying the ATR-X syndrome David J. Picketts, Douglas R. Higgs, Satvinder Bachoo, Derek J. Blake1, Oliver W. J. Quarrell2 and Richard J. Gibbons*

The Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford OX3 9DU, UK, 1Genetics Laboratory, Department of Biochemistry, University of Oxford, South Parks Road, Oxford OX1 3QU, UK and 2Centre for Human Genetics, 117, Manchester Road, Sheffield S10 5DN, UK

Received August 30, 1996; Revised and Accepted September 23, 1996

It was shown recently that mutations of the ATRX gene give rise to a severe, X-linked form of syndromal mental retardation associated with [alpha] thalassaemia (ATR-X syndrome). In this study, we have characterised the full-length cDNA and predicted structure of the ATRX protein. Comparative analysis shows that it is an entirely new member of the SNF2 subgroup of a superfamily of proteins with similar ATPase and helicase domains. ATRX probably acts as a regulator of gene expression. Definition of its genomic structure enabled us to identify four novel splicing defects by screening 52 affected individuals. Correlation between these and previously identified mutations with variations in the ATR-X phenotype provides insights into the pathophysiology of this disease and the normal role of the ATRX protein in vivo.

INTRODUCTION

We have shown recently that mutations in a novel X-encoded protein (ATRX) give rise to a characteristic form of syndromal mental retardation (MR) associated with [alpha] thalassaemia (ATR-X syndrome) (1 ). As for many human genetic disorders, the disease gene was cloned without prior knowledge of the protein it encodes; hence the challenge to determine its normal role and elucidate the pathophysiology of its associated disease(s). Some information may be gained when such proteins show significant homology to other proteins or domains whose function is already known. In addition, naturally occurring mutations may be informative: their locations may indicate critical regions of the protein; their classes may infer the mechanisms by which qualitative or quantitative alterations of the protein cause disease; and their clinical effects may point to cellular or molecular targets of the disease gene.

Preliminary analysis of the ATRX protein demonstrated that it is a new member of a superfamily (SFII) of proven or putative helicases which share seven conserved, co-linear `helicase' motifs (2 ,3 ). On the basis of additional homology located between these motifs, ATRX was assigned to the SNF2 subgroup which includes a rapidly expanding group of proteins involved in a wide variety of cellular processes such as transcriptional regulation, recombination, replication and DNA repair (4 ,5 ). Further sequence comparisons, including the regions flanking the SNF2 helicase domain, have subdivided the family into structurally and functionally distinct groups. To some extent this has enabled the function of newly identified members of the group to be predicted (6 ). However, since the ATRX protein sequence was incomplete, it could not be assigned with confidence to any of the SNF2 subgroups and its functional role remains unknown.

To date, only 13 mutations of the ATRX gene have been described (1 ,7 -9 ) but, since the gene has only been partially characterised, the full repertoire of mutations and their phenotypic effects have not been established. At present, the best guide to the normal function of ATRX comes from an evaluation of the phenotypic effects of mutation. In contrast to other human genetic diseases resulting from mutations in SNF2-like genes, in the ATR-X syndrome there is no clinical evidence for UV sensitivity or the premature development of malignancy, implying that ATRX is not involved in DNA recombination and repair. However, the association of ATR-X syndrome with [alpha] thalassaemia suggests that the protein is involved in the regulation of gene expression (1 ).

To increase our understanding of the normal function and role of the ATRX protein, we have established the structure of its full-length cDNA and predicted protein to compare with other members of the SNF2 family. In addition, to enable the full range of ATRX mutations to be identified, we have determined the genomic structure and intron-exon boundaries of the ATRX gene. Ultimately this will allow us to correlate the full range of molecular defects underlying the ATR-X syndrome with the clinical and haematologic phenotype and infer the mechanism(s) by which ATRX mutations may perturb expression of target genes.

RESULTS

Characterisation of the full-length cDNA

The ATRX gene encodes two closely migrating mRNA transcripts of ~10 kb but, at present, the corresponding cDNA contig (referred to as XH2) represents only 6.1 kb (Fig. 1 A). We recently have extended the sequence of the 3' end of the cDNA to the poly(A) tail (X83753). To complete the cDNA sequence, we identified clones from the uncharacterised 5' end of the mRNA transcript by screening a human fetal brain cDNA library with a PCR-amplified probe (72/73) corresponding to the extreme 5' end of the cDNA contig. This identified the clone 72/73-23 which extends the contig by 2 kb (Fig. 1 B).


Figure 1. (A) Schematic diagram of the complete ATRX cDNA. The cDNA extends 10 448 nucleotides with the largest ORF shown as an open box and the 5' and 3' UTR sequences as black lines with the poly(A) tail denoted (AAAAA). The extent of the published XH2 cDNA and the location of elements B and C conserved in RAD54 are shown below (10). The highly conserved helicase motifs characteristic of the SNF2 subgroup are depicted as black boxes. Additional domains discussed in the text are also shown as black boxes and include the nuclear localisation signal (NLS), a stretch of 21 glutamic acids residues (E), the P element (P) and a glutamine-rich region (Q). The alternate initiation codons are labelled M1 and M2. The fragment 72/73 was used as a probe to identify cDNA clones from the 5' end. (B) Analysis of the 5' end of the ATRX gene. Clone 72/73-23 was identified using fragment 72/73 as a probe. 5' RACE analysis with primer XNP84 and subsequent cloning resulted in three fragments (F1, F2 and F3) the extent of which are depicted by black lines. The cDNA sequence is shown as boxed exons to depict the alternate splicing detected in fragments F2 and F3. RT-PCR using primers XNP103 and XNP125 determined that F1 and F2 were truncated 5' RACE products, and are represented by dashed lines. Primers XNP122 and XNP139 were used for primer extension analysis, and primer XNP107 was used for a second 5' RACE experiment. (C) Agarose gel showing the relative abundance of fragments F1, F2 and F3. Amplification of cDNA from a normal individual with primers XNP125 and XNP103 resulted in bands of 864, 978 and 1100 bp which correspond to transcripts lacking exons 6 and 7, or lacking exon 7 or containing all exons, respectively. Digestions of [Phi]X DNA with HaeIII were used as size markers with fragment sizes indicated. (D) Primer extension analysis with primer XNP122. Transcription initiated equally well from two nucleotides in each cell line tested with one nucleotide corresponding to the start observed in F3 (arrow). Lanes 1-5 correspond to RNA templates from HeLa (cervical carcinoma), K562 (erythroleukaemia), HEL (erythroleukaemia), HT29 (colonic adenocarcinoma) and G401 (renal Wilm's tumour) human cell lines, respectively. The transcriptional start site was determined by comparison with the antisense sequencing ladder (ACGT) generated with primer XNP122 using the genomic clone pEco6kb as a template.

