Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Brinke, A.
Right arrow Articles by Giannelli, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brinke, A.
Right arrow Articles by Giannelli, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1945-1952 © Oxford University Press

Two chimaeric transcription units result from an inversion breaking intron 1 of the factor VIII gene and a region reportedly affected by reciprocal translocations in T-cell leukaemia
Introduction
Results
   RT-PCR analysis
   PFGE analysis
   Hybrid mRNA containing the first exon of the FVIII gene
   Hybrid mRNA containing exons 2-26 of the FVIII gene
Discussion
Materials And Methods
   Patients
   DNA and RNA extraction
   Pulsed-field gel electrophoresis
   Southern blotting
   Reverse transcription, nested PCR and DNA amplification
   RACE/vectorette library amplification
   Chemical mismatch detection
   Sequencing
   Hybridisation of northern blots
   Screening of YACs and cosmids
   Construction of genomic vectorette libraries
Acknowledgements
References


Two chimaeric transcription units result from an inversion breaking intron 1 of the factor VIII gene and a region reportedly affected by reciprocal translocations in T-cell leukaemia

Two chimaeric transcription units result from an inversion breaking intron 1 of the factor VIII gene and a region reportedly affected by reciprocal translocations in T-cell leukaemia Astrid Brinke1,, Luigina Tagliavacca1,+,, Jennifer Naylor1, Peter Green1, Paul Giangrande2 and Francesco Giannelli1,*

1Division of Medical and Molecular Genetics, UMDS, Guy's Hospital, London, UK and 2Oxford Haemophilia Centre, Churchill Hospital, Oxford, UK

Received July 15 1996; Revised and Accepted September 23, 1996

Analysis of mRNA in two haemophilic monozygotic twins offers novel information on the organisation of expressed sequences distal to the coagulation factor VIII gene. These patients show an inversion that, in contrast to the common inversions responsible for 1/5 of all haemophilia A, affects the first rather than intron 22 of the gene. This displaces the most telomeric of the factor VIII exons (exon 1) by ~100 kb towards the telomere, and close to the region of the C6.1A gene. This novel inversion creates two hybrid transcription units: one formed by the promoter and first exon of the factor VIII gene followed by a widely expressed sequence; the other by the promoter and coding region of the C6.1A gene plus most of the factor VIII gene (part of intron 1 and exons 2-26). Investigation of this transcription unit reveals that the C6.1A gene has an unsuspected intron in the region coding for the previously described 3'-untranslated tail of the message. Furthermore, exons located beyond the known C6.1A sequence and present in normal transcripts precede exons 2-26 of the factor VIII gene in the hybrid mRNA of the haemophilic twins. The factor VIII sequences in this hybrid mRNA are not expected to be expressed because they lack the first exon, encoding the prepeptide, and follow a translation stop in the C6.1A gene. Leukaemia-related translocations in the C6.1A region suggest that this region may be somewhat unstable.

INTRODUCTION

Haemophilia A, an X-linked bleeding disorder affecting 1/5000 males, is due to mutation of the large and complex factor VIII (FVIII) gene (186 kb, 26 exons) (1 ). This disease has been maintained in the population by an equilibrium between mutation and selection that, at least until the introduction of modern therapy, resulted in the renewal of the population pool of haemophilia A mutations at a rate of ~1/6 per generation (2 ). Unrelated patients are therefore expected to carry mutations of independent origin and, accordingly, a great variety of gene mutations has been detected by the analysis of haemophilia A patients (3 ). Recently and unexpectedly, however, it has been found that 45% of patients with severe haemophilia or 20% of all patients have large inversions that break the FVIII gene in intron 22 (4 ,5 ). These inversions are caused by intra-chromosome (-chromatid) homologous recombination between a 9.5 kb region (int22h) in the intron 22 of the FVIII gene and either one of two extra copies of the same sequence that are both in inverted orientation relative to the former and ~400 and 500 kb telomeric to the FVIII gene (6 ,7 ). The high incidence of these inversions is due to their repeated occurrence, and a mutation rate of 4-7.2 * 10-6 per gene per gamete per generation has been proposed (5 ,8 ).

In this study, we report the molecular characterisation of a novel inversion in two monozygotic twins severely affected by haemophilia A. The inversion involves the first intron of the FVIII gene and more distal sequences mapped ~70 kb telomeric and upstream of the FVIII gene. This mutation results in the production of two chimaeric transcription units that we characterise.

RESULTS

RT-PCR analysis

The FVIII gene of the monozygotic twins in this study was examined by the procedure of Naylor et al. (9 ). This amplifies, from RNA and genomic DNA, the essential sequences of the FVIII gene (i.e. the putative promoter, coding and the polyadenylation signal regions) in eight overlapping sections. These are then screened by chemical mismatch.

