Absence of disease phenotype and intergenerational stability of the CAG repeat in transgenic mice expressing the human Huntington disease transcript
Absence of disease phenotype and intergenerational stability of the CAG repeat in transgenic mice expressing the human Huntington disease transcript Y. P. Goldberg, M. A. Kalchman, M. Metzler, J. Nasir, J. Zeisler, R. Graham, H. B. Koide, J. O'Kusky1, A. H. Sharp2, C. A. Ross2, F. Jirik3 and M. R. Hayden*
Department of Medical Genetics, University of British Columbia, Vancouver, BC, Canada,1Laboratory of Molecular Neurobiology, Johns Hopkins University, School of Medicine, Baltimore, MD, USA, 2Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver, BC, Canada and 3Biomedical Research Centre, University of British Columbia, Vancouver, BC, Canada
Received October 9, 1995;Revised and Accepted November 8, 1995
The mutation underlying Huntington disease (HD) is CAG expansion in the first exon of the HD gene. In order to investigate the role of CAG expansion in the pathogenesis of HD, we have produced transgenic mice containing the full length human HD cDNA with 44 CAG repeats. By 1 year, these mice have no behavioral abnormalities and morphometric analysis at 6 (one animal) and 9 (two animals) months age revealed no changes. Despite high levels of mRNA expression, there was no evidence of the HD gene product in any of these transgenic mice. In vitro transfection studies indicated that the inclusion of 120 bp of the 5' UTR in the cDNA construct and the presence of a frameshift mutation at nucleotide 2349 prevented expression of the HD cDNA. These findings suggest that the pathogenesis of HD is not mediated through DNA-protein interaction and that presence of the RNA transcript with an expanded CAG repeat is insufficient to cause the disease. Rather, translation of the CAG is crucial for the pathogenesis of HD. In contrast to that seen in humans, the CAG repeat in these mice was remarkably stable in 97 meioses. This suggests that genomic sequences may play a critical role in influencing repeat instability.
Huntington disease (HD) is a progressive, autosomal dominant, neurodegenerative disorder characterized by chorea and intellectual decline (1 -3 ) leading to inexorable progression to death approximately 15 years after the time of onset. The HD gene which spans about 200 kb (4 ) encodes two distinct transcripts of 10.3 and 13.6 kb (5 ).
HD belongs to a growing list of neurodegenerative disorders characterized by unstable expanded trinucleotide repeats in novel genes (3 ). The mutation underlying HD involves an expansion beyond 36 repeats of a CAG trinucleotide repeat (6 ) located within the first exon (7 ). However, how this expanded triplet repeat, or its translation product results in disease remains unknown.
To explore the role of expanded trinucleotide repeats in mediating the disease phenotype, transgenic animal models have been created for several of the dynamic mutation disorders. In spinobulbar muscular atrophy (SBMA) introduction of the full length androgen receptor cDNA coding for an expanded polyglutamine tract does not result in any obvious phenotype, despite expression of the transgene at both the RNA and the protein levels (8 ). In spinocerebellar ataxia type I (SCAI), however, an ataxin cDNA containing a large triplet expansion, expressed under the influence of a Purkinje cell specific promoter led to a phenotype consistent with SCAI with a delayed onset of ataxia at 4 months of age (9 ). Interestingly, however, no mutant protein was detected in cerebellar lysates from these SCAI mice. This may be due to the fact that Purkinje cells constitute only a small proportion of cells in the cerebellum and therefore, the gene product may be present at undetectable levels. Alternatively, the failure to detect protein may reflect the loss of neurons expressing the transgene. It is also possible that the mutant protein is not produced or is rapidly degraded. This raises the question as to whether the protein is essential to the pathogenesis of this and other neurodegenerative disorders caused by expansion of a triplet repeat. In other words, is it possible that these diseases are mediated at the nucleic acid level?
Dynamic mutations could produce their effects at the RNA level. Wang et al. (10 ) recently provided evidence that a dominant negative RNA mutation may play a part in the pathogenesis of myotonic dystrophy (DM). The mutation, a CUG expansion in the 3' UTR of the DM kinase gene (11 ), alters the accumulation of DM kinase poly(A)+ RNA in trans, with a dramatic decrease of both the normal and mutant DM kinase mRNAs. This specific alteration in RNA may be a significant factor in the development of the DM clinical phenotype.