Since no additional cDNA clones were obtained from the library, we used the 5' RACE protocol directed from the primer XNP84 to clone and characterise the remaining sequence. Three different 5' RACE fragments (Fig. 1 B) were cloned, sequenced and their structures compared with genomic DNA. This showed that whereas F1 contains all known exons, F2 lacks exon 7 and F3 lacks exons 6 and 7 (see below). It seemed probable that the end of the transcript extending furthest in the 5' direction (F3) corresponds to the transcriptional start site of the ATRX gene, in which case F1 and F2 would represent truncated 5' RACE products. To test this, we amplified cDNA with several 5' and 3' primer pairs, all of which showed that transcripts F1 and F2 extend at least as far in the 5' direction as clone F3 (Fig. 1 C). To confirm the proposed transcriptional start site, we analysed the transcripts in a second 5' RACE experiment directed from the primer XNP107; again clones from this experiment ended at the same nucleotide (denoted +1 in the submitted sequence). Primer extension analysis using XNP122 confirmed the start site (Fig. 1 D) but showed that transcripts initiate equally well from two adjacent cytidine nucleotides (+1 and -1), the first of which corresponds to the first nucleotide observed in all 5' RACE products. In standard PCR reactions using the primers XNP125 and XNP103, transcripts represented by F2 and F3 consistently appeared more abundant than F1 (Fig. 1 C). Similar results were seen using various primer pairs in four different cell lines (data not shown).

The complete cDNA for the ATRX gene thus extends 10 448 nucleotides (Accession no U72936), but at least two alternatively spliced transcripts exist (Accession nos U72937, U72938). Database searches using the newly acquired sequence identified human and mouse expressed sequence tag (EST) sequences but showed no other significant matches.

Characterisation of the predicted protein

Although translation of the ATRX protein previously was thought to initiate at nucleotide 2911 of the mRNA transcript (10 ), analysis of the full-length cDNA has shown that the open reading frame (ORF) includes an additional 742 amino acids; the first in-frame stop codon occurs at nucleotides 7810-7812. The alternatively spliced transcripts encode three different sized proteins. The inclusion of exons 6 and 7 in the longest transcript (F1) introduces in-frame stop codons and, in this case, the first methionine is encoded at 946 (M2) giving a predicted protein of 2288 amino acids (260 kDa). When exons 7, or 6 and 7, are spliced out, a methionine at nucleotide 563 (M1) represents the start of the ORF and this results in predicted proteins of 2375 amino acids (270 kDa) and 2337 amino acids (265 kDa) respectively.

As noted previously (10 ), the protein can be broadly divided into three regions (Fig. 1 A): an N-terminal hydrophilic segment (~1470 amino acids), a central region containing alternating hydrophilic and hydrophobic stretches (~770 amino acids) and a C-terminal domain (~135 amino acids). Almost 40% of the N-terminal region is comprised of three amino acids (serine, lysine and glutamic acid). In addition, this segment contains a nuclear localisation signal (NLS, amino acids 1025-1050) and a stretch of 21 glutamic acid residues (amino acids 1326-1347) which may be involved in protein-protein interactions. The central portion contains the helicase motifs and, as previously noted, this region is most similar to RAD54 (6 ,10 ). In the extreme C-terminal region, we identified a small motif (P, amino acids 2268-2284) which shows 40-50% identity to other SNF2-like proteins including brahma, BRG1, SNF2 and STH1. In addition, we noted that the entire carboxy-terminal region is rich (~20%) in glutamine residues, including a stretch of 9/11 glutamines (Q, codons 2298-2308), suggesting that this could also be a domain involved in protein-protein interactions.

Thus, although ATRX clearly belongs to the SNF2 subgroup, the extended sequence analysed here shows that it is an entirely novel member of this family. Previous suggestions that it is more closely related to RAD54 than other family members (6 ) are not substantiated by our analysis of newly acquired sequence from the flanking regions (see Discussion).

Genomic structure of the ATRX gene

To obtain the genomic structure of the ATRX gene, we employed a combination of exon-exon amplification, vectorette PCR and genomic subcloning from a cosmid contig. Initially we used primers, originally designed for mutational analysis of exons by single strand conformation polymorphism (SSCP) (1 ), to compare the sizes of products obtained by PCR using cDNA or genomic DNA as a template. When genomic and cDNA products appeared identical in size they were assumed to represent individual exons. Amplified genomic products which differed in length when compared with their cDNA counterparts were sequenced to characterise the splice sites. When a pair of primers did not amplify genomic DNA, PCR fragments obtained using each exon primer with the vectorette primer were cloned and sequenced to identify intron-exon boundaries.

As a third approach, an X-only cosmid library [number 104 (L4/FSC X)] (11 ) was screened with a mixture of cDNA clones to generate a contig spanning the ATRX gene. Gaps in the contig were filled by screening a second cosmid library made from YAC 4551 using cDNA probes not contained in the original contig. This resource was used to subclone and sequence genomic fragments that contained intron-exon boundaries not identified by other methods. In this way, we have characterised 36 exons distributed throughout ~300 kb of genomic DNA encoding the entire cDNA sequence (Fig. 2 ). Exons range in size from 54 to ~3000 bp, and all splice sites conform to the consensus splice sequences (data are included with the submitted sequence, Accession nos U72900-U72935).


Figure 2.The complete amino acid sequence encoded by the ATRX gene. Alternate splicing of exon 7 or both exons 6 and 7 produces proteins of 2375 and 2337 amino acids, both of which initiate from the first in-frame methionine located within exon 5. The inclusion of all exons creates an in-frame stop codon resulting in the use of an internal methionine (M) to produce a protein of 2288 residues. The highly conserved helicase motifs as defined by Gorbalenya and Koonin (3) are shown in red, with the conserved P element shown in pink. Potential protein-protein interaction domains (E and Q elements) are presented in blue, and the nuclear localisation signal is shown in green. Arrowheads above the sequence mark the location of intron-exon boundaries, with the number designating the exon. Where an amino acid was disrupted by a splice site, the residue was included in the exon that contained the majority of the codon. Several differences were seen between the predicted ATRX protein and that published by Stayton et al. (10) (accession nos U09820 and U72937).