All amplified sections of the patients' gene showed no abnormalities, but the first mRNA segment extending from exon 1 to exon 8 consistently failed to amplify (Fig. 1 A and B). RT-PCR of this region was attempted, therefore, using combinations of nested primers spanning different, smaller segments. This revealed that amplification across the exon 1-2 boundary was impossible, while a segment containing exons 2-8 amplified readily using the nested primers 2Q, 1B, 1E and 1D (Fig. 1 A and B) and contained no mutation. Furthermore, amplification (with primers 7A and 1L) and sequencing of a region of genomic DNA containing the putative promoter, exon 1 and the first donor splice site (Fig. 1 C) showed no abnormality.


Figure 1. RT-PCR from patient and control RNA. (A) Diagram showing: above, first nine exons of the FVIII gene and below, outcome of RT-PCR reactions performed on the patients' mRNA using nested primers (arrows) paired as follows: 1A + 1B and 1C + 1D; 2Q + 1B and 1E + 1D. Dotted line = boundary between exons 1 and 2. (B) RT-PCR amplification products obtained using nested primers 1A + 1B and 1C + 1D (lanes 1 and 2) or 2Q + 1B and 1E + 1D (lanes 3 and 4). Only normal control (C) amplifies in the first reaction to produce a band of 1273 bp, while both control (C) and patient (P) amplify in the second to produce a band of 1011 bp. M = size marker (1 kb ladder BRL) with the size of three marker bands shown on the left in bp. (C) Diagram to show the positions of primers 7A (at nt -710) and 1L (at nt 64 3' from exon 1) used to amplify a region comprising the putative promoter region and the donor splice site of exon 1 of the FVIII gene.

This suggested that the mutation affected the more internal region of the 24 kb long first intron of the FVIII gene.

PFGE analysis

In order to investigate whether the first intron of the patients' FVIII gene was involved in a gross rearrangement, we carried out a pulsed-field gel electrophoresis (PFGE) analysis using the NruI restriction enzyme. As shown diagrammatically in Figure 2 , the FVIII gene is normally contained within a ~270 kb NruI fragment that lies proximal to an ~1 Mb segment (7 ,10 ), but when the patients' DNA was hybridised to a cDNA probe consisting of exons 1 and 2, two bands were observed: one of ~270 kb and one of ~1 Mb. The latter band was also seen in the patients' mother but not, as expected, in the normal control (not shown). This suggested the possibility that the first FVIII exon in the patient was placed distally to the NruI site that normally flanks the telomeric (5') end of the FVIII gene and that helps define the telomeric 1 Mb NruI fragment. An inversion delimited by a break in intron 1 and one telomeric to the factor VIII gene (Fig. 2 ) could therefore be present in the patients and their mother.


Figure 2. Diagram derived from pulsed-field gel electrophoresis results in patients and their mother (not shown) depicting postulated inversion (see text). The top and bottom diagram show, respectively, the map of the normal and abnormal chromosome region. C6 = CpG island associated with the C6.1A and C6.1B genes; 924R-C = Xq28 marker 924R-C. The open headed arrows show the direction of transcription of the FVIII gene or its fragments. The full arrow heads marked by A and B show the direction of transcription of the C6.1A and C6.1B genes. The black boxes indicate the FVIII gene or its parts. NruI sites relevant to PFGE analysis are indicated. The Xq telomere (tel) is to the left.

Hybrid mRNA containing the first exon of the FVIII gene

If an inversion had occurred, the first exon of the FVIII gene would be separated from and in opposite orientation to the rest of the gene (Fig. 2 ). The FVIII promoter could then allow the expression of a transcript containing the first FVIII exon and novel sequences. In order to isolate these sequences, we used the 3'RACE/vectorette procedure developed for the analysis of the common int22h-related inversions mentioned in the Introduction (5 ). After 3' RACE with the FVIII-specific primer 1A and amplification of the ClaI vectorette library with the FVIII primer 1C (see Fig. 1 A for the location of primers 1A and 1C), and the vectorette 224 primer a product of ~900 bp was obtained. Sequence analysis performed using the FVIII 1C primer revealed that exon 1 of the FVIII gene splices onto a new sequence of unknown origin. A primer derived from this sequence (5'A) and the vectorette 224 primer served to generate a probe containing the new sequence. This was used to screen a panel of yeast artificial chromosomes (YACs) covering the Xq28 region surrounding the FVIII gene. This mapped the novel sequence between markers C6 and 924R-C (5 ) at ~70-200 kb 5' or telomeric to the FVIII gene (see Fig. 2 ). This clearly demonstrates the presence of the inversion proposed above.