In contrast, in fragile X syndrome inherited as an X-linked recessive trait, the mutation does mediate its effects at the DNA level. The fragile X mutation is an expansion of a CGG repeat in the 5' untranslated region of the FMRI gene (12 ), which is associated with hypermethylation of the region and a concomitant decrease in transcription (13 ).
In order to gain further insight into the pathogenesis of HD and particularly the role of CAG expansion in the development of HD, we have created transgenic mice with the full length human HD cDNA (10.3 kb) containing 44 CAG repeats including the 5' and 3' UTRs. The transgenic mice were shown to express RNA by both Northern blot and RT-PCR analysis, but no protein was expressed. Morphometric assessment showed no difference from controls up to 9 months of age. This suggests that HD is unlikely to be mediated at the DNA or RNA level but rather that translation of the CAG triplet into a polyglutamine tract is essential for the pathogenesis of HD.
Furthermore, these mice provided the opportunity to explore factors influencing stability of the CAG repeat. The marked intergenerational stability of the CAG in the context of the cDNA without surrounding IT15 genomic sequences, raises the possibility that CAG size alone is insufficient to mediate instability and that other genomic sequences are important influences on repeat instability.
Human frontal cortex cDNA libraries were screened using previously identified cDNAs (cD70-2, cD149) (14 ) from the human HD gene. A series of overlapping cDNA clones representing the entire HD cDNA was identified. Each of these cDNAs was sequenced in their entirety and found to contain open reading frames for the HD gene. These cDNAs were sequentially ligated to one another from the 5' to the 3' end resulting in the full-length construct (10 366 bp) containing both 316 bp of 5' untranslated sequence and 619 bp of 3' UTR (Fig. 1 ).
pCMV8M-44 was linearized with PvuI, purified by electroelution and injected into one cell stage mouse embryos. Screening for founders by CAG PCR assessment was performed at about 2 weeks of age using tail DNA. Six founders were identified which contained the CAG trinucleotide repeat in the expanded form (CAG = 44). The integrity of these transgenes was assessed using Southern blot analysis (Fig. 2 ), by probing with cDNAs extending across the entire HD cDNA. Using a series of restriction endonucleases, all six founders were shown to contain the HD cDNA intact with no rearrangements. Southern blot analysis using `single-cutter' restriction endonucleases produced fragment sizes of unit length indicating that the transgenes were integrated in tandem. Comparison with genomic DNA revealed that the copy number of the integrated transgenes varied between one and 12 copies per genome (Table 1 ).
Northern blot analysis was performed with probe cD70-2 (corresponding to nucleotides 1037-3840 of IT15 cDNA), using RNA from brains of one offspring for each of the six founders. Two of the six founders, 213-1 and 214-3, were found to express high levels of IT15 mRNA derived from the integrated transgene (Fig. 3 A). This was confirmed by RT-PCR using primers HD1536 and HD1835 where founder 214-3 showed approximately six times more RNA expression than founder 213-1 (Fig. 3 B). This showed a correlation with copy number as 214-3 has HD cDNA copy number seven times that of 213-1. To exclude the possibility of genomic DNA contamination, primers were chosen that span several exons. Furthermore, no RT-PCR products were detected in any of the mice in the absence of RT indicating that the PCR products were generated from the reverse transcribed RNA only.
Western blotting was performed on those mouse brains expressing IT15 transcripts. AP-78, an antibody directed against the N-terminus and AP81, a human specific antibody directed against amino acids 650-663, detected mouse endogenous protein but failed to detect any human protein in the transgenic mouse brains (Fig. 4 ).
To assess further whether the failure to detect expression of the HD protein was due to the 5' UTR we produced another full length construct (pYPG10366-44) without 5' UTR sequences and devoid of any frameshift mutation. This construct was then expressed in an embryonic stem cell line completely deficient for HD protein expression due to disruption of both HD alleles (15 and unpublished data). This currently represents the only cell line available that does not express the HD protein and therefore allows unambiguous in vitro assessment of expression of the full-length construct. Untransfected HD-/HD- ES cells do not produce any HD protein, while the HD+/HD+ and HD+/HD- cells (Fig. 7 ) showed expression of the HD protein using antibody AP78. Transfected HD-/HD- cells showed clear expression of the full-length HD cDNA which also showed abberant migration due to the presence of 44 CAG repeats.
