An extended region of biallelic gene expression and rodent-human synteny downstream of the imprinted H19 gene on chromosome 11p15.5
An extended region of biallelic gene expression and rodent-human synteny downstream of the imprinted H19 gene on chromosome 11p15.5Luwa Yuan, Naifeng Qian and Benjamin Tycko*
Department of Pathology, Columbia University College of Physicians and Surgeons, New York, NY 10032, USA
Received July 1, 1996;Revised and Accepted September 23, 1996
There is increasing evidence for chromosomal domains containing multiple imprinted genes and for domain-wide disruption of imprinting in certain diseases. In a majority of Wilms' tumors (WTs) there is an abnormal bipaternal pattern of expression at three imprinted loci, H19, IGF2 and KIP2, clustered on chromosome 11p15.5. We previously described biallelic expression of L23MRP, 40 kb downstream of H19. Here we map two additional genes, the first encoding a ubiquitously expressed RNA, 2G7, and the second encoding the fast isoform of skeletal muscle troponin-T (TNNT3), in the 55 kb of DNA downstream of L23MRP. 2G7 RNA is spliced and polyadenylated but lacks long open reading frames. 2G7 and TNNT3 are biallelically expressed in mid-fetal and adult human tissues and 2G7 shows persistent expression in WTs. The rat homologue of L23MRP is highly conserved and lies within 85 kb of H19 in a region of rat chromosome 1 which also contains IGF2 and TNNT3. Parallel expression of H19 and TNNT3 in different adult skeletal muscle types suggests that these genes may share an enhancer. These data outline multiple contiguous loci downstream of H19 which escape functional imprinting in humans. The rodent-human synteny of this region may facilitate a search for an imprinting domain boundary.
Genomic imprinting is a gametic process which leads to parent-of-origin-specific transcriptional silencing of a subset of genes in the offspring. Imprinted genes appear to cluster in particular chromosomal regions. Notably, in the Prader-Willi syndrome/Angelman syndrome region of human chromosome 15q11-q13 there are at least five distinct transcripts which are normally expressed exclusively from the paternal allele and this region is predicted to contain at least one additional gene with the opposite pattern of maternal-restricted expression (1 -3 ). In a region of human chromosome 11p15.5 which is subject to recurrent maternal loss of heterozygosity (LOH) in embryonal tumors such as WT, embryonal rhabdomyosarcoma and hepatoblastoma there are three imprinted genes, H19 and two upstream (centromeric) genes, IGF2 and KIP2 and the syntenic region of mice contains these loci as well as at least two other upstream genes, Ins-2 and Mash2, which show functional imprinting in some tissues (4 -17 ).
The clustering of imprinted genes may have implications for the mechanism of imprinting in the gametes. For example, according to a chromatin accessibility model, imprinted domains may correspond to regions of the chromosome which have an open or accessible chromatin structure in the developing gametes of one sex but not the other. To map the domain of imprinting on human chromosome 11p15.5 and to characterize a potential boundary of this domain we have isolated genes consecutively downstream of H19 and have tested them for allelic expression bias in normal tissues and for dysregulation in WTs. We previously described the first of these genes, L23MRP, located 40 kb downstream of H19 (18 ). This gene is not functionally imprinted in mid-fetal and adult human tissues and is not dysregulated or abnormally methylated in WTs which show H19 hypermethylation and transcriptional inactivation and down-modulation of KIP2 expression (17 -19 ). We now report our extension of these studies to two additional loci consecutively downstream of L23MRP and we characterize the region downstream of H19 in terms of rodent-human synteny.
By PCR screening of a P1 phage library with L23MRP primers we obtained several large genomic clones. Two overlapping clones (P1-5514 and P1-5515) spanned a total of ~145 kb. P1-5514 contained H19 and L23MRP while P1-5515 contained L23MRP and ~75 kb of downstream DNA (Fig. 1 A). Exon trapping from P1-5515 yielded two candidate exons which were sequenced. The first exon, which was 153 bp and was arbitrarily designated 2G7, was not similar to any bona fide genes in the database but was identical to a short sequence (GenBank L38282) from exon trapping studies performed by another laboratory. The second trapped exon, which was 90 bp, showed identity to exon 15 of the human gene for the fast isoform of skeletal muscle troponin-T (TNNT3), a gene which had been previously mapped to band 11p15.5 in somatic cell hybrids (20 ). After cloning the 2G7 cDNA (see below) we used Southern blotting of the P1 clones with various L23MRP, 2G7 and TNNT3 exon probes to determine the relative transcriptional orientations and distances between H19 and the three downstream loci (Fig. 1 A). This showed successive head-to-head and tail-to-tail orientations of the four genes, with an overall distance of ~100 kb between H19 and the 5' end of the most downstream gene, TNNT3.
