Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (54)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Oshima, J.
Right arrow Articles by Martin, G. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oshima, J.
Right arrow Articles by Martin, G. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1909-1913 © Oxford University Press

Homozygous and compound heterozygous mutations at the Werner syndrome locus
Introduction
Results
Discussion
Materials And Methods
   Samples
   RT-PCR
   Direct sequencing of PCR products
Acknowledgements
Abbreviations
References


Homozygous and compound heterozygous mutations at the Werner syndrome locus

Homozygous and compound heterozygous mutations at the Werner syndrome locus Junko Oshima*, Chang-En Yu1, Charles Piussan2, Georg Klein3, Jörg Jabkowski3, Sevim Balci4, Tetsuro Miki5, Jun Nakura5, Toshio Ogihara5, James Ells6, Marilia de A. C. Smith7, Maria I. Melaragno7, Marco Fraccaro8, Susi Scappaticci8, John Matthews9, Samir Ouais10, Amy Jarzebowicz, Gerard D. Schellenberg1 and George M. Martin

Box 357470, Department of Pathology, University of Washington, Seattle, WA 98195, USA, 1Geriatrics Research Education and Clinical Center, Veterans Affairs Puget Sound Health Care System, Seattle Division, Seattle, WA, USA, 2Pediatric Genetics, University of Amiens, Amiens, 80054, France, 3Dermatologische Abteilung, Allgem. offentliche Krankenhaus der Elisabethinen, Linz, 239 Austria, 4Department of Clinical Genetics, Hacettepe University Children's Hispital, Ankara, Turkey, 5Department of Geriatric Medicine, Osaka University, Osaka, 565, Japan, 6Internal Medicine Clinic, Nellis Air Force Base Hospital, Las Vegas, NV 89101, USA, 7Division of Genetics, Escola Paulista de Medicina, São Paulo, 04023, Brazil, 8Medical Genetics, University of Pavia, Pavia, Italy, 9Group Health, Fairfax, VA 22039, USA and 10Section of Endocrinology, Damascus City Hospital, Damascus, Syria

Received June 22, 1996; Revised and Accepted September 23, 1996

The Werner syndrome (WS) is a rare autosomal recessive progeroid disorder. The Werner syndrome gene (WRN) has recently been identified as a member of the helicase family. Four distinct mutations were previously reported in three Japanese and one Syrian WS pedigrees. The latter mutation was originally described as a 4 bp deletion spanning a spliced junction. It is now shown that this mutation results in a 4 bp deletion at the beginning of an exon. Nine new WRN mutations in 10 additional WS patients, both Japanese and Caucasian, are described. These include three compound heterozygotes (one Japanese and two Caucasian). The new mutations are located all across the coding region.

INTRODUCTION

Werner syndrome (WS) is a rare autosomal recessive segmental progeroid syndrome (2 ). Patients exhibit not only an appearance of accelerated aging (premature graying, thinning of hair, skin atrophy and atrophy of subcutaneous fat), but also several disorders commonly associated with aging. These include bilateral cataracts, diabetes mellitus, osteoporosis, several forms of arteriosclerosis and a variety of benign and malignant neoplasms (3 ,4 ).

WS fibroblasts have very limited proliferative capacities as compared with age-matched controls (5 -7 ). A prolongation of the S phase has been demonstrated both in WS fibroblasts and lymphoblastoid cell lines (8 ). Cultured cells exhibit a propensity for chromosomal and intragenic mutations (9 -12 ). The rate of repair of X-ray- or UV-damaged DNA appears to be normal in WS fibroblasts (13 ).

WRN was initially mapped to chromosome 8p (14 ,15 ). Physical and genetic maps of the region were constructed (16 -19 ). WRN has recently been identified (GenBank accession number L76937) and four distinct WRN mutations were described (1 ). The WRN gene encodes a 1432 amino acid protein partially homologous to RecQ helicases (20 ). The WRN protein contains seven helicase motifs; two of them have been identified in all ATP-binding proteins (21 ).