The novel sequence spliced to exon 1 of the FVIII gene was hybridised to a northern blot containing human mRNA from brain, heart, kidney, liver, lung, pancreas, placenta and skeletal muscle and showed (Fig. 3 ) a band of ~1.7 kb in all tissues, with the strongest signal in heart, kidney and skeletal muscle. In addition to this, a larger transcript of ~6.2 kb is present in skeletal muscle only.


Figure 3. Northern blot probed with the novel sequence spliced to exon 1 of the FVIII gene. Lanes: 1, heart; 2, brain; 3, placenta; 4, lung; 5, liver; 6, skeletal muscle; 7, kidney; 8, pancreas.

Hybrid mRNA containing exons 2-26 of the FVIII gene

In the patients' DNA, exons 2-26 are no longer downstream of the normal FVIII gene promoter. Their expression in the patients' mRNA therefore indicates the presence of a new promoter 5' of exon 2 of the FVIII gene. In order to identify this new promoter and characterise the new transcription unit created by the inversion, we considered the location of the distal boundary of the inversion in relation to known expressed sequences. A CpG island associated with two transcripts called C6.1A and C6.1B (11 ) maps close to the inversion boundary (see C6 in Fig. 2 ). Thus, if the inversion break had occurred distal to the CpG island, the inversion would have brought this promoter close to exon 2 of the FVIII gene as shown in Figure 2 . Furthermore, the C6.1A gene, normally in opposite orientation to that for factor VIII, would now be oriented as the FVIII gene, and a hybrid transcription unit consisting of part of C6.1A at the 5' end and exons 2-26 of the FVIII gene at the 3' end would be plausible.

RT-PCR of normal and patients' RNA directed by forward primers in C6.1A (C6.1A/F1 and C6.1A/F2) and reverse primers in exon 2 of the FVIII gene (2R and 2L) only succeeded in the patients' RNA, where four specific bands were obtained (Fig. 4 A). Three of these products were fully sequenced and they demonstrated that the patients' C6.1A mRNA, which lacked the known most 3' sequences, is joined to the FVIII exons 2-26 by a stretch of novel sequence made up of different modules (Fig. 4 B) which are not adjacent to each other in genomic DNA and, therefore, are exon-like.


Figure 4. Products of RT-PCR amplification extending from the C6.1A gene to FVIII exon 2 or novel exons in patient and control RNA. (A) Lanes 1 and 2: amplification with the nested primers C6.1AF1 + 2R and C6.1AF2 + 2L (see B). Only the patient tracks show four strong amplification products. Lanes 6 and 7: amplification of FVIII exons 2-8 with the nested primers 2Q + 1B and 1E + 1D (see Fig. 1). Negative controls for above reactions are in lanes 3 and 8 (no reverse transcriptase) and lanes 4, 5, 9 and 10 (no RNA). M = size marker 1 kb ladder BRL with some sizes indicated (bp). (B) Diagram of sequences contained in the four amplification products of patient lanes 1 and 2 above. Shaded blocks: novel sequences found between known residues of the C6.1A and FVIII genes. Bands 1 and 2: respectively top and bottom band in lane 1. Bands 3 and 4: top and bottom band in lane 2. Band 1 was only partly sequenced (? in diagram). Top bar: composite picture of alternatively spliced mRNA of bands 1-4 with arrows indicating primers for nested PCR amplification. Arrows below bands 2, 3 and 4: primers paired with C6.1A/F and C6.1A/F2 (see top bar) for nested RT-PCR amplifications shown in (C). (C) Nested RT-PCR amplifications in normal and patients' RNA with primers in penultimate exon of known C6.1A sequence and novel `exons' found in the patients' C6.1A-FVIII hybrid mRNA (see above). Lanes 1 and 2: amplification from normal RNA; lanes 3 and 4: negative controls with no reverse transcriptase or RNA respectively; lanes 5 and 6: amplification from patients' RNA; lanes 7 and 8: negative controls (as lanes 3 and 4); M = size markers. NS-IR2 amplification from primers in C6.1A to those shown in band 3 of (B). The three lowest and strongest bands in lane 2 (normal RNA template) were sequenced and showed the following arrangement of sequences: lowest band = 3' part of novel A + C6.1A, middle band = 3' part of novel A, a 97 bp segment and C6.1A, top band = 3' part of novel A, 75 bp segment, and 5' part of novel A and C6.1A. The band in lane 5 (patients' RNA template) showed the 3' and 5' part of novel A spliced to C6.1A. NS-IIR2 amplification from primers in C6.1A to those shown in band 4 of (B). The three bands in lanes 2 and 5 were sequenced. The lowest band showed the expected novel B spliced to the C6.1A sequence. The two higher bands showed overlapping poorly readable sequences indicating non-specific products, probably amplified from traces of DNA present in RNA preparation since the same bands are also found in the negative control reaction without reverse transcriptase (lane 7). NS-IVR2 amplification from primers in C6.1A to those shown in band 2 of (B). The lowest bands in lanes 2 and 6 correspond to amplification products expected on the basis of the sequence of band 2 in (B). The higher molecular weight bands were not investigated.