From the initial six founders, 30 offspring were found to contain CAG trinucleotide expansion. In all cases CAG repeat lengths were completely stable from one generation to the next. There were 35 offspring with the expanded CAG repeat in the F2 generation. In 34 of 35 the repeat was transmitted stably; however, in one there was an increase in trinucleotide repeat size by one triplet. Further transgenic mice were created by injecting a pGEM construct containing 32 CAG repeats only (excluding other HD cDNA sequences). Similarly, in these mice there was remarkable intergenerational stability in 32 transmissions without any change in CAG size from one generation to the next. Approximately half of the transmissions were derived from paternal or maternal transmissions. Therefore, in a total of 97 meioses examined, only one (1.03%) showed any evidence of intergenerational instability.
Brains of three wild-type control and three transgenic mice containing the full length cDNA with 44 CAG repeats were examined as described previously (15 ) (one control and one transgenic mouse at 6 months and two similar pairs of mice at 9 months of age, respectively). Detailed morphometric analysis performed on serial Nissl sections to determine individual volumes as well as cell density of the caudate/putamen, globus pallidus and subthalamic nucleus revealed no significant differences between the transgenic and control mice at either time period (Table 2 ). There was no evidence of necrosis or gliosis in the caudate/putamen, globus pallidus or subthalamic nucleus. In addition, the neuron to glial ratio as well as the neuronal density was also within normal limits for both transgenic and control mice in all three areas of the basal ganglia.
At 6, 9 months and 1 year of age, there was no obvious difference in behavior between the transgenic mice and control mice. Mice carrying the transgene with 44 CAG repeats ate and drank normally and were similar to controls with regard to locomotion, posture, rearing and body weight. There was no evidence of ataxia in any of the mice.
We have created HD transgenic mice containing the full length HD cDNA, including the 5' UTR. The transgenes have integrated intact and are expressing RNA but no protein in brain tissues. By 9 months of age, no changes in brain structure were evident and by 1 year, these mice have no behavioral abnormalities.
In disorders associated with trinucleotide repeat expansion it is not known how repeat expansion causes neuronal damage (16 ) and whether this could be mediated at the nucleic acid level (9 ). The availability of a transgenic animal with a highly expressed transcript containing CAG repeats but with no protein expression, serendipitously allowed us to assess whether translation of the CAG trinucleotide repeat into a polyglutamine stretch is essential for the development of the phenotype. The absence of a neurological phenotype suggests that translation of the CAG repeat into a polyglutamine stretch may be crucial for the development of this disorder.
Morphometric variables of brains of transgenic mice (2) and controls (2) at 9 months of age
Control (n = 2)
Transgenics (n = 2)
P value
Caudate putamen
Volume (mm3)
10.227 ± 0.232
10.076 ± 0.815
ns
Nv neurons
124 702 ± 5584
133 239 ± 27 194
ns
Total neurons
1 227 778 ±29 212
1 252 256 ± 37 617
ns
Neuron profiles (µm2)
110.23 ± 2.64
108.62 ± 2.59
ns
Globus pallidus
Volume (mm3)
1.101575 ± 0.015875
1.206332 ± 0.054168
ns
Nv neurons
31 899 ± 2726
26 371 ± 4321
ns
Total neurons
35 026 ± 2796
32 184 ± 2269
ns
Neuron profiles (µm2)
248.83 ± 4.60
232.79 ± 3.61
ns
Subthalamic nucleus
Volume (mm3)
0.152116 ± 0.004548
0.147239 ± 0.006845
ns
Nv neurons
154 782 ± 2291
144 916 ± 13 366
ns
Total neurons
24 382 ± 456
22 885 ± 2735
ns
Neuron profiles (µm2)
141.43 ± 8.33
128.23 ± 14.14
ns
Substantia nigra
Volume (mm3), PR
0.619272 ± 0.017733
0.688505 ± 0.027132
ns
Volume (mm3), PC
0.097338 ± 0.013740
0.223590 ± 0.011379
ns
Volume, SN total
0.816610 ± 0.026403
0.912095 ± 0.036866
ns
Body weight (g)
43.65 ± 0.45
34.60 ± 7.30
ns
Brain weight (mg)
480.0 ± 20.0
485.0 ± 15.0
ns
aValues are given as the mean ± standard error of the mean
It could, however, be argued that the mouse is not an appropriate species for the development of an animal model for HD. However, this is unlikely, as a closely related disorder, SCAI, has been successfully reproduced in the mouse (9 ). In addition, as HD is a late-onset disorder (2 ) it could also be argued that these mice are still too young to have developed the disorder. Currently, these mice are more than 1 year old and clinically normal, which is equivalent to a middle-aged human adult by which time clinical features of HD might have been expected.