To identify the complete 2G7 transcript we carried out 3' and 5' anchored reverse transcription (RT)-PCR (RACE) with human skeletal muscle RNAs. This initially yielded a 900 bp cDNA which was applied as a probe on northern blots of total and oligo-dT-selected RNAs from various human tissues and which detected a single major polyadenylated transcript of ~1.2 kb in which was equally expressed in a variety of adult and fetal tissues (Fig. 2 and data not shown). A second round of 5' RACE yielded 300 bp of additional sequence which was proven to be legitimate by RT-PCR using primers located at the ends of the sequence, which directly yielded the predicted 1.2 kb cDNA. Sequencing of the 900 bp cDNA and the 5' end of the 1.2 kb cDNA (two independent PCR clones each), as well as several genomic PCR products spanning intron-exon boundaries, showed that the 2G7 gene consists of at least six small exons and encodes a spliced RNA which lacks long continuous translational reading frames (Fig. 3 A). 2G7 is therefore similar to H19 in the sense that it is composed of small exons separated by small introns and gives rise to a spliced and polyadenylated but most likely untranslated RNA, but it differs from H19 in that the steady-state levels of its transcript are comparatively low and not tissue- or developmental stage-specific (Fig. 2 and data not shown). Also in contrast to H19, the 2G7 exons are not particularly G/C-rich and an Alu-like element is present in the 2G7 transcript (nucleotides 386-444). Other than this, no significant sequence similarities were found in the database.
To search for polymorphisms in exons of TNNT3 we carried out RT-PCR/SSCP analysis of the entire coding region in skeletal muscle RNAs from multiple individuals. One rare but recurrent polymorphism was found, a T -> C change at nucleotide position 647 in the cDNA sequence (GenBank M21984) which was neutral in terms of the amino acid sequence but which created a TaqI restriction site (Fig. 1 C). This polymorphism was confirmed by genomic PCR and sequencing. TNNT3 RT-PCR products were generated using a strategy which encompassed four intron-exon boundaries (Fig. 1 C) and TaqI digestion of the resulting cDNAs from skeletal muscle and a variety of other tissues from two heterozygous 16-23 week fetuses and one 4 year old child showed that, in all cases, both TNNT3 alleles were expressed and that there was no allelic bias (Table 1 and Fig. 4 B). Thus, TNNT3 is not functionally imprinted in a variety of human tissues at mid-fetal and postnatal stages of development.
Since H19 expression is repressed in all adult tissues except skeletal muscle it is suspected that the H19 promoter can interact with a muscle-specific enhancer. The mapping of TNNT3 within 100 kb of H19 suggests that this gene might be providing the enhancer. Since TNNT3 expression is restricted to fast skeletal muscle fibers this model predicts that H19 should also show preferential expression in fast compared with slow skeletal muscle. A northern blot analysis of rat skeletal muscle RNAs confirmed this prediction: H19 RNA was very abundant in two different muscles predominantly composed of fast fibers (tibialis anterior and white quadriceps) and was only weakly detectable in a slow skeletal muscle (soleus) (Fig. 5 ).
Despite its apparent lack of protein coding potential, the H19 gene is well conserved among several mammalian species. To ask whether the gene structure of the region downstream of H19 was conserved we isolated the rat homologue of L23MRP. An 85 kb rat P1 clone was obtained by hybridization with a rat H19 probe and was subjected to Southern blotting with a human L23MRP cDNA probe at moderate stringency. A 600 bp HpaII restriction fragment which showed specific hybridization was subcloned and sequenced. This yielded 80 bp of sequence with strong similarity to the central region of the human L23MRP cDNA and to a 439 bp rat EST (GenBank H35131). A 540 bp rat L23MRP cDNA was cloned by 5' RACE using nested primers based on this sequence. This detected a ubiquitous 55 kb transcript in northern blots of poly A+ RNA from various rat tissues, suggesting that the RACE-generated clone was roughly full-length (data not shown). The full-length rat cDNA (GenBank U62635) showed high sequence similarity to the human cDNA and contained a single open translational reading frame with 86% amino acid identity to the predicted protein sequence of human L23MRP. A database search showed no additional similarities beyond the moderate mitochondrial, chloroplast and bacterial ribosomal protein matches found with the human sequence (18 ).