In order to localise the inversion breakpoint further, genomic vectorette libraries were constructed from the patient DNA. This allowed analysis of the genomic sequence 3' of the segment of the gene C6.1A present in the hybrid mRNA and this revealed an unreported intron (Fig. 5 ). Further use of the vectorette strategy in a YAC containing the C6.1A region identified the 3' end of this intron (Fig. 5 ) and confirmed the presence and location of the intron in normal DNA. Then the size of the intron was approximately determined by Southern blotting using probes from the flanking exons and YACs containing only the X-linked C6.1A gene (Fig. 6 ), as a non-expressed autosomal homologue of C6.1A is known to exist (11 ). In PstI digests of normal DNA, probes from the proximal and distal exon hybridised to bands of 5 and 5.5 kb respectively, while in HindIII digests both probes hybridised to a 12 kb fragment. The double digests allowed the construction of a restriction map of the region, indicating that the intron is <10 kb long. The patients' Southern blots showed the same pattern as the normal DNA (Fig. 6 B) and, therefore, the inversion appears not to have broken this C6.1A intron. In keeping with this, the sequences found between the C6.1A and FVIII segments of the patients' hybrid mRNA did not hybridise to the HindIII/PstI bands containing the penultimate and last known exon of C6.1A (Fig. 6 ). These novel sequences should, therefore, map either to the region distal to the latter exon or to intron 1 of the FVIII gene.


Figure 5.Boundaries of a previously unreported intron within the 3' UTR of the C6.1A gene. Upper case: exonic and lower case: intronic sequence. Shaded sequence: 5' end of 3' untranslated tail. Arrows: positions of specific primers used in genomic vectorette amplification.


Figure 6. Sizing of a new intron in the 3' UTR of the C6.1A gene and exclusion of its interruption by inversion junction. (A) Map of intron relative to PstI and HindIII restriction sites. Top: genomic structure of the 3' section of the C6.1A gene. Shaded boxes: regions coding for the 3'-untranslated tail of mRNA that flank the new intron. Bold lines above the exons: 5' and 3' probe. I-IV = primers C6.1A/F6, C6.1A/R4, C6.1A/F4, C6.1A/R5 (see Table 1). Bottom: size of the PstI, HindIII and HindIII + PstI fragments hybridising to the 5' or 3' C6.1A probe (see autoradiographs in B). (B) Southern blots of DNA digested with HindIII, PstI, HindIII + PstI and hybridised on subsequent occasions to the 5' and the 3' C6.1A probe. Lanes 1 and 5: control genomic DNA; lanes 2 and 4: Xq28 YAC 13BD8 (ICI library); lane 3: Xq28 YAC 869C1 (CEPH library); lane 6: genomic DNA of patients' mother; lane 7: patients' genomic DNA. Size markers (kb) are on the left of autoradiographs. The YAC DNA samples are included to help distinguish bands due to the X-linked C6.1A gene from those due to its unexpressed autosomal homologue (11). The 5' and 3' probes hybridise to different PstI fragments of 5.0 and 5.5 kb respectively, while they both bind to the same HindIII fragment of ~12 kb. The double digests show modest reduction of the 5' PstI band and partial digestion of the YAC DNA. The genomic DNA tracks from control, patients and patients' mother in all but the PstI digest hybridised to the 5' probe show two bands of which only the one of the same size as the band obtained from the YACs is due to the X-linked copy of C6.1A. Comparison of the HindIII-PstI double digests of normal DNA and DNA from the patients or the patients' mother shows identical patterns (lanes 5, 6 and 7), indicating that the new intron is not altered by the inversion. (C) Lanes 4-7: same Southern blot as in (B) but hybridised to the novel exons shown in band 3 of Fig. 4B. Size of markers is shown on left in kb. The novel exons hybridise only to segments smaller than those in (B).

In order to resolve this uncertainty and see whether normal cells contained transcripts extending beyond the known C6.1A exons, primers in the novel sequences of the patients' hybrid mRNA were used as reverse primers in RT-PCR reactions with C6.1A forward primers. These reactions worked on RNA preparations from normal individuals, yielding a number of alternatively spliced products (Fig. 4 C). Sequencing of these amplification products demonstrated the splicing of the known penultimate C6.1A exon to the novel sequences in normal mRNA. These sequences, therefore, are not part of the FVIII intron 1 but instead are from the region distal to the last known exon of C6.1A. Precise localisation of the inversion breakpoint will, therefore, require analysis of this region. Our results prove, however, that, in the patients, exon-like sequences found in normal transcripts extending beyond the known sequences of the C6.1A gene are spliced to exons 2-26 of the FVIII gene to form the abnormal hybrid message that contains the C6.1A coding region.

