FRA3B extends over a broad region and contains a spontaneous HPV16 integration site: direct evidence for the coincidence of viral integration sites and fragile sites
FRA3B extends over a broad region and contains a spontaneous HPV16 integration site: direct evidence for the coincidence of viral integration sites and fragile sitesCharles M. Wilke*, Bryan K. Hall, Ann Hoge, William Paradee1, David I. Smith1 and Thomas W. Glover
Department of Pediatrics and Department of Human Genetics, University of Michigan, 2818 MS II 0618, Ann Arbor, MI 48109, USA and 1Departments of Molecular Biology, Genetics and Internal Medicine, Wayne State University School of Medicine, 540 East Canfield, Detroit, MI 48201, USA
Received August 22, 1995;Revised and Accepted November 8, 1995
The common fragile site at 3p14.2 (FRA3B) is the most sensitive site on normal human chromosomes for the formation of gaps and breaks when DNA replication is perturbed by aphidicolin or folate stress. Although rare fragile sites are known to arise through the expansion of CCG repeats, the mechanism responsible for common fragile sites is unknown. Beyond being a basic component of chromosome structure, no biological effects of common fragile sites have been convincingly shown, although suggestions have been made that breakage and recombination at these sites may sometimes be mechanistically involved in deletions observed in many tumors and in constitutional deletions. In an observation related to the high rate of recombination at fragile sites, a number of studies have shown a statistical association between the integration of transforming DNA viruses and chromosomal fragile sites. Using FISH analysis we recently identified a 1.3 Mb YAC spanning both FRA3B and the t(3;8) translocation associated with hereditary RCC. Here we report the further localization of FRA3B within this YAC. Using lambda subclones of the YAC as FISH probes, gaps and breaks were found to occur over a broad region of at least 50 kb. Neither CCG nor CAG repeats were found in this region suggesting a different mechanism for fragility than seen with rare fragile sites. We further show that an area of frequent gaps and breaks within FRA3B, defined by a lambda contig, coincides with a previously characterized site of HPV16 integration in a primary cervical carcinoma. The HPV16 integration event gave rise to a short chromosomal deletion limited to the local FRA3B region within 3p14.2. Interestingly, 3p14.2 lies within the smallest commonly deleted region of 3p in cervical cancers, which are often HPV16 associated. To our knowledge this is the first molecular characterization of an in vivo viral integration event within a confirmed fragile site region, supporting previous cytogenetic observations linking viral integration sites and fragile sites.
Chromosomal fragile sites are loci which show gaps or breaks on metaphase spreads of cells that have been grown in the presence of inhibitors of DNA replication (1 ). Following induction, these sites show increased sister chromatid exchange (2 ,3 ), a high rate of translocation and deletion in somatic cell hybrid systems (4 -6 ) and an increased rate of recombination with pSV2neo DNA artificially introduced into cells (7 ). It has also been suggested that fragile sites may play a mechanistic role in chromosome breakage and rearrangements involved in cancer (8 ,9 ).
The sequences of five `rare' fragile sites have been cloned and characterized and in all cases the mutation leading to the expression of fragility is the expansion of a CCG trinucleotide repeat (10 -14 ). The rare fragile site mutations therefore represent a subclass of the recently discovered repeat expansion mutations involved in a number of human diseases. In the case of rare fragile sites, the molecular instability observed at the nucleotide level is translated through an apparent change in chromatin structure to a higher-order instability observed at the level of the chromosome. This change in chromatin structure can give rise to disease by modifying the expression of neighboring genes, as in the case of FMR1 (15 ), or by mediating chromosome deletion as is suggested in the 11q- (Jacobsen) syndrome (14 ).
Common fragile sites, on the other hand, have not been convincingly implicated in disease processes. Even though these sites make up the vast majority of fragile sites, little is known about their structure or biological role. While the rare fragile sites arise via expansion of normally occurring CCG repeats and represent aberrations in nucleotide and chromatin structure, the large number of common fragile sites are a constant feature of the genome. This constancy of common fragile sites suggests that their overall nucleotide and/or chromatin structure is also unvarying and implies a conservation of function. Fragile sites in general are thought to represent genomic regions that replicate late in S phase of the cell cycle (16 ) and this has been demonstrated in the case of the FRAXA locus (17 ). Common fragile sites are induced by agents that perturb DNA replication. Therefore a greater understanding of common fragile sites may lead to a greater understanding of the basic processes of DNA replication and repair and how these may relate to chromatin structure.