These data indicated rodent-human synteny of H19-L23MRP, with the genes separated by 40 kb in humans and not more than 85 kb in the rat. The rat gene for fast skeletal muscle troponin-T, on chromosome 1, also shows clear synteny with human chromosome 11p15.5 by virtue of its presence in the same linkage group as IGF2 (23 ) and this suggests that the entire region downstream of H19 is well conserved between rodents and humans.
With the accumulating evidence for clustering of imprinted genes in chromosomal regions it appears increasingly likely that imprinting might reflect the existence of chromosomal domains with sex-specific differences in chromatin `accessibility' in the developing gametes. DNA within such regions might be differentially marked, by CpG methylation and/or by binding of transcriptional repressor proteins, in egg versus sperm and, for genes with appropriate local regulatory sequences (`imprinting boxes') this could lead to allele-restricted gene expression in the offspring. A strong sex-bias in the rates of meiotic recombination restricted to imprinted regions of human chromosomes supports this model (24 ,25 ). If imprinted regions have a sex-specific chromatin structure in the gametes then DNA elements which establish boundaries between open and closed chromatin (26 ) might also define the borders of imprinted domains. Alternatively, the chromatin structure of imprinted domains might be determined solely by internal sequences, such as repetitive motifs (27 ), and domain boundary sequences per se might not be important. Distinguishing between these possibilities will require germline modification experiments in mice, but the design of such studies will depend on prior multi-locus mapping and cross-species comparisons of regional imprinting.
The finding of biallelic gene expression at three loci consecutively downstream of human H19 suggests that there may be an imprinting domain boundary between H19 and L23MRP, but there are two major caveats. First, we have not been able to examine allelic expression at very early developmental stages and this could lead to a false impression of lack of imprinting. For example, the Ins-2 gene in mice is functionally imprinted only in the fetal yolk sac and not in its primary site of expression, the adult pancreas (11 ). Second, there appear to be genes which lie well within putative imprinted domains but which are not themselves functionally imprinted. When examined in the pancreas, Ins-2 is an example of this since it lies between Igf-2/H19 and other imprinted genes such as Kip-2 and Mash-2. Another example is the TH gene, which also lies between the imprinted genes IGF2/H19 and KIP2 but which is biallelically expressed in adult mouse brain (28 ). Genes which lie within imprinted domains but which escape functional imprinting most likely lack imprinting boxes which are essential for transcriptional silencing by CpG methylation or other epigenetic modifications. If there is indeed a border of the 11p15.5 imprinted domain between H19 and L23MRP, then our finding of rodent-human synteny of this region is encouraging in terms of future attempts to functionally define boundary sequences by germline deletions in mice.
H19 is highly expressed in a variety of fetal tissues but shows markedly reduced expression in almost all adult tissues, with the exception of skeletal muscle (29 ). The localization of TNNT3 ~100 kb downstream of H19 is intriguing since this gene encodes the isoform of troponin-T which shows high expression restricted to fast skeletal muscle. Based on our finding of high H19 expression in fast but not in slow skeletal muscle it is likely that there are long-range enhancer-like elements shared by the two genes in fast skeletal muscle cells and that this accounts for the persistent expression of H19 in this adult tissue, but if this is the case there cannot be mutually exclusive `competition' for these enhancers since TNNT3 is biallelically expressed. A possible precedent for non-competitive enhancer sharing in mammals are the linked albumin and alpha fetoprotein (AFP) genes, which are coexpressed in murine fetal liver and which can share the tripartite AFP enhancer in a plasmid model (30 ,31 ).
Lastly, our findings regarding the structure and sequence of the 2G7 gene are of interest in terms of the poorly understood roles of non-coding spliced and polyadenylated RNAs in the cell. The 2G7 transcript joins H19, XIST and IPW as the fourth example of an apparently non-coding spliced and polyadenylated RNA closely associated with an imprinted chromosomal region (2 ). Whether this association is meaningful or instead results from an ascertainment bias due to intensive gene analysis in these regions remains to be seen. We have described tumor suppressor activity of human H19 RNA (32 ) and a cis-regulatory effect of H19 transcription influences IGF2 allelic expression via enhancer competition (33 ). Since 2G7 RNA is present in the cell at much lower levels than H19 RNA we doubt that these molecules share the same biological function. There is at least one example of a non-translated spliced and polyadenylated RNA which gives rise to functional small RNAs from its introns (34 ). The possibility of a function for 2G7 introns remains to be tested.