DISCUSSION

We describe the first inversion found in haemophilia A not related to the int22h sequence in intron 22 of the FVIII gene and its intra-chromosomal recombination with int22h regions 400-500 kb more telomeric. This novel inversion, that breaks the FVIII gene in intron 1 and involves ~100 kb of DNA 5' or telomeric of the FVIII gene, is present in a pair of monozygotic twins with severe haemophilia A and their heterozygous mother. Since this mutation has not been observed previously, it may represent a rare event. Nevertheless, inversion mutations cannot be detected by procedures that examine all the FVIII exons in genomic DNA, and even the common inversions that break the FVIII gene in intron 22, and that account for 45% of severely affected patients went undetected for 8 years from the cloning of the FVIII gene until the screening of haemophilia A mutations was based on mRNA analysis (12 ). So far, only a small number of patients has been examined by mRNA-based procedures capable of detecting novel inversions. We have examined 44 families, mostly with severe disease. Besides the family that is the object of this work, 26 showed different non-inversion mutations, and 17 inversions breaking the FVIII gene in intron 22 (13 ,14 and unpublished observations).

The inversion described here extends from intron 1 of the FVIII gene to a region beyond the known sequence of the C6.1A gene, and results in the formation of two hybrid transcription units. One of these is formed by both the promoter plus first exon of the FVIII gene and sequences normally expressed in a wide variety of tissues (see Fig. 3 ). These sequences are mapped by our work telomeric to the known C6.1A sequence. The other hybrid transcription unit contains in its 5' section the CpG island and all the known sequence of the C6.1A gene, while the 3' section consists of most of the FVIII gene (part of intron 1 followed by exons 2-26). The transcript of this unit is spliced so that the penultimate exon of the known sequence of the C6.1A gene (11 ) is joined to a variable number of exons distal to the published C6.1A sequence (11 ) and then to exons 2-26 of the FVIII gene. This hybrid transcription unit should allow the expression of the C6.1A gene unless the hybrid mRNA were unduly unstable. By contrast, the transcribed factor VIII sequence should not be translated because it is preceded by at least the translation stop signal at the start of the 3'-untranslated tail of the published C6.1A message (11 ). This mutation, therefore, easily explains the severe haemophilia affecting both twins.

Unexpectedly, we have found an intron in the region of the C6.1A gene specifying the 3'-untranslated tail of the message, and we have revealed that transcripts may normally extend beyond the known C6.1A sequence to include novel exons alternatively spliced. Such longer transcripts are part of the patients' hybrid message. Further work is required to locate the inversion breakpoints and to define in detail both the transcription map of the region immediately distal to the known C6.1A sequences and the role of the novel exons found in the patients' hybrid mRNAs.

Interestingly, three translocations affecting the C6.1A gene and the T-cell receptor [alpha]/[delta] locus have been described in the lymphocytes of three patients with T-cell leukaemia. One of these was found in a patient with ataxia telangiectasia (AT) and chronic prolymphocytic leukaemia, and two in non-AT patients with the same type of leukaemia (15 -17 ). The mechanism by which these translocations may favour the development of T-cell leukaemia is not yet clear, but it has been suggested that they may act by affecting the expression of the gene C6.1B that originates from the same CpG island as C6.1A but extends in the opposite direction towards the FVIII gene (15 -17 ). Whatever the relevance of these translocations in chronic T-cell leukaemia, they suggest some instability of Xq28 in the region of the C6.1A gene.

MATERIALS AND METHODS

Patients

The patients, monozygotic twins with severe haemophilia A, have <1% plasma factor VIII activity. Inhibitors have not been reported in either patient. No other members of the family are affected. Samples of blood in EDTA anticoagulant were used to obtain RNA and DNA.

DNA and RNA extraction

A 10 ml sample of blood was used for extracting DNA by a standard technique (18 ). RNA was isolated by acid guanidinium thiocyanate-phenol-chloroform extraction (19 ) from peripheral lymphocytes purified by centrifugation through a layer of Histopaque 1077 (Sigma) from 10 ml of blood (9 ).

Pulsed-field gel electrophoresis

PFGE was carried out as described by Vetrie et al. (20 ).

Southern blotting

DNA from the patient or YAC clones was digested with restriction enzymes according to the manufacturer's instructions, then blotted on Hybond-N membrane and hybridised to 32P-labelled probes according to standard procedures (18 ).