Analysis of 5' flanking region

One vectorette clone (V117), generated from primer XNP117 located in exon 1, orientated towards the 5' end of the gene contained ~1.5 kb of 5'-flanking sequence of which the first ~400 nucleotides were sequenced and examined for promoter elements and CpG content. A plot of the proportion of CpG dinucleotides identified two CpG-rich regions (Fig. 3 ). The first encompasses the transcriptional start site (+1) and is associated with a nearby unmethylated SacII site; the second CpG island is located 176 nucleotides downstream of this. Since the second CpG island could have been associated with another transcriptional start site for ATRX, we used the oligonucleotide XNP139 for primer extension analysis but we only detected transcripts originating from the proximal CpG island (data not shown). The possibility that the distal CpG island is associated with a transcript on the other DNA strand has not been addressed. Sequence analysis upstream of the transcriptional start site (+1 to -377), containing the putative promoter, did not reveal a TATA box, but there were multiple CCAAT boxes and binding sites for the CTF family of transcription factors. No binding sites were identified for known erythroid-enriched transcription factors (12 ).

Identification of novel splicing defects in ATR-X patients

Establishing the complete intron-exon structure of the ATRX gene allowed us to undertake a more extensive mutational analysis than previously, including potential splicing and promoter defects. To screen for splicing defects we analysed ~8 kb (1-7986) of the cDNA from 52 affected individuals. Products of altered size were identified and sublocalised in four affected individuals.

In two ATR-X patients from pedigree 20 [case 11 (13 ), and his similarly affected cousin case 12], using primers XNP52 and XNP53 (1 ), which amplify exons 15 and 16, we detected the expected fragment (227 bp) and two additional, abnormal fragments of increased size (Fig. 4 A). Sequence analysis demonstrated a G4650A transition at the well conserved G adjacent to the invariant GT of the donor splice site [reviewed in (14 )]. This mutation decreases the efficiency of splicing at the normal site resulting in the use of other cryptic donor sites and the inclusion of the adjacent intronic sequence (intron 15) into the transcript. One such spliceform includes 53 nucleotides of intronic sequence causing the insertion of 17 amino acids and creating a stop codon where it is spliced to exon 16 (Fig. 4 A). These patients also produce some normally spliced product which incorporates the A -> G nucleotide change; however, the altered base (AAG -> AAA: Lys -> Lys) does not create an amino acid substitution and therefore these patients produce a reduced amount (~30%) of entirely normal mRNA. Interestingly, previously we have identified another change in the ATRX protein from these individuals which results in the substitution of serine for asparagine. We suggested that this may not represent the disease-causing mutation in this family due to the conservative nature of the change and its location within a non-conserved region of the protein (1 ). It now appears that N1743S represents a rare amino acid polymorphism.

In a further case [pedigree 15, case 6 (13 )] using primers Seq19 and XNP18 which amplify exons 28 and 29, we detected a normal band (173 bp) representing ~10% of the total product and at least two larger abnormal fragments (Fig. 4 B). Sequence analysis around the donor and acceptor splice sites of intron 28 were normal. Characterisation of three RT-PCR fragments revealed a normally spliced product and two abnormal spliceforms containing 124 bp of an Alu repeat at the 5' end. In addition, the larger spliceform included 200 bp of unique sequence derived from intron 28. Due to the nature of this abnormality lying within a large (>8 kb) intron, we have not yet identified the causative mutation.

We also identified a novel splicing defect in two apparently unrelated families (pedigrees 12 and N17). Amplification of cDNA from these patients [case 3 (13 ); N17 see Materials and Methods] with primers XNP100 and XNP103 resulted in a single fragment of decreased size (214 bp) compared with normal individuals (277 bp), localising the mutation between exons 8 and 9 (Fig. 4 C). Sequence analysis of this product identified an A869G transition in both patients: this creates a cryptic donor splice site (at nucleotide 865, exon 8) which is used exclusively and results in the loss of 63 nucleotides (865-927) of exon 8, thereby maintaining the translational reading frame.

To exclude the possibility that these two families might be related, we analysed several polymorphic markers. The two affected individuals have entirely different haplotypes around ATRX and in pedigree 12 the mutation appears to have arisen as a new event of grandpaternal origin (data not shown). Since this deletion of 63 bases leaves the remainder of the reading frame intact and in-phase it seemed possible that this might represent a rare polymorphism. However, we did not find this mutation in 13 normal X chromosomes or in any of the other 50 affected individuals we have studied. Although we cannot exclude this as a rare polymorphism, it seems probable that it is a disease-causing mutation which could have detrimental effects on protein folding due to the removal of 21 amino acids (61-81) including one cysteine residue.

DISCUSSION

Having established the complete structure of the ATRX gene, its cDNA and predicted protein, it is now possible to search for similarities to other well characterised members of the SNF2 family that might point to the normal role of this protein in vivo. Previous analysis of a partial cDNA identified two small segments (B and C in Fig. 1 A) in the central domain of ATRX which share 50-55% identity with the yeast RAD54 gene (10 ). ATRX was thus provisionally assigned to the RAD54 group of SNF2-like proteins, implying a role in DNA recombination or repair. The complete structure of the ATRX gene, established here, and the recent characterisation of the mouse and human homologues of RAD54 (15 ) have allowed us to re-evaluate the relationship between ATRX and the RAD54 group.

Alignment of the predicted ATRX protein with human, mouse and yeast RAD54 shows no homology beyond that described previously around elements B and C which are not exclusive to the RAD54 group (data not shown). Furthermore, we have found no significant similarity between ATRX and RAD54 in the N-terminal and C-terminal flanking regions which characterise the SNF2 subgroups (6 ). Therefore, although similarity between ATRX and RAD54 in the SNF2 central domain may point to a common ancestry, their divergent flanking regions imply that they are not closely related and probably subsume different functional roles in vivo.