A number of cytogenetic studies have demonstrated an association between common chromosomal fragile sites and the sites of integration of human papillomaviruses (18 -20 ). Recently, human papillomavirus infection has been confirmed to be the causative transforming factor in over 90% of cervical cancers worldwide (21 ). A key step in the progression of benign cervical tumors to invasive carcinomas is the integration of the normal episomally-replicating HPV DNA into the cellular genome. It is therefore possible that common fragile sites could play an important role in the progression of cervical and other cancers, by providing targets for viral integration. However, the actual importance of common fragile sites in facilitating tumor progression through this process has not been established.
Using FISH analysis we recently identified a 1.3 Mb YAC spanning both the t(3;8) translocation associated with hereditary renal cell carcinoma (hRCC) and the common fragile site FRA3B (22 ,23 ). Here we report the further localization of FRA3B to a broad region within this YAC and show that a region of frequent breakage within FRA3B coincides with a previously characterized site of HPV16 integration in a primary cervical carcinoma (24 ). Furthermore, we show that the HPV16 integration event gave rise to a short chromosomal deletion limited to the local FRA3B region within 3p14.2. Interestingly, 3p14.2 lies within the smallest commonly deleted region of 3p LOH in cervical cancers (25 ). To our knowledge this is the first molecular characterization of an in vivo viral integration event within a confirmed fragile site region, supporting previous cytogenetic observations linking viral integration sites and fragile sites.
In our previous experiments, we used FISH analysis on metaphase spreads expressing the common fragile site, FRA3B to determine that YAC850A6 spanned this fragile site (23 ). Here we extended this approach to sublocalize FRA3B within YAC850A6. In this case, lambda subclones of the YAC were used as FISH probes against aphidicolin treated metaphase spreads to determine the relative positions of the probes to the fragile site.
First, YAC850A6 was subcloned into Lambda FIXII (Stratagene, La Jolla, CA). Hybridization of random lambda subclones to pulsed field blots of MluI digested YAC DNA was then used to determine the general position of several anchor subclones within YAC850A6. DNA from these subclones was then hybridized to the gridded library to extend small contigs. This 1.3 mb YAC is cleaved five times by MluI. Several lambda subclones were positioned within the two most telomeric MluI fragments, D and A (Fig. 1 ). The initial FISH experiments with three lambda clones from these two regions (L48, L98 and L72) indicated that the general position of FRA3B, as defined by gaps or breaks on aphidicolin treated spreads, is within the MluI D and A regions. The position of the FISH signals from lambda 48, which spans the MluI site dividing fragments F from D, was nearly always proximal to the fragile site gaps. Lambda 72, located in fragment A, generally hybridized distal to the breakage. While lambda 98 was more frequently proximal, but also crossed giving FISH signals on both sides and sometimes hybridized distal to the fragile site.
By using a FISH mapping approach with available probes we have successfully localized FRA3B to a fairly broad region of YAC850A6. The findings that the fragility of FRA3B extends over a large region and does not involve the expansion of CCG trinucleotide repeats underscores the basic differences between common fragile sites and rare heritable fragile sites. The molecular mechanisms responsible for these two types of fragile sites are likely to be distinct and this is not surprising considering the differences in both the frequencies with which they occur in populations and in the methods used in their induction. Contemporary with our studies, Rassool et al. (7; F. V. Rassool, M. M. Le Beau M-L. Shen, M. E. Neilly, S. T. Ong, F. Boldog, H. Drabkin and T. W. McKeithan, in preparation) used a direct cloning strategy, based on integration of transfected pSV2neo DNA into the FRA3B region, to isolate sequences from FRA3B. They too have defined the same general region of YAC850A as containing the fragile site. Furthermore, the detailed mapping of aphidicolin-induced breakpoints in chromosome 3 containing hamster-human hybrids has revealed a distribution of breaks in 3p14.2 that encompasses this same region (6 ) (W. Paradee, C. M. Wilke, T. W. Glover and D. I. Smith, in preparation). Although the molecular basis for chromosome fragility is not yet apparent from simple sequence analysis of the clones characterized so far, the mapping of the region will allow for further studies into the mechanisms underlying common fragile site expression.