DNA helicases have been implicated in a number of molecular processes. One of the most important functions of DNA helicases is the unwinding of DNA during DNA replication as a component in a replication complex (22 -24 ). Another function of helicase involves DNA repair. It has been hypothesized that some forms of nucleotide excision repair are coupled with transcription; mutant helicases responsible for the DNA instability syndromes may impair lesion recognition and/or lesion removal of the damaged nucleotides during transcription (25 -27 ). Examples include: ERCC2 helicase, which complements xeroderma pigmentosum B and its yeast homologue RAD3 (28 ,29 ); ERCC3, which complements xeroderma pigmentosum D and its yeast homologue RAD25 (30 -34 ); ERCC3 and ERCC6, which complement a Cockayne syndrome mutation (35 ,36 ). In Escherichia coli, the RecQ helicase is involved in the initial step of DNA repair by recombination (37 ).

Helicases are required for accurate chromosomal segregation. In yeast, precise chromosome segregation requires Sgs1, a eukaryotic homologue of RecQ (38 ).

Given the several potential roles of the WRN protein, a careful delineation of spontaneous mutations at this locus could facilitate the characterizations of its functions. We report nine WRN gene mutations from 10 WS patients, three of which were compound heterozygotes. Two other mutations found in three patients have been previously reported (1 ). These various mutations involve sequences throughout the coding region.

RESULTS

Four Japanese and eight non-Japanese WS patients were selected from our International Registry. Six of them (AUS, KO, MIM3, SEP, TUR, UH) were classified as `definite WS' and three (LGS, OW, SUG) as `probable WS'. Clinical and laboratory data for members of BLS, KUN and SYR remain incomplete, but the affected subjects had been diagnosed as WS by the submitting physicians.

Three new mutations were found in regions N-terminal with respect to the helicase consensus motifs. The point mutation at nt 1336, CGA (Arg) to TGA (Stp), was found as a homozygous mutation in one Caucasian (LGS) and two consanguineous Japanese (OW, KO) WS subjects and as a heterozygous mutation in one Japanese WS subject (KUN). LGS denied consanguinity; non-consanguinity was supported by haplotype data (19 ). A single nucleotide deletion at 1194-1196, AAA to AA, was seen as a heterozygous mutation in AUS. This mutation would create a frameshift which ends at 1406-1408 TGA (Stp). A four nucleotide insertion (ATCT) between 1509 and 1520 was homozygous in MIM3. This frameshift mutation would terminate at 1535-1537 TGA (Stp).

Three mutations were found within or just 3' to the helicase motifs in two Caucasian patients. One (SEP) mutation was a 105 bp insertion between 2319 and 2320. The insertion results in a termination codon, creating a truncated protein that excludes helicase domains III and the subsequent C terminus of the WRN protein. A second mutation was a deletion of nucleotide 2320-3056 seen in SUG as a heterozygous mutation, terminating at nt 3081-3083 TGA (Stp). The third mutation was a heterozygous termination mutation found in SUG, located 30 amino acids after the last helicase motif.

Three new mutations were found in regions C-terminal to the helicase motifs. A Japanese patient, IB, was homozygous for an A deletion at nt 3677. The mutated protein stops at nt 3713-3715 TAG (Stp). BLS (French) and TUR (Turkish) patients shared the same mutation at nt 3724, CGA (Gln) to TGA (Stp), which was previously found in the Japanese SY family (1 ). A 74 bp deletion of nt 3541-3614 was seen as a heterozygous mutation in a Japanese WS, KUN. This deletion results in a termination at 3720-3722 TAG (Stp). A 113 bp deletion of nt 3691-3803, which would result in a termination at nt 3816-3818 TGA (Stp), was found as a heterozygous deletion in the Caucasian WS, AUS.

These mutations were confirmed by sequencing of genomic PCR products, using the primers from the intron sequences of WRN (39 ). A summary of the newly discovered mutations is given in Figure 1 .


Figure 1. Locations of the WRN mutations. The rectangular box indicates the predicted WRN protein. The light shadowed segment indicates the highly acidic repeat region; dark shadows indicate the locations of the helicase consensus motifs. The locations of the WRN mutations are grouped based upon the type of mutation and are shown underneath the WRN protein along with Registry codes. Parentheses indicate the heterozygous mutations. ZM and MH mutations were previously described (1).

The mutation in the SYR pedigree was previously reported as a 4 bp deletion at the intron-exon boundary, 2 bp from the putative intron and 2 bp from the contiguous exon (gtagACAGACC at the DNA level). This was expected to cause an in-frame deletion of the exon. Our RT-PCR protocol, however, showed a deletion of 4 bp, ACAG, from the beginning of this exon. The ACAG deletion would result in a termination at nt 3971-3973 TAG (Stp).