One possible reason for the absence of the HD protein was the inclusion of 120 bp of 5' UTR. When these sequences are removed from the wild-type constructs, high levels of protein expression can be obtained in vitro, suggesting that DNA sequences which inhibit expression may be found within the first 120 bp of the 5' UTR. We did not directly assess a construct with the stop codon lacking the 5' UTR and therefore cannot exclude the possibility that a truncated protein is produced in the presence of 5' UTR sequences, which is rapidly degraded and thus not detected. However, in view of the fact that we have in different experiments expressed protein products of shorter length which were stable (data not shown) we favor the influence of the 5' UTR influencing expression in vitro. In support of this, we have recently compared the genomic organization of the 5' end of the HD gene between mouse and human and found that there is a highly conserved region 5' to the ATG start site from -56 to -206 (17 ).
Interestingly, by Western blot analysis of the HD protein it is possible to differentiate the normal from the mutant protein as the mutant protein migrated more slowly than the wild-type HD protein (18 -20 ). This phenomenon has also been observed in SCAI (21 ) and SBMA (8 ). The extent of the slower migration appears to be in proportion to the length of polyglutamine tract present in the protein (21 ). Here we show directly that the slower migration can be attributed to the polyglutamine stretch. Possibly, the additional polyglutamines induce conformational changes in the protein which may result in altered mobility of the HD protein.
Previously identified cDNAs from the HD gene cD70-2 (nucleotide 1037-3840) and cD149 (nucleotide 4050-7700) were used to screen human frontal cortex cDNA libraries. All cDNAs derived were cloned in Bluescript. The IT15 cDNA was built sequentially in Bluescript from the 5' to the 3' end. A PCR product from 1 to 314 of the published sequence (4 ) was ligated on to cPG2M (314-1594) containing 21 CAG repeats. A NotI site was engineered into the 5' oligonucleotide to allow easy subsequent manipulations of the full length construct as there already was a NotI site at the 3' end. An RT-PCR product spanning the CAG repeat region was generated using a patient's RNA containing 44 CAG repeats. RT-PCR was performed as detailed below except using primer HD995r (5' TCTTCGGGTCTCTTGCTTGTTC 3') for the reverse transcription and primers HD830r (5' AGCTCGAGCTGTAAC CTTGG 3') and HD197 (5' GGCC GCTC AG GTTCTGCTT 3') for the PCR. This PCR product was then cloned into the construct using unique NcoI and HD3 sites to generate the cPG3M-44 construct. Next a 2663 bp cD70-2 fragment from SspI site at 1177 to the polylinker was ligated in a three-part reaction to yield cPG5M-44. An NsiI/EcoRI 1.8 kb cDNA fragment was subsequently added resulting in cPG6M-44 which extends up to 4868. A partial EcoRI/SmaI 2120 bp fragment was ligated to cPG6M-44 to produce cPG7M-44. Finally, a 4023 bp fragment extending from SalI (6343) to the polylinker EcoRV site of HD12 (6202-10366) was added to yield cPG8M-44, the full length IT15 cDNA of 10366 bp including the first 316 bp of 5' untranslated sequence according to the published sequence (4 ). The entire 10366 kb cPG8M-44 insert was subcloned into pCMV using NotI to generate pCMV8M-44.
pCMV8M-44 was linearized using PvuI and microinjected into fertilized oocytes which were implanted into pseudopregnant mice. Tail DNA was extracted from each of the offspring according to standard procedures. PCR across the CAG repeat was performed on the tail DNA to screen for founders using the methods previously described by our group (6 ,25 ). Six founders were identified and subjected to further analyses by Southern blotting using standard procedures with probes cD70-2 and HD12 to confirm the integration status of the cDNA.
Brain tissues were disrupted by Polytron homogenizer in guanidinium isothiocyanate. Total RNA was isolated by CsCl cushion centrifugation (26 ). RNA was fractionated on formaldehyde 0.6 M agarose gel and transferred to Hybond-N membrane according to standard procedures. RNA was UV crosslinked and hybridized to 32P-radiolabelled cD70-2. Blots were washed to 0.2* SSPE and subjected to autoradiography.