It is significant that the region we have defined as FRA3B coincides with the integration site of a human papillomavirus in a primary cervical carcinoma. The existence and position of common fragile sites have been defined through the use of stress inducing agents in an artificial cell culture environment. Their identification in this way does not point to biological significance. However, our positioning of FRA3B by in vitro methods and the subsequent finding of an in vivo generated HPV16 integration site within the region provides the first direct evidence that common fragile sites, as they have been defined, have biological relevance. These direct molecular data support the earlier statistical association of these two entities observed at a cytogenetic level.
Common chromosomal fragile sites are present in all individuals and therefore can be assumed to constitute a macromolecular manifestation of some conserved feature of chromatin structure or DNA replication and repair, or perhaps gene expression. Two characteristics of fragile sites that may be relevant to viral integration are that most occur in G-light bands, leading to suggestions that they may be associated with active gene regions (8 ,36 ) and that they are thought to be late replicating regions (16 ). That they are late replicating has recently been verified for FRAXA, the only fragile site in which the time of replication has been characterized (17 ). Several studies point to a possible mechanistic connection between the integration of DNA viruses and these two characteristics of fragile sites.
Caporossi et al. (37 ) observed that adenovirus type 5 infection and aphidicolin treatment, both of which when used alone induce common fragile sites, have a synergistic effect on the production of fragile sites when used together. Aphidicolin is an inhibitor of both DNA polymerase [alpha] and [delta] (38 ) and may induce fragile sites by further delaying DNA replication in regions that are already late replicating or slow to replicate. This synergism with aphidicolin and virus suggests that the fragile sites induced by the two different agents are the same and that the viral induction of fragile sites also involves delay in DNA replication. In another study (39 ), it was found that the latest replicating G-negative bands were selectively targeted by HPV16 in virus-immortalized human keratinocyte cell lines. Finally, Smith et al. (40 ), directly demonstrated that an HPV18 integration spanned a gap like a fragile site in a cell line infected in vitro. These in vitro studies have suggested a direct association between DNA tumor virus integration and fragile sites, or portions of the genome showing characteristics of fragile sites and support previous FISH studies correlating HPV integration sites in tumors or tumor cell lines with chromosomal bands known to contain fragile sites and protooncogenes (19 ,41 ). This type of data also suggests that the viral infection may play some direct role in the induction of fragile sites and the eventual site of viral integration (37 ).
Most DNA tumor viruses encode proteins that inhibit p53 or pRb or both. The initial infection therefore results in a relaxation of normal cell cycle controls on DNA replication and repair, establishing a favorable cellular environment for the occurrence and fixation of the multiple mutations seen in tumor progression, including increased DNA instability. Double-stranded transforming DNA viruses normally replicate extrachromosomally and only rarely integrate into the host genome. Because integration of these viruses is not a normal part of their replication cycle, it is likely that the integration events themselves are passive and signal a change in DNA metabolism to a more recombinogenic state. However, if the integration of the virus results in a selective growth advantage to the cell, then these will be the events observed in cancers and may point to regions important to tumor progression. In this way, the initial viral infection can be viewed as the first step in this series of events leading to its own integration and the integration itself is an important later step in the evolution of the cancer. Such a view is not novel and has been proposed previously (19 ,42 ,43 ).
Consistent with this selection perspective, is the actual small number of different chromosomal locations containing HPV16 or 18 integrations that have been characterized in primary cervical tumors or cervical cancer cell lines and the number of times that several of these locations have been repeatedly targeted in these tissues. In a summary of these integration sites Lazo et al. (42 and references therein) found that the 8q24 region, which contains both a fragile site and the c-myc gene, was targeted five of 15 times and the 2p24 region containing the N-myc gene was also targeted once. The 12q13 region, rearrangements of which are associated with a number of cancers was also found to be multiply targeted. By extension these authors argue that other sites found to contain HPV16/18 integrations are likely to indicate the position of tumorogenic genes.