DISCUSSION

In our original report of the positional cloning of the WRN locus, four distinct homozygous mutations in the 3' region of the WRN gene were described (1 ). Using the present RT-PCR strategy mutations were readily found in various locations within the gene. The biochemical consequences of these mutations are not known.

All of the WRN mutations we have found to date either create a stop codon mutation or cause frameshifts that lead to premature terminations. We have not yet found an amino acid substitution in WRN that seems to be responsible for the pathogenesis of WS. It is quite possible that the various truncated WRN proteins may be rapidly degraded, resulting in comparable null mutations and comparable phenotypes. Such altered mRNAs are thought to be degraded via a specific pathway (40 ). In preliminary experiments, we do observe evidence for reduced levels of WRN mRNA expression in WS LCLs with four different mutations.

Identical mutations were found across a variety of ethnic groups, raising the question of potential mutationally susceptible sequences. Although the total number of mutations so far found in the WRN protein is not extensive, candidate sequences for such susceptibility would include nt 3677-3920, nt 1336-1395 and nt 2319-2320.

Three instances of compound heterozygous mutations were found: KUN (Japanese), AUS (Caucasian) and SUG (Caucasian). There have been numerous reports of compound heterozygotic mutations in `disease genes' (41 ,42 ). However, comparatively few compound heterozygotes have been reported in the genomic instability syndromes. Given the comparatively low prevalence of consanguinity in the USA, clinicians should therefore be alert to the diagnosis of WS in the absence of a history of consanguinity. Our experience suggests that WS is underdiagnosed in the USA.

MATERIALS AND METHODS

Samples

WS patients were from an International Registry of Werner Syndrome (George M. Martin, MD, Junko Oshima, MD, PhD, Amy Jarzebowicz, BS). Diagnostic criteria were previously described (18 ). This study was approved by the University of Washington Institutional Review Board.

RT-PCR

Five [mu]g of poly(A) RNA, isolated from total RNA, using Oligotex (Qiagen Inc.) was reverse-transcribed with random hexamers in 100 [mu]l reaction volume with GeneAmp RNA PCR kit (Perkin Elmer Cetus). Two [mu]l of the RT product were amplified in a 50 [mu]l PCR reaction buffer containing 5 units Taq DNA polymerase, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 50 [mu]M each of dGTP, dATP, dTTP and dCTP. The cycle program was typically: 94oC for 5 min, then 94oC for 45 s, 55oC for 45 s, 72oC for 3.5 min with 2 s increase per cycle for 35 cycles, followed by 72oC for 10 min. Five [mu]l aliquots of the first amplification products were subjected to a nested second amplification in 100 [mu]l reaction volumes. The primer sequences for RT-PCR are listed in Table 1 . The secondary PCR products were separated on 1% agarose/1*TBE (100 mM Tris-HCl pH 8.0, 90 mM boric acid and 1 mM ethylenediaminetetraacetic acid) to estimate the concentrations of DNA before sequencing.

Table 1 . Primer sequences for the RT-PCR sequencing template
 

 

 

Size of

Region of the amplification

1st amplification primers (5' to 3')

2nd amplification primers (5' to 3')

PCR product

5' end

GTGGTGGCGCTCCACAGTCATCC

AAGACCTGTTGGACTGGATCTTCTC

838

 

CTTTATGAAGCCAATTTCTACCC

TACTCCAAAATCTCTAAATTTCGG

Translation start site

GTGGTGGCGCTCCACAGTCATCC

TAGGACTTTCAAAGATGAGTG

1936

to helicase region

CTTTATGAAGCCAATTTCTACCC

CGTATACAATCCGGTATTTACC

Helicase region

GTGGTGGCGCTCCACAGTCATCC

AGATGTACTTTGGCCATTCCAG

1218

 

CTTTATGAAGCCAATTTCTACCC

GCAATGATCCAATCTGGACC

3' region

GCATTAATAAAGCTGACATTCGCC

CATTACGGTGCTCCTAAGGACATG

1946

 

CGGAAGGCTGATTTAAGATGCC

CGGAAGGCTGATTTAAGATGCC

Table 2 . WRN mutations in Japanese and Caucasian WS patients
Registry no.