RT-PCR was performed on brain RNA extracted as above. Five µg of RNA was reverse transcribed using primer HD1835 (5'AGTGTGTGCTGTGACCGTGG 3' located on the sense strand in the opposite direction to transcription, starting at 1835). PCR was performed under the following conditions: 1 mM MgCl2, 50 mM KCl, 20 mM Tris pH 8.4, 200 µM of each dNTP, 0.5 µM of primers HD1835 and HD1536 (5' CGCTGCTAAGGAGGAGTCTG 3') and 0.5 U Taq DNA polymerase. Cycling parameters were 95oC for 1 min, followed by 30 cycles of 94oC for 1 min, 63oC for 45 s and 72oC for 45 s ending with an extension at 72oC for 10 min. PCR products were detected by ethidium bromide agarose gel electrophoresis. Semiquantitative analysis was performed as above, except that HD1536 was radiolabelled, the PCR was stopped after 20 cycles (which we had previously shown to be on the exponential part of the PCR) and detection was by autoradiography.
Cells were seeded the day before lipofection at 70-80% confluency in 35 mm dishes. Five hundred to 2000 ng of construct DNA was mixed with 100 µl of optimemTM.Complexes were allowed to form by mixing a solution containing 100 µl of optimemTM and 6 µl of lipofectamineTM with the DNA solution. After 30 min 800 µl of optimemTM was added to the complexes and this was layered slowly on to the prewashed cells. After 5 h 1 ml of growth media containing 20% fetal calf serum was added. The next day the media was removed and replaced with DMEM growth media. Cells were harvested 2 days later. A control pCMV[beta]GAL plasmid was used to estimate transfection efficiency by staining with XGAL.
The ES cell lines were grown in DMEM supplemented with 15% fetal calm serum (Hyclone), 0.1 mM non-essential amino acids, 1 mM sodium pyruvate, 100 mL L-glutamine, 0.1 mM [beta]-mercaptoethanol and 100 U/ml leukemia inhibitory factor (Esgrow, Gibco/BRL) on 0.1% gelatinized tissue culture dishes. 1×107 ES cells were electroporated with 30 µg of linearized plasmid DNA (pYPG10366-44) using a Bio Rad Gene Pulser (500 µF and 240 V) and grown for 48 h on gelatinized tissue culture dishes as described above. Subsequently, cells were trypsinized, washed twice with PBS and cell pellets were resuspended for Western blot analysis.
Western blotting was performed according to the method of Sharp et al. (19 ). Briefly, 150 µg of protein (homogenate) was fractionated on 3-12% gradient SDS-PAGE, transferred to nitrocellulose at 50 V for 3 h using Tobin buffer system. The blots were blocked in 5% milk/PBS for 1 h at room temperature and then incubated with the primary antibody (AP78 or AP81) at 4oC overnight. Blots were subsequently washed in 5% milk/PBS for 15 min then three times for 5 min. The blots were incubated with secondary antibody, goat antirabbit IgG coupled to HR-peroxidase for 1 h at room temperature. After washing in 5% milk/PBS detection was performed using chemiluminescence (Amersham).
Coupled in vitro transcription/translation was performed using the Promega TnT transcription/translation kit according to the manufacturer's protocol. One µg of CsCl purified HD construct was translated at 30oC for 1 h. Protein products were detected by fractionation on 7.5% SDS-PAGE followed by fixing in 40% methanol/10% acetic acid for 30 min and fluorography using AmplifyTM (Amersham).
Brains from a transgenic and wild-type control were examined at 6 and 9 months of age. Mice were anesthetized and brains were prepared as described previously (15 ). All histological sections were coded to prevent experimenter bias. Individual volumes of the caudate/putamen, globus pallidus and subthalamic nucleus were measured on serial Nissl sections as described previously (15 ).
PCR across the CAG repeat was performed on tail DNA. Samples were fractionated on urea-PAGE gel electrophoresis and detected by autoradiography as previously described (6 ,25 ). In order to detect single triplet changes, samples were fractionated adjacent to the parental PCR products.