In summary, we have shown that three genes consecutively downstream of human H19 are not functionally imprinted in mid-fetal to adult tissues and that there is long-range rodent-human synteny of this chromosomal region. Additional mapping of imprinting in the opposite (centromeric) direction along the chromosome may define the extent of the putative 11p15.5 imprinted domain.
P1 clones (Genome Systems, St. Louis, MO) were isolated by PCR-screening using L23MRP primers (18 ). Exon trapping was performed with BamHI, BglII, BamHI-BglII and PstI fragments of P1-5515 subcloned into the pSPL3 vector, as previously described (18 ).
Reverse transcription of total RNA was with Superscript reverse transcriptase (GIBCO-BRL, Gaithersburg, MD). RACE PCR for cDNA cloning of 2G7 and rat L23MRP was with the 5'/3' RACE kit (Boehringer-Mannheim, Indianapolis, IN). PCR primers for allelic analysis of cDNAs were: 2G7-1 (TGCAATTGTTACAGGAGAG); 2G7-2 (TATGCACGGGAACCTGGG); 2G7-3 (GTATGCACTGTAGTCCCAGCTGCT); Tn-1 (TACCTGGCCAAGGCTGACC); Tn-2 (AGGCAGCAAGGACACAGAC). The 2G7-1 primer, together with a different downstream primer, 2G7-4 (ATGAGACTGAGTCCTACT), was used for genomic PCR spanning the 2G7 polymorphism. PCR cycling conditions for 2G7 cDNA were: denaturation at 94oC for 4 min followed by 25 cycles of denaturation at 94oC for 1 min, annealing at 58oC for 1 min and extension at 72oC for 40 s with a final extension at 72oC for 6 min. In most experiments nested PCR was carried out with a 1:100 dilution of the first round product for an additional 25 cycles using similar conditions but with annealing at 60oC, extension for 30 s and inclusion of 5% DMSO; products were fainter but allelic expression results were identical with fewer (20 + 20) total cycles. Genomic PCR was carried out under similar conditions but for 30 cycles with annealing at 52oC, extension for 30 s and inclusion of 5% DMSO. Conditions for TNNT3 PCR were: denaturation at 94oC for 4 min followed by 30 cycles (skeletal muscle and heart) or 40 cycles (other tissues) of denaturation at 94oC for 1 min, annealing at 62oC for 30 s and extension at 72oC for 1 min with a final extension at 72oC for 6 min; 5% DMSO was included in the reaction mixture.
Poly A+ RNA was selected on oligo-dT cellulose. Poly A+ RNA from human tissues (2-5 [mu]g) or total RNA from rat tissues (5 [mu]g) was separated on 1% formaldehyde-agarose gels. The 2G7 probe was the 900 bp cDNA. The TNNT3 probe was a full-length cDNA. The TNN1 probe was a partial cDNA generated by RT-PCR using primers bracketing nucleotides 135-562 of the rat cDNA sequence (GenBank J04993). The control probes have been previously described (17 -19 ).