We could not detect extensive similarity between ATRX and any of the SNF2 subgroups, implying that it is an entirely novel member of this family. However, several new findings support previous observations suggesting that ATRX is involved in the regulation of gene expression. The N-terminal region contains a nuclear localisation signal (NLS in Fig. 1 A), and provisional data using a polyclonal anti-ATRX antibody have confirmed that it is a nuclear protein (unpublished data). The C-terminal region is highly glutamine-rich, including a run of 9/11 glutamines, as previously observed in some well characterised transcription factors (16 -18 ). In addition, a 15 amino acid segment (P) in the C-terminal region is conserved (35-50% similarity) in several SNF2-like proteins that are involved in the regulation of gene expression (brahma, BRG1, SNF2 and STH1) but not in RAD54 which is involved in recombination and repair. It is interesting that ATRX mutations down-regulate [alpha]-globin expression, whereas the closely related [beta]-globin genes appear unaffected. One possible reason is that these genes are contained within different chromosomal environments and because of this are regulated differently via their interactions with chromatin (19 ). This is consistent with the emerging concept that all SNF2-like proteins may exert their effects by influencing protein-DNA interactions including well described effects on remodelling chromatin using the energy of ATP hydrolysis (20 -22 ).

Now that the ATRX gene has been completely characterised, it will be possible to establish the full range of disease-causing mutations. To date, 16 mutations have been documented (Table 1 ), including nine missense mutations; two nonsense mutations; five splicing defects, of which four cause frameshifts and protein truncation, and a small (2.0 kb) deletion. These mechanistically diverse mutations are quite evenly distributed throughout the gene and apparently not concentrated in structurally conserved regions. Thus, the common theme is that they all potentially reduce the amount of normal ATRX protein, leading to a loss of function. While this cannot yet be proven for the missense mutations, the principle is illustrated most clearly by the small deletion, in which ATRX mRNA is reduced to <1% of normal and may represent a null mutation (1 ). Similarly, in some of the splicing mutants, including some presented here, the levels of normal ATRX mRNA range from <1 to 30% (9 ). The fact that key features of the ATR-X syndrome are found in the presence of substantial amounts of normal ATRX mRNA suggests that the target pathways are sensitive to the dosage of this protein. One reason for such sensitivity could be that, like the related SNF2 protein (23 ,24 ), ATRX may be required in carefully controlled stoichiometric amounts for the formation of multiprotein complexes.


Figure 3. A plot of the frequency of CpG dinucleotides across the ATRX gene determined by the GCG programs window/statplot (40). Two CpG-rich regions were identified, one located over the transcriptional start site (A) and the other one located 176 nucleotides downstream (B).


Figure 4. (A) A splicing defect was detected between exons 15 and 16 in two affected individuals from pedigree 20. Amplification of cDNA with primers XNP52 and XNP53 results in an expected fragment of 227 bp (arrow) in a normal individual (lane 1) but produces additional bands in affected individuals from the family (lane 2, case 11; lane 3, similarly affected cousin, case 12). The sizes of [Phi]X HaeIII markers are shown on the left. (B) Analysis of the splicing defect detected in pedigree 15. Amplification with primers Seq19 and XNP18 produces a 173 bp cDNA fragment (arrow) that spans the splice junction between exons 28 and 29. Results are shown for a normal individual (lane 1) and his affected brother (case 6; lane 2). Shown on the right are [Phi]X HaeIII size markers. (C) Analysis of splicing mutations in two unrelated families. Amplification of cDNA with primers XNP100 and XNP103 results in a fragment of 277 bp in normal individuals (lane 1, arrow) but a fragment of reduced size (214 bp) in affected individuals from pedigree 12 (lane 2) and pedigree N17 (lane 3). Shown on the left are pBR322 MspI size markers.

Given the diversity of mutations affecting the ATRX gene, the associated phenotype, comprising severe psychomotor retardation and a characteristic facial appearance, with variable degrees of urogenital abnormalities and [alpha] thalassaemia, is remarkably constant (13 ). This is consistent with the view that the common final pathway of these mutations is a decrease in normal ATRX activity. Since the discovery of the ATRX gene, most new cases are defined on the basis of severe MR with the typical facial appearance associated with a mutation in the ATRX gene. This allows a less biased evaluation of the effect of ATRX mutations on the commonly associated clinical features.

There are now five mutations associated with the most severe urogenital abnormalities (Table 1 ). One represents the putative null mutation (see above). Of the others, all but one truncates the protein, resulting in the loss of the C-terminal domain including the conserved P element and polyglutamine tract. These mutations may, therefore, have the greatest potential to disrupt ATRX function. From the available data, it appears that in the absence of significant ATRX function, particularly that of the C-terminal domain, severe urogenital abnormalities are inevitable. Consistent with this, in families with such mutations severe urogenital abnormalities breed true (25 ). Interestingly, in one family with a splicing defect that produces variable amounts of normal ATRX mRNA, urogenital abnormalities were only seen in the patient with the least amount of normal ATRX mRNA (9 ,26 ).

The relationship between ATRX mutations and [alpha] thalassaemia is less clear. Since the presence of excess [beta] chains (HbH inclusions) was originally used to define the ATR-X syndrome, current observations are inevitably biased. Nevertheless, there is considerable variability in the degree to which [alpha] globin synthesis is affected by these mutations. Some patients do not have HbH inclusions (7 ), although this does not rule out down-regulation of [alpha] globin expression since inclusions may not appear until there is 30-40% reduction in [alpha] chain synthesis (27 ). There appears to be no consistent relationship between the degree of [alpha] thalassaemia and the predicted severity of the ATRX mutations and, therefore, no correlation with abnormal sexual differentiation.

Perhaps the most provocative observation is that patients with identical mutations may have very different, albeit stable, degrees of [alpha] thalassaemia, suggesting that the effect of ATRX protein on [alpha] globin expression may be modified by other genetic factors. This is illustrated most clearly by comparing the newly identified pedigrees N17 and 12. Both families harbour identical mutations but in one pedigree the affected individual clearly has [alpha] thalassaemia whereas in the other no HbH inclusions could be detected. This may be analogous to mutations of other members of the SNF2 family whose effects are known to be modified by a variation in many genes encoding proteins that interact with SNF2-like proteins (4 ,21 ).