Reverse transcription, nested PCR and DNA amplification

Between 200 and 500 ng of total lymphocyte RNA was incubated at 65oC for 10 min in a volume of 9.5 [mu]l with 50 ng of the appropriate 3' oligonucleotide primer for cDNA synthesis as already described (9 ,21 ). After two nested PCR reactions, the products were purified by electrophoretic separation on a 1% agarose gel and by absorption to Geneclean II (Bio 101). Genomic DNA was amplified for a single round of 30 cycles (93oC 1 min, 58-61oC 30 s, 72oC 3 min). The primers newly developed for the amplification reactions used in this work are listed in Table 1 .

Table 1 . Primers used for amplification of targeted sequences
Factor VIII primers

1A (section 1 5' outer)

GGGAGCTAAAGATATTTTAGAGAAG

1C (section 1 5' inner)

GAGAAGAATTAACCTTTTGCTTCTC

1B (section 1 3' outer)

TTCCTACCAATCCGCTGAGG

1D (section 1 3' inner)

CAGCAGCAATGTAATGTACC

2Q (exon 2 outer)

ATTTCCTCCTAGAGTGCCA

1E (exon 2 inner)

TGTAGAATTCACGGATCACC

1L (intron 1 reverse)

AACCCGATGTCTGCACCTTC

7A (putative promoter region)

GGATGCTCTAGGACCTAGGC

2R

TACCAGGGTGGCCTTGGCTT

2L

AGCGATGTTGAAAAGGTGAT

C6.1A primers

C6.1A/F1

GTGGTTGGAGGACAGACTGG

C6.1A/F2

GCAAAACCAACAGCATTTGC

C6.1A/F4

GAAAGATGAAAATATCCAGTG

C6.1A/F6

CAGTAACCAAGATCCATAATG

C6.1A/R2

GGTAAAATGAGTCCTCCAAG

C6.1A/R3

TAGTAAGTCTTGAAGTCAGG

C6.1A/R4

GTCTCCTGATTTATTCTAGAG

C6.1A/R5

CTTTTATGGATGTGCTTTCG

New sequence primers

5'A

GGCAGTTGAATACCTTCACCTGC

NS-R

TATATGGAATGTTGTTGCTC

NS-IR

GATGAGATCATTCTATATGC

NS-IR2

TTCAAGTACTTGCTGTATCG

NS-IIR

GAGCAGGTCCAGAAATGCTG

NS-IIR2

AGAAATGCTGTCCAAGAGCC

NS-IVR2

CTCTGGTCAGTTCCAACTTG

RACE/vectorette library amplification

The combination of 3' RACE and vectorette amplification introduced by Naylor et al. (5 ) for the amplification of normal 3' ends of rare transcripts was used as previously described (5 ). 3' RACE used a gene-specific primer, as specified in Results, and the 3' RACE T17 + adapter primer (22 ). Following ClaI digestion of 3' RACE products and ligation to a vectorette bubble (23 ), 5 [mu]l of the DNA mixture were used in a PCR amplification of 35 cycles at 93oC 1 min; 60oC 1 min, 72oC 5 min with a nested gene-specific primer and the 224 primer (23 ).

Chemical mismatch detection

The amplified sequences from the patients' FVIII gene and cDNA were denatured and annealed in a 10:1 ratio with homologous wild-type 32P-end-labelled probes. The hybrids were divided into two aliquots and treated with hydroxylamine solution (3 M hydroxylaminehydrochloride, 1.75 M diethylamine, 37oC for 2 h) or osmium tetroxide solution (0.025% OsO4, 3% pyridine, 37oC for 2 h) to modify mispaired cytosine (C) and thymine (T) residues respectively. These were then cleaved by 1 M piperidine (90oC for 30 min) and sized by 4% acrylamide gel electrophoresis followed by autoradiography (24 ,25 ).

Sequencing

Sequencing was carried out by means of the dideoxy procedure (26 ) modified for direct sequencing of double-stranded PCR products (27 ,28 ).

Hybridisation of northern blots

A multiple tissues northern blot was purchased from Clontech and hybridised according to the manufacturer's instructions.

Screening of YACs and cosmids

A contig of YACs and cosmids representing the Xq28 region surrounding the FVIII gene was screened by hybridisation with a patient-specific probe derived from sequences obtained by 3' RACE/vectorette or RT-PCR.