Country

Ethnicity

M/F

Location

Mutation

Predicted protein

LGS90610

USA

Caucasian

F

1336

CGA-TGA

368

 

 

 

 

 

Arg Stp

OW90650

Japan

Japanese

M

1336

CGA-TGA

368

 

 

 

 

 

Arg Stp

KO90375

Japan

Japanese

M

1336

CGA-TGA

368

 

 

 

 

 

Arg Stp

KUN9001

Japan

Japanese

M

1336

CGA-TGA

368

 

 

 

 

 

Arg Stp

 

 

 

 

3541-3614

Deletion

1138

AUS40025

Austria

Caucasian

M

1395

A deletion

391

 

 

 

 

3691-3803

Deletion

1157

MIM37100

Brazil

Caucasian

F

1509

ATCT insertion

429

SEP9000

Sardinia

Caucasian

F

2319-2320

105 bp insertion

708

SUG17802

USA

Caucasian

M

2320-3056

Deletion

704

 

 

 

 

2896

CGA-TGA

888

 

 

 

 

 

Arg Stp

IB90550

Japan

Japanese

F

3677

A deletion

1160

BLS60010

France

Caucasian

M

3724

CAG-TAG

1164

 

 

 

 

 

Gln Stp

TUR90010

Turkey

Caucasian

M

3724

CAG-TAG

1164

 

 

 

 

 

Gln Stp

SYR10006

Syria

Syrian

M

3919-3922

ACAG deletion

1245

Direct sequencing of PCR products

RT-PCR products were sequenced using a T7 sequence PCR product sequencing kit (UBS, Amersham Life Science, Inc.). Seven [mu]l of PCR product was pretreated with 15 U of exonuclease I and 1.5 U of shrimp alkaline phosphatase at 37oC for 15 min followed by inactivation of the enzymes at 80oC for 15 min, then mixed with 100 ng of sequencing primers. The sequencing reaction followed the manufacturer's instructions.

The sequencing gel contained 6.6% LongRanger polyacrylamide (J. T. Baker Inc.), 6 M urea and 1.2* TBE. The running buffer contained 0.6* TBE. The gel was run at 55 W, dried and exposed overnight to Biomax MR film (Eastman Kodak Co.).

ACKNOWLEDGEMENTS

We thank Dr Goberdhan P. Dimri for a human cDNA library, an important contribution leading to the original positional cloning of WRN. We also thank Annette Smith, Charles E. Ogburn, Thao Dang, Susan Fredell, Ellen Nemens and Deanne Sparlin for their technical support. This work was supported by National Institute on Aging grants P1 AG08303 (GMM), R37 AG08303 (GMM), T32 AG00057 (GMM), RO1 AG12019 (GDS) and CNPq and FAPESP, Brazil (MIM).

ABBREVIATIONS

WS, Werner syndrome; WRN, Werner syndrome gene; UV, ultraviolet; ERCC, excision repair-cross-complementing; LCL, lymphoblastoid cell line; RT-PCR, reverse transcription-polymerase chain reaction; PCR, polymerase chain reaction.

REFERENCES

1 Yu, C.E., Oshima, J., Fu, Y.W., Hisama, F., Wijsman, E.M., Alisch, R., Matthews, S., Nakura, J., Miki, T., Ouais, S., Martin, G.M., Mulligan, J. and Schellenberg, G.D. (1996) Positional cloning of the Werner's syndrome gene. Science, 272, 258-262. MEDLINE Abstract

2 Martin, G.M. (1978) Genetic syndromes in man with potential relevance to the pathology of aging. Birth Defects, 14, 5-39. MEDLINE Abstract

3 Epstein, C.J., Martin, G.M., Schultz, A.L. and Motulsky, A.G. (1966) Werner's syndrome: a review of its symptomatology, natural history, pathologic features, genetics and relationships to the natural aging process. Medicine, 45, 172-221.

4 Tollefsbol, T.O. and Cohen, H.J. (1984) Werner's syndrome: an underdiagnosed disorder resembling premature aging. Age, 7, 75-88.

5 Martin, G.M., Sprague, C.A. and Epstein, C.J. (1970) Replicative life-span of cultivated human cells. Effects of donor's age, tissue and genotype. Lab. Invest., 23, 86-92. MEDLINE Abstract

6 Salk, D., Bryant, E., Hoehn, H., Johnston, P. and Martin, G.M. (1985) Growth characteristics of Werner syndrome cells in vitro. Adv. Exp. Med. Biol., 190, 305-311. MEDLINE Abstract

7 Kill, I.R., Faragher, R.G., Lawrence, K. and Shall, S. (1994) The expression of proliferation-dependent antigens during the lifespan of normal and progeroid human fibroblasts in culture. J. Cell Sci., 107, 571-579. MEDLINE Abstract