Table 1 Summary of ATRX mutations
Case

Nucleotide

Amino

Mutationa

Normal

Abnormal

Genital

HbH inc

References

 

 

acid

 

transcript

transcript

abnormalityb

cells %

Ped12, case 3

865-927

61-81

S; deletion 63 bp; in-frame

-

+

+

0.1

13, this paper

PedN17

865-927

61-81

S; deletion 63 bp; in-frame

-

+

+

0

this paper

Ped20, case 11

4650

 

S; G -> A; insertion 53 bp; frameshift

+

+

+++

3.6

13, this paper

Ped20, case 12

4650

 

S; G -> A; insertion 53 bp; frameshift

+

+

++

0.9

13, this paper

Ped22, case 15

4946

1421

M; T -> G; Val -> Glyc

-

+

+++

11

13

Ped14, case 5

5159

1492

M; A -> G; His -> Arg

-

+

+++

1.6

1,13

Ped5, NE

5173

1497

M; T -> C; Cys -> Arg

-

+

++++

>5

1,41

Ped21, case 13

5283

1533

M; G -> T; Lys -> Asn

-

+

normal

0.4

1,13

Ped21, case 14

5283

1533

M; G -> T; Lys -> Asn

-

+

normal

0.6

1,13

IV-10

5606-5781

 

S; deletion 176 bp; frameshift

-

+

+++

30

9,26

IV-9

5606-5781

 

S; deletion 176 bp; frameshift

+(faint)

+

normal

13

9,26

IV-16

5606-5781

 

S; deletion 176 bp; frameshift

+(30%)

+

normal

<0.001

9,26

Ped23, MEF

6437

1918

M; A -> T; Asp -> Val

-

+

+++

7

1,42

Ped23, MF

6437

1918

M; A -> T; Asp -> Val

-

+

+++

27

1,42

Ped15, case 6

6550

 

S; insertion 124 bp; frameshift

+

+

++

1.4

13, this paper

Ped3, SW

6583

1967

M; T -> C; Tyr -> His

-

+

++

>5

1,41

JM3,4, IV-1

6725

2014

M; G -> A; Arg -> Gln

-

+

+++

nd

7,43

Ped13, case 4

6821

2046

M; A -> G; Tyr -> Cys

-

+

+

12

1,13

Ped17, case 8

7489

2269

N; C -> T; Arg -> stop

-

+

++++

0.02

1,13

Ped17, III-1

7489

2269

N; C -> T; Arg -> stop

-

+

++++

nd

1,13

Ped27, case 1

7495

2271

N; G -> T; Glu -> stop

-

+

++++

0.03

1,44

Ped27, case 2

7495

2271

N; G -> T; Glu -> stop

-

+

++++

nd

1,44

IV-18

7534-7541

 

S; deletion 8 bp; frameshift

-

+

++++

0d

8

IV-1

7534-7541

 

S; deletion 8 bp; frameshift

-

+

++++

nd

8

Ped26, case 1

7534-9122

 

D

-

<1%

++++

1.1

1,25

Ped26, case 2

7534-9122

 

D

-

<1%

++++

0.03

1,25

Ped26, case 3

7534-9122

 

D

-

<1%

++++

0.09

1,25

aMutation; D = deletion; M = missense; N = nonsense; S = splice site.bGenital abnormality range is from normal, + = very mild e.g. high lying testes to ++++ = ambiguous genitalia or male pseudohermaphrodite.cThis previously unpublished relatively conservative amino acid change in a non-conserved location may represent a polymorphism rather than a disease-causing mutation.d0/5000 red cells had HbH inclusions but [alpha]/[beta] globin chain ratio = 0.85, 15% below control samples.nd = not determined.

The principles that are beginning to emerge for two of the phenotypic features of ATR-X syndrome will almost certainly apply to other associated abnormalities and, therefore, the clinical spectrum observed for ATRX mutations should increase now that the gene has been isolated. Given the large number of X-linked mental retardation syndromes that map to Xq13, it is possible that ATRX mutations will underlie a significant proportion of these diseases as previously suggested (9 ). The complete characterisation of the ATRX gene will allow a comprehensive mutational analysis, thus providing information on the range of associated phenotypes and elucidating the functionally important aspects of the protein.

MATERIALS AND METHODS

Clinical details

Patient N17, who has not been described previously, has severe mental retardation, characteristic facial dysmorphism, hiatus hernia and mild urogenital abnormalities. In contrast to other cases we have reported, no cells with HbH inclusions have been observed after incubation of fresh venous blood with 1% brilliant cresyl blue solution on several occasions. The clinical details of pedigrees 12, 15 and 20 and all other affected individuals discussed in the text have been reported previously (13 ).

cDNA cloning and 5' RACE analysis

To extend the published cDNA sequence, primers XNP72 and XNP73 were used to amplify a fragment which was used to screen a human fetal brain cDNA library prepared in the vector pcDNA II (28 ) by standard conditions (29 ). Primers XNP84 and XNP107 were used for 5' RACE analysis as described by Frohman et al. (30 ). Clone 72/73-23, and fragments F1, F2 and F3 cloned into pCR-Script (see text) were sequenced using a modified T7 polymerase (USB Biochemicals) and sequential truncations (31 ). Analysis of the alternate spliceforms was performed by RT-PCR as described by Brown et al. (32 ) using RNA isolated from Epstein-Barr virus-transformed lymphoblasts and the primers XNP125 and XNP103.

Primer extension analysis

Primer extension with the primers XNP122 and XNP139 was performed on 10 [mu]g of total RNA isolated from the cell lines HT-29 (33 ), K562 (34 ), HeLa (35 ), HEL (36 ) and G401 (human renal Wilm's tumour; ECACC) as described by Hughes et al. (37 ), except that primers were annealed at 65oC. Primer XNP122 was also used to generate a sequencing ladder using the genomic clone pEco6kb, a 6 kb EcoRI genomic fragment including exon 1 and the 5'-flanking region of the ATRX gene.

Primers

Primers not listed in Table 2 have been described elsewhere (1 ).

Table 2 Primers used in this study
Primer name

Primer sequence (5'-3')

XNP 72

TCTTCAGCAGAAGGCACGTTG

XNP 73

TCATCGCTCTGGTCTTTCTTTAGG

XNP 84

TGATTGACCTGTTGTCCAC

XNP 100

GGCTTCATGGGATTGTGAGCTG

XNP 103

TATTGTGGACAACTCCTTTCGACC

XNP 107

CGTGACGATCCTGAAGACTTGG

XNP 117

GAACCTCCCCACAGCTCAAAG

XNP 122

TTAGTCGTCACTGTAGCTGCTGCTGGAACCTCC

XNP 125

TCGGCCCAACAAAATGGCGGC

XNP 139

CTTCAGATTCTTCTGATGAGTGTGCAAGGAAG

Seq 19

TGTTTTCAGCCAGTCCCTC

Analysis of genomic structure

PCR primers initially designed for SSCP analysis were used to amplify a normal genomic template as described by Gibbons et al. (1 ), with the addition of Taq PCR extender (Stratagene) following the manufacturer's recommendations. Amplified fragments were gel purified (Qiagen), subcloned into pCR-Script (Stratagene) and sequenced using M13 forward and reverse primers and a modified T7 polymerase (Sequenase).