Construction of genomic vectorette libraries

Approximately 3 [mu]g of genomic DNA from the patient were digested with restriction enzymes MseI, MboI and TaqI followed by an ethanol precipitation. The DNA was resuspended in Tris EDTA buffer and ligated to 50 pmol of the appropriate vectorette cassette (23 ) in a final volume of 100 [mu]l. Vectorette PCR was performed for 30 cycles at 94oC for 1 min, 65oC 1 min, 72oC 5 min on 5 [mu]l of vectorette library with primers C6.1A/F1 or C6.1A/R3 (see Fig. 4 C) in combination with vectorette primer 224 (23 ). Subsequently, 2 [mu]l of a 1:100 dilution of first round product was used in a heminested amplification using primers C6.1A/F2 and C6.1A/R2 respectively under the conditions specified above. Amplification products were purified from agarose gel slices and sequenced as described above.

ACKNOWLEDGEMENTS

We thank Sheila Hassock for YAC and cosmid clones and Adrienne Knight for secretarial help. This work was supported by the Medical Research Council and the Wellcome Trust. We also acknowledge the support of the Generation Trust.

REFERENCES

1 Gitschier, S., Wood, W.I., Goralka, T.M., Wion, K.L., Chen, E.Y., Eaton, D.H., Vehar, G.A., Capon, D.J. and Lawn, R.M. (1984) Characterisation of the human FVIII gene. Nature,312, 326-330.

2 Green, P.M., Naylor, J.A. and Giannelli, F. (1995) The hemophilias. In Hall, J.C., Dunlop, J.C., Friedman, T. and Giannelli, F. (eds), Advances in Genetics. Academic Press, New York, Vol. 32, pp. 99-139. MEDLINE Abstract

3 Tuddenham, E.G.D., Schwaab, R., Seehafer, J., Millar, D.S., Gitschier, J., Higuchi, M., Bidichandani, S., Connor, J.M., Hoyer, L.W., Yoshioka, A., Peake, I.R., Olek, K., Kazazian, H.H., Lavergne, J.M., Giannelli, F., Antonarakis, S.E. and Cooper D.N.(1994) Haemophilia A: database of nucleotide substitutions, deletions, insertions and rearrangements of the factor VIII gene, second edition. Nucleic Acids Res., 22, 3511-3533.

4 Lakich, D., Kazazian, H.H., Antonarakis, S.E. and Gitschier J. (1993) Inversions disrupting the factor VIII gene are a common cause of severe haemophilia A. Nature Genet., 5, 236-241. MEDLINE Abstract

5 Naylor J.A., Brinke, A., Hassock, S., Green, P.M. and Giannelli F. (1993) Characteristic mRNA abnormality found in half the patients with severe haemophilia A is due to large DNA inversions. Hum. Mol. Genet., 2, 1773-1778. MEDLINE Abstract

6 Naylor, J.A., Buck, D., Green, P., Williamson, H., Bentley, D. and Giannelli, F. (1995) Investigation of the factor VIII intron 22 repeated region (int22h) and the associated inversion junctions. Hum. Mol. Genet., 4, 1217-1224. MEDLINE Abstract

7 Rogner, U.C., Kloschis, P., Wilke, K., Gong, W., Pick, E., Dietrich, A., Zechner, U., Hameister, H., Pragliola, A., Herman, G.E., Yates, J.R.W., Lehrach, H. and Poustka, A. (1994) A YAC clone map spanning 7.5 megabase of human chromosome band Xq28. Hum. Mol. Genet., 3, 2137-2146. MEDLINE Abstract

8 Millar, D.S., Kakkar, V.V. and Cooper, D.N. (1994) Screening for inversions in the factor VIII (F8) gene causing severe haemophilia A. Blood Coag. Fibrinol., 5, 239-242.

9 Naylor, J.A., Green P.M., Montandon, A.J., Rizza, C.R. and Giannelli, F. (1991) Detection of three novel mutations in two haemophilia A patients by rapid screening of the whole essential region of factor VIII. Lancet, 337, 635-639. MEDLINE Abstract

10 Poustka, A., Dietrich, A., Langenstein, G., Toniolo, D., Warren, S.T. and Lehrach, H. (1991) Physical map of human Xq27-qter: localizing the region of the fragile X mutation. Proc. Natl Acad. Sci. USA, 88, 8302-8306. MEDLINE Abstract

11 Kenwrick, S., Levinson, B., Taylor, S., Shapiro, A. and Gitschier, J. (1992) Isolation and sequence of two genes associated with a CpG island 5' to the factor VIII gene. Hum. Mol. Genet., 1, 179-186. MEDLINE Abstract

12 Naylor, J.A., Green, P.M., Rizza, C.R. and Giannelli, F. (1992) Factor VIII gene explains all cases of haemophilia A. Lancet, 340, 1066-1067. MEDLINE Abstract

13 Naylor, J.A., Green, P.M., Rizza, C.R. and Giannelli, F. (1993) Analysis of factor VIII mRNA reveals defects in every one of 28 haemophilia A patients. Hum. Mol. Genet., 2, 11-17. MEDLINE Abstract

14 Tagliavacca, L., Rowley, G., Green, P.M., Hayden, S., Woosey, C., Colvin, B. and Giannelli, F. (1996) Analysis of the haemophilia A mutation in sporadic patients registered at the Royal London Hospital and their families. Haemophilia, in press.