8 Poot, M., Hoehn, H., Runger, T.M. and Martin, G.M. (1992) Impaired S-phase transit of Werner syndrome cells expressed in lymphoblastoid cell lines. Exp. Cell. Res., 202, 267-273. MEDLINE Abstract

9 Hoehn, H., Bryant, E.M., Au, K., Norwood, T.H., Boman, H. and Martin, G.M. (1975) Variegated translocation mosaicism in human skin fibroblast culture. Cytogenet. Cell. Genet., 15, 282-298. MEDLINE Abstract

10 Fukuchi, K., Martin, G.M. and Monnet, R.J. (1989) Mutator phenotype of Werner syndrome is characterized by extensive deletion. Proc. Natl Acad. Sci. USA, 86, 5893-5897. MEDLINE Abstract

11 Fukuchi, K., Tayama, K., Kumahara, Y., Murano, K., Pride, A.B., Martin, G.M., Monnet, R.J. (1990) Increased frequency of 6-thioguanine-resistant peripheral blood lymphocytes in Werner syndrome patients. Hum. Genet., 84, 249-252. MEDLINE Abstract

12 Runger, T.M., Bauer, C., Dekant, B., Moller, K., Sobotta, P., Czerny, C., Poot, M. and Martin, G.M. (1994) Hypermutable ligation of plasmid DNA ends in cells from patients with Werner syndrome. J. Invest. Dermatol., 102, 45-48. MEDLINE Abstract

13 Fujiwara, Y., Higashikawa, T. and Tatsumi, M. (1977) A retarded rate of DNA replication and normal level of DNA repair in Werner's syndrome fibroblasts in culture. J. Cell. Physiol., 92, 365-374. MEDLINE Abstract

14 Goto, M., Rubenstein, M., Weber, J., Woods, K. and Drayna, D. (1992) Genetic linkage of Werner's syndrome to five markers on chromosome 8. Nature, 355, 735-758. MEDLINE Abstract

15 Schellenberg, G.D., Martin, G.M., Wijsman, E.M., Nakura, J., Miki, T. and Ogihara, T. (1992) Homozygosity mapping and Werner syndrome. Lancet, 339, 1002. MEDLINE Abstract

16 Yu, C.E., Oshima, J., Goddard, K.A.B., Miki, T., Nakura, J., Ogihara, T., Fraccaro, M., Puissan, C., Martin, G.M., Schellenberg, G.D. and Wijsman, E.M. (1994) Linkage disequilibrium and haplotype analysis of chromosome 8p11.1-21.1 markers and Werner syndrome. Am. J. Hum. Genet., 55, 356-364. MEDLINE Abstract

17 Oshima, J., Yu, C.E., Boehnke, M., Weber, J.L., Edelhoff, S., Wagner, M.J., Wells, D.E., Wood, S., Disteshe, D.M., Martin, G.M. and Schellenberg, G.D. (1994) Integrated mapping analysis of the Werner syndrome region of chromosome 8. Genomics, 23, 100-113. MEDLINE Abstract

18 Nakura, J., Wijsman, E.J., Miki, T., Kamino, K., Yu, C.E., Oshima, J., Fukuchi, K.I., Weber, J.L., Puissan, C., Melaragno, M.I., Epstein, C.J., Scappaticci, S., Fraccaro, M., Matusmura, T., Murano, S., Yoshida, S., Fujiwara, Y., Saida, T., Ogihara, T., Martin, G.M. and Schellenberg, G.D. (1994) Homozygosity mapping of the Werner syndrome locus (WRN). Genomics, 23, 600-608. MEDLINE Abstract

19 Goddard, K.A.B., Yu, C.E., Oshima, J., Martin, G.M., Schellenberg, G.D. and Wijsman, E.M. (1996) Towards localization of the Werner syndrome gene by linkage disequilibrium and ancestral haplotyping: lessons learned from analysis of 35 chromosome 8p11.1-21.1 markers. Am. J. Hum. Genet., 58, 1286-1302. MEDLINE Abstract

20 Schmid, S.R. and Linder, P. (1992) D-E-A-D protein family of putative RNA helicases. Mol. Microbiol., 6, 283-292. MEDLINE Abstract

21 Gorbalenya, A.E., Koonin, E.V., Donchenko, A.P. and Blinov, V.M. (1989) Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genome. Nucleic Acids Res., 17, 4713-4730. MEDLINE Abstract