1 Sutcliffe, J.S., Nakao, M., Christian, S,. Orstavik, K.H., Tommerup, N., Ledbetter, D.H. and Beaudet, A.L. (1994) Deletions of a differentially methylated CpG island at the SNRPN gene define a putative imprinting control region. Nature Genet.8, 52-58.MEDLINE Abstract
2 Wevrick, R., Kerns, J.A. and Francke, U. (1994) Identification of a novel paternally expressed gene in the Prader-Willi syndrome region. Hum. Mol. Genet.3, 1877-1882.MEDLINE Abstract
3 Buiting, K., Saitoh, S., Gross, S., Dittrich, B., Schwartz, S., Nicholls, R.D. and Horsthemke, B. (1995) Inherited microdeletions in the Angelman and Prader-Willi syndromes define an imprinting centre on human chromosome 15. Nature Genet. 9, 395-400.MEDLINE Abstract
4 Zhang, Y. and Tycko, B. (1992) Monoallelic expression of the human H19 gene. Nature Genet.1, 40-44.MEDLINE Abstract
5 Rainier, S., Johnson, L., Dobry, C.J., Ping, A.J., Grundy, P.E. and Feinberg, A.P. (1993). Relaxation of imprinted genes in human cancer. Nature362, 747-749.MEDLINE Abstract
6 Zhang, Y., Shields, T., Crenshaw, T., Hao, Y., Moulton, T. and Tycko, B. (1993) Imprinting of human H19: allele-specific CpG methylation, loss of the active allele in Wilms' tumor and potential for somatic allele switching. Am. J. Hum. Genet.53, 113-124.MEDLINE Abstract
7 Ohlsson, R., Nystrom, A., Pfeifer-Ohlsson, S., Tohonen, V., Hedbourg, F., Schofield, P., Flam, F. and Ekstrom, T.J. (1993) IGF2 is parentally imprinted during human embryogenesis and in the Beckwith-Wiedemann syndrome. Nature Genet.4,94-97.MEDLINE Abstract
8 Giannoukakis, N., Deal, C., Paquette, J., Goodyer, C.G. and Polychronakos, C. (1993) Parental genomic imprinting of the human IGF2 gene. Nature Genet.4, 98-101.MEDLINE Abstract
9 DeChiara, T.M., Robertson, E.J. and Efstratiadis, A. (1991) Paternal imprinting of the mouse insulin-like growth factor II gene. Cell64, 849-859.MEDLINE Abstract
10 Bartolomei, M.S., Zemel, S. and Tilghman, S.M. (1991) Parental imprinting of the mouse H19 gene. Nature351, 153-155.MEDLINE Abstract
11 Giddings S.J., King, C.D., Harman, K.W., Flood, J.F. and Carnaghi, LR. (1994) Allele-specific inactivation of insulin 1 and 2, in the mouse yolk sac, indicates imprinting. Nature Genet.6, 310-313.MEDLINE Abstract
12 Guillemot, F., Caspary, T., Tilghman, S.M., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., Anderson, D.J., Joyner, A.L., Rossant, J. and Nagy, A. (1995) Genomic imprinting of Mash2, a mouse gene required for trophoblast development. Nature Genet.9, 235-241.MEDLINE Abstract
13 Hatada, I. and Mukai, T. (1995) Genomic imprinting of p57Kip2, a cyclin-dependent kinase inhibitor, in mouse. Nature Genet.11, 204-206.MEDLINE Abstract
14 Kondo, M., Matsuoka, S., Uchida, K., Osada, H., Nagatake, M., Takagi, K., Harper, J.W., Takahashi, T., Elledge, S.J. and Takahashi, T. (1996) Selective maternal-allele loss in human lung cancers of the maternally expressed p57KIP2 gene at 11p15.5. Oncogene 12, 1365-1368.MEDLINE Abstract
15 Matsuoka, S., Thompson, J.S., Edwards, M.C., Barletta, J.M., Grundy, P., Kalikin, L.M., Harper, J.W., Elledge, S.J. and Feinberg, A.P. (1996) Imprinting of the gene encoding a human cyclin-dependent kinase inhibitor, p57KIP2, on chromosome 11p15.5. Proc. Natl. Acad. Sci. USA93, 3026-3030.MEDLINE Abstract
16 Hatada, I., Inazawa, J., Abe, T., Nakayama, M., Yasuhiko, K., Jinno, Y., Niikawa, N., Ohashi, H., Yoshimitsu, F., Iida, K., Yutani, C., Takahashi, S., Chiba, Y., Ohishi, S. and Mukai, T. (1996) Genomic imprinting of human p57KIP2 and its reduced expression in Wilms' tumors. Hum. Mol. Genet.5, 783-788.MEDLINE Abstract