Vectorette PCR was performed using DNA from YAC 4551 (38 ) after digestion with either RsaI, PvuII or HaeIII; or BglII, BclI and BamHI. Following the manufacturer's instructions, blunt vectorette linkers (Genosys) were ligated onto the digested genomic DNA and PCR amplified using a phosphorylated vectorette primer and a gene-specific primer. If the products were in the size range of 100-400 bp, prior to sequencing single-stranded template was produced by digestion with lambda exonuclease which degrades the strand containing the phosphorylated primer (39 ).

ACKNOWLEDGEMENTS

We would like to thank Drs H.M. Kingston, B.C.C. Davison, and A.O.M. Wilkie for referring patients for whom the clinical features have been previously described; Professor Sir D. Weatherall for his continued support and help throughout; Dr A. Monaco for YAC 4551; J. Sloane-Stanley for tissue culture work; and L. Rose for excellent secretarial skills. The families are gratefully acknowledged for their cooperation. This work was supported by grants from the MRC and the Wellcome Trust (Grant ref. no. 042152).

REFERENCES

1 Gibbons, R.J., Picketts, D.J., Villard, L. and Higgs, D.R. (1995) Mutations in a putative global transcriptional regulator cause X-linked mental retardation with [alpha]-thalassemia (ATR-X syndrome). Cell, 80, 837-845. MEDLINE Abstract

2 Bork, P. and Koonin, E.V. (1993) An expanding family of helicases within the `DEAD/H' superfamily. Nucleic Acids Res., 21, 751-752. MEDLINE Abstract

3 Gorbalenya, A.E. and Koonin, E.V. (1993) Helicases: amino acid sequence comparisons and structure-function relationships. Curr. Opin. Struct. Biol., 3, 419-429.

4 Carlson, M. and Laurent, B.C. (1994) The SNF/SWI family of global transcriptional activators. Curr. Opin. Cell Biol., 6, 396-402. MEDLINE Abstract

5 Matson, S.W., Bean, D.W. and George, J.W. (1994) DNA helicases: enzymes with essential roles in all aspects of DNA metabolism. BioEssays, 16, 13-22. MEDLINE Abstract

6 Eisen, J.A., Sweder, K.S. and Hanawalt, P.C. (1995) Evolution of the SNF2 family of proteins: subfamilies with distinct sequences and functions. Nucleic Acids Res., 23, 2715-2723. MEDLINE Abstract

7 Villard, L., Gecz, J., Mattéi, J.F., Fontes, M., Saugier-Veber, P., Munnich, A. and Lyonnet, S. (1996) XNP mutation in a large family with Juberg-Marsidi syndrome. Nature Genet., 12, 359-360. MEDLINE Abstract

8 Ion, A., Telvi, L., Chaussain, J.L., Galacteros, F., Valayer, J., Fellous, M. and McElreavey, K. (1996) A novel mutation in the putative DNA helicase XH2 is responsible for male-to-female sex reversal associated with an atypical form of the ATR-X syndrome. Am. J. Hum. Genet., 58, 1185-1191. MEDLINE Abstract

9 Villard, L., Toutain, A., Lossi, A.-M., Gecz, J., Houdayer, C., Moraine, C. and Fontes, M. (1996) Splicing mutation in the ATR-X gene can lead to a dysmorphic mental retardation phenotype without [alpha]-thalassemia. Am. J. Hum. Genet., 58, 499-505. MEDLINE Abstract

10 Stayton, C.L., Dabovic, B., Gulisano, M., Gecz, J., Broccoli, V., Giovanazzi, S., Bossolasco, M., Monaco, L., Rastan, S., Boncinelli, E., Bianchi, M.E. and Consalez, G.G. (1994) Cloning and characterisation of a new human Xq13 gene, encoding a putative helicase. Hum. Mol. Genet., 3, 1957-1964. MEDLINE Abstract

11 Lehrach, H., Drmanac, R., Hoheisel, J., Larin, Z., Lennon, G., Monaco, A.P., Nizetic, D., Zehetner, G. and Poutska, A. (1990) In Davies, K.E. and Tilghman, S.M. (eds), Genome Analysis Volume I: Genetic and Physical Mapping. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

12 Shivdasani, R.A. and Orkin, S.H. (1996) The transcriptional control of hematopoiesis. Blood, 87, 4025-4039. MEDLINE Abstract

13 Gibbons, R.J., Brueton, L., Buckle, V.J., Burn, J., Clayton-Smith, J., Davison, B.C.C., Gardner, R.J.M., Homfray, T., Kearney, L., Kingston, H.M., Newbury-Ecob, R., Porteous, M.E.P., Wilkie, A.O.M. and Higgs, D.R. (1995) The clinical and hematological features of the X-linked [alpha] thalassemia/mental retardation syndrome (ATR-X). Am. J. Med. Genet., 55, 288-299. MEDLINE Abstract

14 Nakai, K. and Sakamoto, H. (1994) Construction of a novel database containing aberrant splicing mutations of mammalian genes. Gene, 141, 171-177. MEDLINE Abstract

15 Kanaar, R., Troelstra, C., Swagemakers, S.M.A., Essers, J., Smit, B., Franssen, J.H., Pastink, A., Bezzubova, O.Y., Buerstedde, J.M., Clever, B., Heyer, W.D. and Hoeijmakers, J.H.J. (1996) Human and mouse homologs of the Saccharomyces cerevisiae RAD54 DNA repair gene: evidence for functional conservation. Curr. Biol., 6, 828-838. MEDLINE Abstract

16 Ptashne, M. (1988) How eukaryotic transcriptional activators work. Nature, 335, 683-689. MEDLINE Abstract

17 Courey, A.J. and Tjian, R. (1988) Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell, 55, 887-898. MEDLINE Abstract

18 Hoey, T., Weinzieri, R.O., Gill, G., Chen, J.L., Dynlacht, B.D. and Tjian, R. (1993) Molecular cloning and functional analysis of Drosophila TAF110 reveal properties expected of coactivators. Cell, 72, 247-260. MEDLINE Abstract