22 Lohman, T.M. (1993) Helicase-catalyzed DNA unwinding. J. Biol. Chem., 268, 2269-2272. MEDLINE Abstract

23 Conaway, R.C. and Lehman, L.R. (1982) A DNA primase activity associated with DNA polymerase alpha from Drosophila melanogaster embryos. Proc. Natl Acad. Sci. USA, 79, 2523-2527. MEDLINE Abstract

24 Dodson, M.S. and Lehman, I.R. (1991) Association of DNA helicase and primase activities with subassembly of the herpes simples virus 1 helicase-primase composed of the UL5 and UL52 gene products. Proc. Natl Acad. Sci. USA, 88, 1105-1109. MEDLINE Abstract

25 Hanawalt, P.C. (1994) Transcription-coupled repair and human disease. Science, 266,1957-1958. MEDLINE Abstract

26 Drapkin, R. and Reinberg, D. (1992) The essential twist. Nature, 369, 523-533.

27 Bootsma, D., Weeda, G., Vermeulen, W., van Vuuren, H., Troelstra, C., van der Spek, P. and Hoeijmakers, J. (1995) Nucleotide excision repair syndrome: molecular basis and clinical symptoms. Phil. Trans. R. Soc. London B. Biol. Sci., 347, 75-81. MEDLINE Abstract

28 Weber, C.A., Salazer, E.P., Stewart, S.A. and Thompson, L.H. (1990) ERCC2: cDNA cloning and molecular characterization of a human nucleotide excision repair gene with high homology to yeast RAD3. EMBO J., 9, 1437-1447. MEDLINE Abstract

29 Guzder, S.N., Qiu, H., Sommers, C.H., Sung, P., Prakash, L. and Prakash, S. (1994a) DNA repair gene RAD3 of S. cerevisiae is essential for transcription by RNA polymerase II. Nature, 367, 91-94. MEDLINE Abstract

30 Weeda, G., van Ham, R.C.A., Masurel, R., Westerveld, A., Odijk, H., de Wit, J., Bootsma, D., van del Eb, A.J. and Hoeijmakers, J.H.J. (1990a) Molecular cloning and biological characterization of the human excision repair gene ERCC-3. Mol. Cell. Biol., 10, 2570-2581. MEDLINE Abstract

31 Flejter, W.L., McDaniel, L.D., Johns, D., Friedberg, E.C. and Schults, R.A. (1992) Correction of xeroderma pigmentosum complementation group D mutant cell phenotypes by chromosome and gene transfer: involvement of human ERCC2 DNA repair gene. Proc. Natl Acad. Sci. USA, 89, 261-265. MEDLINE Abstract

32 Sung, P., Bailly, V., Weber, C., Thompson, L.H., Prakash, L. and Prakash, S. (1993) Human xeroderma pigmentosum group D gene encodes a DNA helicase. Nature, 365, 852-855. MEDLINE Abstract

33 Guzder, S.N., Sung, P., Bailly, V., Prakash, L. and Prakash, S. (1994) RAD25 is a DNA helicase required for DNA repair and RNA polymerase II transcription. Nature, 369, 578-581. MEDLINE Abstract

34 Ma, L., Westbroek, A. Jochemsen, A.G., Weeda, G., Bosch, A., Bootsma, D., Hoeijmakers, J.H. and van der Eb, A.J. (1994) Mutational analysis of ECRR3, which is involved in DNA repair and transcription initiation: identification of domains essential for the DNA repair function. Mol. Cell. Biol., 14, 4126-4136. MEDLINE Abstract

35 Weeda, G., van Ham, R.C.A., Vermeulen, W., Bootsma, D., van der Eb, A.J. and Hoeijmakers, J.H.J. (1990) A presumed DNA helicase encoded by ERRC-3 is involved in the human repair disorders xeroderma pigmentosum and Cockayne's syndrome. Cell, 62, 777-791. MEDLINE Abstract

36 Troelstra, C., van Gool, A., de Wit, J., Vermeulen, W., Bootsma, D. and Hoeijmaker, J.H.J. (1992) ECCR6, a member of a subfamily of putative helicases, is involved in Cockayne's syndrome and preferential repair of active gene. Cell, 71, 939-953. MEDLINE Abstract

37 West, S.C. (1994) The processing of recombination intermediates: mechanistic insights from studies of bacterial protein. Cell, 76, 9-15. MEDLINE Abstract

38 Watt, P.M., Louis, E.J., Borts, R.H., Hickson, I.D. (1995) Sgs1: A eukaryotic homolog of E. coli RecQ that interacts with topoisomerase II in vivo and is required for faithful chromosome segregation. Cell, 81, 253-260. MEDLINE Abstract

39 Yu, C.E., Oshima, J., Wijsman, E. M., Nakura, J., Miki, T., Puissan, C., Matthews, S., Martin, G.M., Schellenberg, G.D. and the Werner's Syndrome Collaborative Group. Mutations in the consensus helicase domains of the Werner's syndrome gene (submitted).