17 Chung, W.-Y., Yuan, L., Feng, L., Hensle, T. and Tycko, B. (1996) Chromosome 11p15.5 regional imprinting: comparative analysis of KIP2 and H19 in human tissues and Wilms' tumors. Hum. Mol. Genet. 5, 1101-1108.MEDLINE Abstract
18 Tsang, P., Gilles, F., Yuan, L., Kuo, Y-H., Lupu, F., Samara, G., Moosikasuwan, J., Goy, A., Zelenetz, A.D., Selleri, L. and B. Tycko (1995) A novel L23-related gene 40 kb downstream of the imprinted H19 gene is biallelically expressed in mid-fetal and adult human tissues. Hum. Mol. Genet.4, 1499-1507.MEDLINE Abstract
19 Moulton, T., Crenshaw, T., Hao, Y., Moosikasuwan , J., Lin, N., Dembitzer, F., Hensle, T., Weiss, L., McMorrow, L., Loew, T., Kraus, W., Gerald, W. and Tycko, B. (1994) Epigenetic lesions at the H19 locus in Wilms' tumor patients. Nature Genet. 7, 440-447.MEDLINE Abstract
20 Mao, C., Baumgartner, A.P., Jha P.K., Huang, T. H.-M. and Sarkar, S. (1996) Assignment of the human fast skeletal muscle troponin T gene (TNNT3) to chromosome 11p15.5: evidence for the presence of 11pter in a monochromosome 9 somatic cell hybrid in NIGMS mapping panel 2. Genomics31, 385-388.MEDLINE Abstract
21 Steenman, M.J.C., Rainier, S., Dobry, C.J., Grundy, P., Horon, I.L. and Feinberg, A.P. (1994) Loss of imprinting of IGF2 is linked to reduced expression and abnormal methylation of H19 in Wilms' tumor. Nature Genet.7, 433-439.
22 Taniguchi, T., Sullivan, M.J., Osamu, O. and Reeve, A. (1995) Epigenetic changes encompassing the IGF2/H19 locus associated with relaxation of IGF2 imprinting and silencing of H19 in Wilms tumor. Proc. Natl. Acad. Sci.USA92, 2159-2163.
23 Goldmuntz, E.A., Remmers, E.F., Zha, H., Cash, J.M., Mathern, P., Crofford, L.J. and Wilder, R.L. (1993) Genetic map of 12 polymorphic loci on rat chromosome 1. Genomics16, 761-764.MEDLINE Abstract
24 Thomas, B.J. and Rothstein, R. (1991) Sex, maps, and imprinting. Cell64, 1-3.MEDLINE Abstract
25 Paldi, A., Gyapay, G. and Jami, J. (1995) Imprinted chromosomal regions of the human genome display sex-specific meiotic recombination frequencies. Curr. Biol.5, 1030-1035.MEDLINE Abstract
26 Zhao, K., Hart, C.M. and Laemmli, U.K. (1995) Visualization of chromosomal domains with boundary element-associated factor BEAF-32. Cell81, 879-889.MEDLINE Abstract
27 Bestor, T.H. and Tycko, B. (1996) Creation of genomic methylation patterns. Nature Genet.12, 363-367.MEDLINE Abstract
28 Kitsberg, D., Selig, S., Brandeis, M., Simon, I., Keshet, I., Driscoll, D.J., Nicholls, R.D. and Cedar, H. (1993) Allele-specific replication timing of imprinted gene regions. Nature364, 459-463.MEDLINE Abstract
29 Pachnis, V., Brannan, C.I. and Tilghman, S.M. (1988) The structure and expression of a novel gene activated in early mouse embryogenesis. EMBO J.7, 673-681.MEDLINE Abstract
30 Godbout, R., Ingram, R.S. and Tilghman, S.M. (1988) Multiple regulatory elements in the intergenic region between the [alpha]-fetoprotein and albumin genes. Mol. Cell. Biol.8, 1169-1178.MEDLINE Abstract
31 Jin, J.-R., Wen, P. and Locker, J. (1995) Enhancer sharing in a plasmid model containing the [alpha]-fetoprotein and albumin promoters. DNA Cell Biol.14, 267-272.MEDLINE Abstract
32 Hao, Y., Crenshaw, T., Moulton, T., Newcomb, E. and Tycko, B. (1993) Tumour-suppressor activity of H19 RNA. Nature365, 764-767.MEDLINE Abstract
33 Leighton, P.A., Ingram, R.S., Eggenschwiler, J., Efstratiatis, A. and Tilghman, S.M. (1995) Disruption of imprinting caused by deletion of the H19 gene region in mice. Nature375, 34-39.MEDLINE Abstract
34 Tycowski, T.K., Shu, M.-D. and Steitz, J.A. (1996) A mammalian gene with introns instead of exons generating stable RNA products. Nature379, 464-466.
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Sun Jan 12 13:36:46 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