19 Craddock, C.F., Vyas, P., Sharpe, J.A., Ayyub, H., Wood, W.G. and Higgs, D.R. (1995) Contrasting effects of [alpha] and [beta] globin regulatory elements on chromatin structure may be related to their different chromosomal environments. EMBO J., 14, 1718-1726. MEDLINE Abstract

20 Tsukiyama, T. and Wu, C. (1995) Purification and properties of an ATP-dependent nucleosome remodeling factor. Cell, 83, 1011-1020. MEDLINE Abstract

21 Hirschhorn, J.N., Brown, S.A., Clark, C.D. and Winston, F. (1992) Evidence that SNF2/SWI2 and SNF5 activate transcription in yeast by altering chromatin structure. Genes Dev., 6, 2288-2298. MEDLINE Abstract

22 Peterson, C.L. and Tamkun, J.W. (1995) The SWI-SNF complex: a chromatin remodelling machine? Trends Biochem. Sci., 20, 143-146. MEDLINE Abstract

23 Peterson, C.L. and Herskowitz, I. (1992) Characterisation of the yeast SWI1, SWI2 and SWI3 genes, which encode a global activator of transcription. Cell, 68, 573-583. MEDLINE Abstract

24 Wilson, C.J., Chao, D.M., Imbalzano, A.N., Schnitzler, G.R., Kingston, R.E. and Young, R.A. (1996) DNA polymerase II holoenzyme contains SWI/SNF regulators involved in chromatin remodeling. Cell, 84, 235-244. MEDLINE Abstract

25 McPherson, E., Clemens, M., Gibbons, R.J. and Higgs, D.R. (1995) X-linked alpha thalassemia/mental retardation (ATR-X) syndrome. A new kindred with severe genital anomalies and mild hematologic expression. Am. J. Med. Genet., 55, 302-306. MEDLINE Abstract

26 Lefort, G., Taib, J., Toutain, A., Houdayer, C., Moraine, C., Humeau, C. and Sarda, P. (1993) X-linked [alpha]-thalassemia/mental retardation (ATR-X) syndrome. Report of three male patients in a large French family. Ann. Génét., 36, 200-205. MEDLINE Abstract

27 Higgs, D.R., Vickers, M.A., Wilkie, A.O.M., Pretorius, I.-M., Jarman, A.P. and Weatherall, D.J. (1989) A review of the molecular genetics of the human [alpha]-globin gene cluster. Blood, 73, 1081-1104. MEDLINE Abstract

28 Blake, D.J., Nawrotzki, R., Peters, M.F., Froehner, S.C. and Davies, K.E. (1996) Isoform diversity of dystrobrevin, the murine 87-kDa postsynaptic protein. J. Biol. Chem., 271, 7802-7810. MEDLINE Abstract

29 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

30 Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl Acad. Sci. USA, 85, 8998-9002. MEDLINE Abstract

31 Henikoff, S. (1984) Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene, 28, 351-359. MEDLINE Abstract

32 Brown, C.J., Flenniken, A.M., Williams, B.R.G. and Willard, H.F. (1990) X chromosome inactivation of the human TIMP gene. Nucleic Acids Res., 18, 4191-4195. MEDLINE Abstract

33 Fogh, J. and Tremse, G. (1975) In Fogh, J. (eds), Human Tumour Cells in Vitro. Plenum Publishing, New York.

34 Lozzio, C.B. and Lozzio, B.B. (1975) Human chronic myelogeneous leukaemic cell-line with positive Philadelphia chromosome. Blood, 45, 321-334. MEDLINE Abstract

35 Gey, G.O., Coffman, W.O. and Kubicek, M.T. (1952) Tissue culture studies of the proliferative capacity of cervical carcinoma and normal epithelium. Cancer Res., 12, 264-265.

36 Martin, P. and Papyannopoulou, T. (1982) HEL cells: a new human erythroleukemia cell line with spontaneous and induced globin expression. Science, 216, 1233-1235. MEDLINE Abstract

37 Hughes, J., Ward, C.J., Peral, B., Aspinwall, R., Clark, K., San Millán, J.L., Gamble, V. and Harris, P.C. (1995) The polycystic kidney disease 1 (PKD1) gene encodes a novel protein with multiple cell recognition domains. Nature Genet., 10, 151-160. MEDLINE Abstract

38 Larin, Z., Monaco, A.P. and Lehrach, H. (1991) Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc. Natl Acad. Sci. USA, 88, 4123-4127. MEDLINE Abstract

39 Higuchi, R.G. and Ochman, H. (1989) Production of single-stranded DNA templates by exonuclease digestion following the polymerase chain reaction. Nucleic Acids Res., 17, 5865. MEDLINE Abstract

40 Genetics Computer Group (1994) Program Manual for the Wisconsin Package. Madison, WI 53711.

41 Wilkie, A.O.M., Zeitlin, H.C., Lindenbaum, R.H., Buckle, V.J., Fischel-Ghodsian, N., Chui, D.H.K., Gardner-Medwin, D., MacGillivray, M.H. Weatherall, D.J. and Higgs, D.R. (1990) Clinical features and molecular analysis of the [alpha] thalassaemia/mental retardation syndromes. II. Cases without detectable abnormality of the [alpha] globin complex. Am. J. Hum. Genet., 46, 1127-1140.

42 Ogle, R., De Souza, M., Cunningham, C., Kerr, B. and Sillence, D. (1994) X-linked mental retardation with non-deletional alpha-thalassaemia (ATR-X). Further delineation of the phenotype. J. Med. Genet., 31, 245-247. MEDLINE Abstract

43 Mattei, J.F., Collignon, P., Ayme, S. and Giraud, F. (1983) X-linked mental retardation, growth retardation, deafness and microgenitalism. A second familial report. Clin. Genet., 23, 70-74. MEDLINE Abstract

44 Reardon, W., Gibbons, R.J., Winter, R.M. and Baraitser, M. (1995) Sex reversal in the [alpha] thalassemia/mental retardation (ATR-X) syndrome: a further case. Am. J. Med. Genet., 55, 285-287. MEDLINE Abstract