40 Jacobson, A. and Peltz, S.W. (1996) Interrelationships of the pathways of mRNA decay and translation in eukaryotic cells. Annu. Rev. Biochem., 65, 693-739. MEDLINE Abstract

41 Satokata, I., Tanaka, K. and Okada, Y. (1992) Molecular basis of group A xeroderma pigmentosum: a missense mutation and two deletions located in a zinc finger consensus sequence of the XPAC gene. Hum. Genet., 88, 603-607. MEDLINE Abstract

42 Sato, M., Nishigori, C., Yagi, T. and Tanabe, H. (1996) Aberrant splicing and truncated-protein expression due to a newly identified XPA gene mutation. Mutat. Res., 362, 199-208. MEDLINE Abstract


*To whom correspondence should be addressed


This page is maintained by OUP admin. Last updated Sun Jan 12 13:36:46 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Circ. Res.Home page
B. C. Capell, F. S. Collins, and E. G. Nabel
Mechanisms of Cardiovascular Disease in Accelerated Aging Syndromes
Circ. Res., July 6, 2007; 101(1): 13 - 26.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. W. Lee, R. Kusumoto, K. M. Doherty, G.-X. Lin, W. Zeng, W.-H. Cheng, C. von Kobbe, R. M. Brosh Jr., J.-S. Hu, and V. A. Bohr
Modulation of Werner Syndrome Protein Function by a Single Mutation in the Conserved RecQ Domain
J. Biol. Chem., November 25, 2005; 280(47): 39627 - 39636.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. S. Kamath-Loeb, P. Welcsh, M. Waite, E. T. Adman, and L. A. Loeb
The Enzymatic Activities of the Werner Syndrome Protein Are Disabled by the Amino Acid Polymorphism R834C
J. Biol. Chem., December 31, 2004; 279(53): 55499 - 55505.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Franchitto, J. Oshima, and P. Pichierri
The G2-phase Decatenation Checkpoint Is Defective in Werner Syndrome Cells
Cancer Res., June 15, 2003; 63(12): 3289 - 3295.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
D. CHOI, P. S. WHITTIER, J. OSHIMA, and W. D. FUNK
Telomerase expression prevents replicative senescence but does not fully reset mRNA expression patterns in Werner syndrome cell strains
FASEB J, April 1, 2001; 15(6): 1014 - 1020.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J.-F. Baurain, D. Colau, N. van Baren, C. Landry, V. Martelange, M. Vikkula, T. Boon, and P. G. Coulie
High Frequency of Autologous Anti-Melanoma CTL Directed Against an Antigen Generated by a Point Mutation in a New Helicase Gene
J. Immunol., June 1, 2000; 164(11): 6057 - 6066.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. J. Moser, A. S. Kamath-Loeb, J. E. Jacob, S. E. Bennett, J. Oshima, and R. J. Monnat
WRN helicase expression in Werner syndrome cell lines
Nucleic Acids Res., January 15, 2000; 28(2): 648 - 654.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. Shiratori, S. Sakamoto, N. Suzuki, Y. Tokutake, Y. Kawabe, T. Enomoto, M. Sugimoto, M. Goto, T. Matsumoto, and Y. Furuichi
Detection by Epitope-defined Monoclonal Antibodies of Werner DNA Helicases in the Nucleoplasm and Their Upregulation by Cell Transformation and Immortalization
J. Cell Biol., January 11, 1999; 144(1): 1 - 9.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. A. Marciniak, D. B. Lombard, F. B. Johnson, and L. Guarente
Nucleolar localization of the Werner syndrome protein in human cells
PNAS, June 9, 1998; 95(12): 6887 - 6892.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (54)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Oshima, J.
Right arrow Articles by Martin, G. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oshima, J.
Right arrow Articles by Martin, G. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?