15 Thick, J., Mak, Y.-F., Metcalfe, J., Beatty, D. and Taylor, A.M.R. (1994) A gene on chromosome Xq28 associated with T-cell prolymphocytic leukaemia in two patients with ataxia telangiectasia. Leukaemia, 8, 564-573.

16 Fish, P., Forster, A., Sherrington, P.D., Dyer, M.J.S. and Rabbitts, T.H. (1993) The chromosomal translocation t(X;14)(q28;q11) in T-cell prolymphocytic leukaemia breaks within one gene and activates another. Oncogene, 8, 3271-3276.

17 Stern, M.-H., Soulier, J., Rosenzwajg, M., Nakahara, K., Canki-Klain, N., Aurias, A., Sigaux, F. and Kirsh, I.R. (1993) MTCP-1: a novel gene on the human chromosome Xq28 translocated to the T-cell receptor [alpha]/[delta] locus in mature T-cell proliferations. Oncogene, 8, 2475-2483. MEDLINE Abstract

18 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual.2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

19 Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA extraction by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156-159. MEDLINE Abstract

20 Vetrie, D., Bobrow, M. and Harris A. (1993) Construction of a 5.2-Megabase physical map of the human X chromosome at Xq22 using pulsed field gel electrophoresis and yeast artificial chromosomes. Genomics, 15, 631-642. MEDLINE Abstract

21 Roberts, R.G., Bentley, D.R., Barby, T.F.M., Manners, E. and Bobrow, M. (1990) Direct diagnosis of carriers of Duchenne and Becker muscular dystrophy by amplification of lymphocyte RNA. Lancet, 336, 1523-1526. MEDLINE Abstract

22 Frohman, M.A., Dush, M.K. and Martin, G. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene specific oligonucleotide primer. Proc. Natl Acad. Sci. USA, 85, 8998-9002. MEDLINE Abstract

23 Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J.C. and Marham, AF. (1990) A novel, rapid method for the isolation of terminal sequence from yeast artificial chromosome (YAC) clones. Nucleic Acids Res., 18, 2887-2890. MEDLINE Abstract

24 Cotton, R.G.H., Rodrigues, N.R. and Campbell, R.D. (1988) Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations. Proc. Natl Acad. Sci. USA, 85, 4397-4401.

25 Montandon, A.J., Green, P.M., Giannelli, F. and Bentley, D.R. (1989) Direct detection of point mutations by mismatch analysis: application to haemophilia B. Nucleic Acids Res., 17, 3347-3358. MEDLINE Abstract

26 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl Acad. Sci. USA, 74, 5463-5467. MEDLINE Abstract

27 Green, P.M., Bentley, D.R., Mibashan, R.S., Nilsson, I.M. and Giannelli F. (1989) Molecular pathology of haemophilia B. EMBO J., 8, 1067-1072. MEDLINE Abstract

28 Winship, P.R. (1989) An improved method for directly sequencing PCR amplified material using dimethyl sulphoxide. Nucleic Acids Res., 17, 1266. MEDLINE Abstract


*To whom correspondence should be addressed

+Present address: Department of Biological Chemistry, The University of Michigan Medical School, Ann Arbor, MI, USA

These authors contributed equally to this work


This page is maintained by OUP admin. Last updated Sun Jan 12 13:36:46 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
BloodHome page
O. El-Maarri, H. Singer, C. Klein, M. Watzka, U. Herbiniaux, H. H. Brackmann, J. Schroder, J. Graw, C. R. Muller, W. Schramm, et al.
Lack of F8 mRNA: a novel mechanism leading to hemophilia A
Blood, April 1, 2006; 107(7): 2759 - 2765.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Riccardi, A. Tagliaferri, C. Manotti, C. Pattacini, and T. M. Neri
Intron 1 factor VIII gene inversion in a population of Italian hemophilia A patients
Blood, October 16, 2002; 100(9): 3432 - 3432.
[Full Text] [PDF]


Home page
BloodHome page
R. D. Bagnall, N. Waseem, P. M. Green, and F. Giannelli
Recurrent inversion breaking intron 1 of the factor VIII gene is a frequent cause of severe hemophilia A
Blood, January 1, 2002; 99(1): 168 - 174.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Brinke, A.
Right arrow Articles by Giannelli, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brinke, A.
Right arrow Articles by Giannelli, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?