*To whom correspondence should be addressed


This page is maintained by OUP admin. Last updated Sun Jan 12 13:36:46 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
JCBHome page
K. Ritchie, C. Seah, J. Moulin, C. Isaac, F. Dick, and N. G. Berube
Loss of ATRX leads to chromosome cohesion and congression defects
J. Cell Biol., January 28, 2008; 180(2): 315 - 324.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
M. Szyf
The Dynamic Epigenome and its Implications in Toxicology
Toxicol. Sci., November 1, 2007; 100(1): 7 - 23.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
X. Nan, J. Hou, A. Maclean, J. Nasir, M. J. Lafuente, X. Shu, S. Kriaucionis, and A. Bird
Interaction between chromatin proteins MECP2 and ATRX is disrupted by mutations that cause inherited mental retardation
PNAS, February 20, 2007; 104(8): 2709 - 2714.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
X. Sun, T. Morozova, and M. Sonnenfeld
Glial and Neuronal Functions of the Drosophila Homolog of the Human SWI/SNF Gene ATR-X (DATR-X) and the jing Zinc-Finger Gene Specify the Lateral Positioning of Longitudinal Glia and Axons
Genetics, July 1, 2006; 173(3): 1397 - 1415.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
G. S. Banting, O. Barak, T. M. Ames, A. C. Burnham, M. D. Kardel, N. S. Cooch, C. E. Davidson, R. Godbout, H. E. McDermid, and R. Shiekhattar
CECR2, a protein involved in neurulation, forms a novel chromatin remodeling complex with SNF2L
Hum. Mol. Genet., February 15, 2005; 14(4): 513 - 524.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. M. Ishov, O. V. Vladimirova, and G. G. Maul
Heterochromatin and ND10 are cell-cycle regulated and phosphorylation-dependent alternate nuclear sites of the transcription repressor Daxx and SWI/SNF protein ATRX
J. Cell Sci., August 1, 2004; 117(17): 3807 - 3820.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Tang, S. Wu, H. Liu, R. Stratt, O. G. Barak, R. Shiekhattar, D. J. Picketts, and X. Yang
A Novel Transcription Regulatory Complex Containing Death Domain-associated Protein and the ATR-X Syndrome Protein
J. Biol. Chem., May 7, 2004; 279(19): 20369 - 20377.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. P. Steensma, D. R. Higgs, C. A. Fisher, and R. J. Gibbons
Acquired somatic ATRX mutations in myelodysplastic syndrome associated with {alpha} thalassemia (ATMDS) convey a more severe hematologic phenotype than germline ATRX mutations
Blood, March 15, 2004; 103(6): 2019 - 2026.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. M. J. van der Meijden, D. S. Lapointe, M. X. Luong, D. Peric-Hupkes, B. Cho, J. L. Stein, A. J. van Wijnen, and G. S. Stein
Gene Profiling of Cell Cycle Progression through S-Phase Reveals Sequential Expression of Genes Required for DNA Replication and Nucleosome Assembly
Cancer Res., June 1, 2002; 62(11): 3233 - 3243.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
N. Rouleau, A. Domans'kyi, M. Reeben, A.-M. Moilanen, K. Havas, Z. Kang, T. Owen-Hughes, J. J. Palvimo, and O. A. Janne
Novel ATPase of SNF2-like Protein Family Interacts with Androgen Receptor and Modulates Androgen-dependent Transcription
Mol. Biol. Cell, June 1, 2002; 13(6): 2106 - 2119.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
M Fichera, E Borgione, E Avola, S Amata, M Sturnio, C Romano, and A Ragusa
A new MRXS locus maps to the X chromosome pericentromeric region: a new syndrome or narrow definition of Sutherland-Haan genetic locus?
J. Med. Genet., April 1, 2002; 39(4): 276 - 280.
[Full Text] [PDF]


Home page
J. Neurol. Neurosurg. PsychiatryHome page
P Nokelainen and J Flint
Genetic effects on human cognition: lessons from the study of mental retardation syndromes
J. Neurol. Neurosurg. Psychiatry, March 1, 2002; 72(3): 287 - 296.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
N. G. Berube, M. Jagla, C. Smeenk, Y. De Repentigny, R. Kothary, and D. J. Picketts
Neurodevelopmental defects resulting from ATRX overexpression in transgenic mice
Hum. Mol. Genet., February 1, 2002; 11(3): 253 - 261.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
B. Hendrich and W. Bickmore
Human diseases with underlying defects in chromatin structure and modification
Hum. Mol. Genet., October 1, 2001; 10(20): 2233 - 2242.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Pask, M. B. Renfree, and J. A. Marshall Graves
The human sex-reversing ATRX gene has a homologue on the marsupial Y chromosome, ATRY: Implications for the evolution of mammalian sex determination
PNAS, November 2, 2000; (2000) 230424497.
[Abstract] [Full Text]


Home page
J. Med. Genet.Home page
C. Cardoso, Y. Lutz, C. Mignon, E. Compe, D. Depetris, M.-G. Mattei, M. Fontes, and L. Colleaux
ATR-X mutations cause impaired nuclear location and altered DNA binding properties of the XNP/ATR-X protein
J. Med. Genet., October 1, 2000; 37(10): 746 - 751.
[Abstract] [Full Text]


Home page
BloodHome page
W. H. Raskind, K. K. Niakan, J. Wolff, M. Matsushita, T. Vaughan, G. Stamatoyannopoulos, C. Watanabe, J. Rios, and H. D. Ochs
Mapping of a syndrome of X-linked thrombocytopenia with thalassemia to band Xp11-12: further evidence of genetic heterogeneity of X-linked thrombocytopenia
Blood, April 1, 2000; 95(7): 2262 - 2268.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. L. McDowell, R. J. Gibbons, H. Sutherland, D. M. O'Rourke, W. A. Bickmore, A. Pombo, H. Turley, K. Gatter, D. J. Picketts, V. J. Buckle, et al.
Localization of a putative transcriptional regulator (ATRX) at pericentromeric heterochromatin and the short arms of acrocentric chromosomes
PNAS, November 23, 1999; 96(24): 13983 - 13988.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Pask, M. B. Renfree, and J. A. Marshall Graves
The human sex-reversing ATRX gene has a homologue on the marsupial Y chromosome, ATRY: Implications for the evolution of mammalian sex determination
PNAS, November 21, 2000; 97(24): 13198 - 13202.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
D. E. MacCallum, A. Losada, R. Kobayashi, and T. Hirano
ISWI Remodeling Complexes in Xenopus Egg Extracts: Identification as Major Chromosomal Components that Are Regulated by INCENP-aurora B
Mol. Biol. Cell, January 1, 2002; 13(1): 25 - 39.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (88)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Picketts, D. J.
Right arrow Articles by Gibbons, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Picketts, D. J.
Right arrow Articles by Gibbons, R. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?