A 1544 bp NcoI fragment (from 2184 to 3728) was purified from cPG8M-44 using Geneclean (Bio101). This fragment was ligated into the NcoI site of the yeast two-hybrid vector pAS1 maintaining an appropriate open reading frame with the GAL4 DNA binding-domain and the HD gene. An anti-hemagglutinin (HA) monoclonal antibody directed against an HA tag, located immediately 5' of the pAS1 multiple cloning site, was used to detect the Gal4 binding domain-HD fusion protein from yeast cell extracts. The expected molecular weight of the fusion protein is 73 kDa (59 kDa HD plus 14 kDa for the Gal4 DNA-binding domain). However, immunodetection of the yeast extracts using ECL (Amersham) revealed a fusion protein of only approximately 22 kDa (8 kDa for HD plus 14 kDa for the Ga14 DNA-binding domain) and not the expected 73 kDa. Upon further sequence analysis of both the NcoI-cD70-2-pAS1 and cPG8M-45 clones, a single nucleotide (T) deletion was detected at the nucleotide corresponding to 2349 of the HD published sequence. This T deletion results in a frameshift mutation and subsequently a stop codon (TAA) occurring 18 codons (54 nucleotides) downstream of the T deletion. Resequencing of the parent clone cD70-2 revealed that the T deletion was not present. This deletion, however, was found in cPG5M-44 indicating that it probably occurred during the addition of the cD70-2 fragment.
We thank Dr H. Telenius and Dr D. Gietz for their technical assistance and advice and Dr M. McDonald for her kind gift of IT16C (2M). This work was supported by the Medical Research Council of Canada and the Canadian Genetic Disease Network. FJ is a recipient of a Canadian Arthritis Society award. MRH is an established investigator of the BC Childrens Hospital.
3 Goldberg,Y.P., Telenius,H. and Hayden,M.R. (1994) The molecular genetics of Huntington disease. Curr. Opin.Neurol., 7, 325-332.
4 Huntington's Disease Collaborative Research Group (1993) A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell, 72, 971-983.
5 Lin,B., Rommens,J.M., Graham,R.K., Kalchman,M.A., McDonald,H., Nasir,J., Delaney,A., Goldberg,Y.P. and Hayden,M.R. (1993) Differential 3' polyadenylation of the Huntington disease gene results in two mRNA species with variable tissue expression. Hum. Mol. Genet., 2, 1541-1545.MEDLINE Abstract
6 Kremer,H.P.H., Goldberg,Y.P. Andrew,S.E., Theilmann,J., Telenius,H., Squitieri,F., Zeisler,J., Lin,B., Bassett,A., Almqvist,E. et al. (1994) Worldwide study of the Huntington's disease mutation: the sensitivity and specificity of repeated CAG sequences. N. Engl. J. Med., 330, 1401-1406.
7 Jou,Y-S. and Myers,R.M. (1995) Evidence from antibody studies that the CAG repeat in the Huntington disease gene is expressed in the protein. Hum. Mol. Genet., 4, 465-469.MEDLINE Abstract
8 Bingham,P.M., Scott,M.O., Wang,S., McPhaul,M.J. Wilson,E.M., Garbern,J.Y., Merry,D.E. and Fischbeck,K.H. (1995) Stability of an expanded trinucleotide repeat in the androgen receptor gene in transgenic mice. Nature Genet., 9, 191-196.MEDLINE Abstract
9 Burright,E.N., Clark,H.B., Servadio,A., Matilla,T., Feddersen,R.M., Yunis,W.S., Duvick,L.A., Zoghbi,H.Y., Orr,H.T. (1995) SCA1 transgenic mice: a model for neurodegeneration caused by CAG trinucleotide expansion. Cell, 82,937-948.MEDLINE Abstract
10 Wang,J., Pegoraro,E., Menegazzo,E., Gennarelli,M., Hoop,R.C., Angelini,C. and Hoffman,E.P. (1995) Myotonic dystrophy: evidence for a possible dominant-negative RNA mutation. Hum. Mol. Genet., 4, 599-606.MEDLINE Abstract
11 Mahadevan,M., Tsilfidis,C., Sabourin,L., Shutler,G., Amemiya,C., Jansen,G., Neville,C., Narang,M., Barcelo,J., O'Hoy,K. et al. (1992) Myotonic dystropy mutation: an unstable CTG repeat in the 3' untranslated region of a candidate gene. Science, 255, 1253-1255.MEDLINE Abstract
12 Kremer,E.J., Pritchard,M., Lynch,M., Yu,S., Holman,K., Baker,E., Warren,S.T., Schlessinger,D., Sutherland,G.R. and Richard,R.I. (1991) Mapping of DNA instability at the fragile X to a trinucleotide repeat sequence p(CCG)n. Science, 252, 1711-1714.MEDLINE Abstract
13 Hansen,R.S., Canfield,T.K., Lamb,M.M., Gartier,S.M. and Laird,C.D. (1993) Association of fragile X syndrome with delayed replication of the FMR1 gene. Cell, 73, 1403-1409.MEDLINE Abstract
14 Rommens,J.M., Lin,B., Hutchinson,G.B. Andrew,S.E., Goldberg,Y.P., Glaves,M.L., Graham,R., Lai,V., McArthur,J., Nasir,J., Theilmann,J., McDonald,H., Kalchman,M., Clarke,L.A., Schappert,K. and Hayden,M.R. (1993) A transcription map of the region containing the Huntington disease gene. Hum. Mol. Genet., 2, 901-907.MEDLINE Abstract
15 Nasir,J., Floresco,S.B., O'Kusky,J.R., Diewert,V.M., Richman,J.M., Zeisler,J., Borowski,A., Marth,J.D., Phillips,A.G. and Hayden,M.R. (1995) Targeted disruption of the Huntington disease gene results in embryonic lethality and behavioral and morphological changes in heterozygotes. Cell, 81, 811-823.MEDLINE Abstract
16 Housman,D. (1995) Gain of glutamines, gain of function? Nature Genet., 10, 3-4.MEDLINE Abstract
17 Lin,B., Nasir,J., Kalchman,M.A., McDonald,H., Zeisler,J., Goldberg,Y.P. and Hayden,M.R. (1995) Structural analysis of the 5' region of mouse and human Huntington disease genes reveals conservation of putative promoter region and di- and trinucleotide polymorphisms. Genomics, 25, 707-715.MEDLINE Abstract
18 Trottier,Y., Devys,D., Imbert,G., Saudou,F., An,I., Lutz,Y., Weber,C., Agid,Y. Hirsch,E.C. and Mandel,J.L. (1995) Cellular localization of the Huntington's disease protein and discrimination of the normal and mutated form. Nature Genet., 10, 104-110.MEDLINE Abstract
20 Schilling,G., Sharp,A.H., Loev,S.J., Wagster,M.V., Li,S-H., Stine,O.C., Ross,C.A. (1995) Expression of the HD gene (IT15) protein product in HD patients. Hum. Mol. Genet., 4, 1365-1371.MEDLINE Abstract
21 Servadio,A., Koshy,B., Armstrong,D., Antalffy,B., Orr,H.T. and Zoghbi,H.Y. (1995) Expression analysis of the ataxin-1 protein in tissues from normal and spinocerebellar ataxia type 1 individuals. Nature Genet., 10, 94-98.MEDLINE Abstract
22 Goldberg,Y.P., Kremer,B. Andrew,S.E., Theilmann,J., Graham,R.K., Squitieri,F., Telenius,H., Adam,S., Sajoo,A., Starr,E. et al. (1994) Molecular analysis of new mutations causing Huntington disease: intermediate alleles and sex of origin effects. Nature Genet., 5, 174-179.
23 Goldberg,Y.P., McMurray,C.T., Zeisler,J., Almqvist,E., Sillence,D., Richards,F., Gacy,A.M., Buchanan,J., Telenius,H. and Hayden,M.R. (1995) Increased instability of intermediate alleles in families with sporadic Huntington disease compared to similar sized intermediate alleles in the general population. Hum. Mol. Genet., 4, 1911-1918.MEDLINE Abstract
24 Kremer,B., Theilmann,J., Almqvist,E., Spence,N., Telenius,H., Goldberg,Y.P. and Hayden,M.R. (1995) Sex dependent mechanisms for expansion and contractions of the CAG repeat on affected Huntington disease chromosomes. Am. J. Hum. Genet., 57, 1-8.
25 Andrew,S.E., Goldberg,Y.P., Theilmann,J., Zeisler,J. and Hayden,M.R. (1994) A CCG repeat polymorphism adjacent to the CAG repeat in the Huntington disease gene: implications for diagnostic accuracy and predictive testing. Hum. Mol. Genet., 3, 65-69.MEDLINE Abstract
26 Maniatis,T., Fritsch,E.F. and Sambrook,J. (1982) Molecular Cloning: A Laboratory Manual. 2nd edition. Cold Spring Harbor.
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Thu Oct 31 15:21:55 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