Several studies have implicated the 3p14 region in the development of cancer (44 ). In one study (45 ) loss of heterozygosity of 3p14 was found in 90% of cervical cancers and in several others (25 ,46 ) the most commonly deleted region of 3p in cervical cancer was between 3p13 and 3p21.1. The transfection of a malignant renal cell carcinoma cell line with the 3p12-3p14 region was shown to suppress tumor growth in nude mice (47 ). Also, both loss of heterozygosity (48 ) and amplification (49 ) of 3p14 have been observed in breast tumors. Interestingly, Wagatsuma et al. (24 ) found that H705 sequences represented the only HPV16 integration in their primary cervical tumor and that the viral and neighboring genomic DNAs were amplified five to 10 times. Similar amplifications of HPV DNAs and the c-myc and N-myc genes, sometimes associated with increased expression of these loci, have been found in a number of cervical cancer cell lines (50 ). The coincidence of a fragile site and an HPV16 integration/deletion event within a region commonly deleted in cervical cancers suggests that, at least in some instances, viral integration events within fragile sites may play a mechanistic role in the evolution of cancers (20 ). Furthermore, it suggests that the 3p14.2 region in particular may be important in cervical carcinoma progression.
Subcloning of YAC850A6 into the Lambda FIXII vector and production of a gridded, human specific subclone library was carried out as previously described (51 ). Initially, random human lambda clones were hybridized to MluI digested YAC850A6 pulsed field gel blots to assign anchor clones to each of the MluI fragments. Also, the 850A6 MluI fragments themselves were 32P-labeled and hybridized to the grids to assign some of the lambda clones. After the initial FISH results (below) indicating the position of the fragile region, the lambda contigs were expanded by hybridizing lambda insert DNA, to the gridded phage library.
PHA-stimulated whole blood lymphocyte cultures were grown in RPMI 1640 medium (Irvine Scientific) containing 10% fetal calf serum, 4 mM glutamine and penicillin/streptomycin (200 units/ml, 200 µg/ml). Fragile sites were induced with 0.4 µM aphidicolin (Sigma) for 26 h prior to harvesting. Harvesting was carried out conventionally and consisted of 45-60 min of colcemid treatment (0.07 µg/ml) followed by 15-20 min hypotonic treatment (0.075 M KCl) and multiple changes of fixative (3:1 methanol-acetic acid) before preparing slides.
Total lambda DNA was biotin labeled (biotin-14-dATP) using the BioNick Labeling System (BRL, Gaithersburg, MD). One hundred to 200 ng of labeled lambda DNA and 25 µg of Cot1 (BRL) were denatured at 75oC in 10 µl of 2* SSC, 10% dextran sulfate, 50% formamide, 1% tween 20 and preannealed at 37oC for at least 1 h prior to application to denatured slides. Slides were denatured at 70oC for 2 min in 70% formamide, 2* SSC, pH 7.0 and put through a standard dehydrating ethanol series. Hybridization was carried out overnight. Washes consisted of 50% formamide, 2* SSC at 42oC followed by 0.1* SSC at 60oC. Signals were visualized after incubations with two layers of FITC conjugated avidin-DCS and biotinylated goat anti-avidin IgG (Vector, Burlingame, CA), followed by counterstaining with propidium iodide alone or with both DAPI and propidium iodide. The chromosomes were viewed with either a Nikon or Zeiss Axioskop epifluorescence microscope equipped with FITC and DAPI filters. Metaphase spreads were photographed on Kodak ASA 400 or 100 Gold film. For the published picture, the color negatives were digitally scanned to a Kodak PhotoCD Master Disc using a Kodak PCD Film Scanner 2000 controlled by a Kodak PCD Imaging Workstation 2200/2400. The digital image was converted to gray scale using Adobe Photoshop software and printed on a Kodak PCD Printer 200.
Lambda 247 DNA was singly digested with NotI, EcoRI, PstI, KpnI, SalI, XbaI, HindIII and doubly cut with NotI/EcoRI and shotgun cloned into appropriately digested pUC18 or pBluescript. None of these enzymes cleave within the Lambda Fix II vector and therefore allow the cloning of only insert DNA. DNA from individual clones from each shotgun ligation was prepared using the miniprep alkaline lysis procedure (52 ), digested and run on agarose gels to identify clones of various sizes. Clones with different size inserts were subjected to automated fluorescence sequence analysis using vector sequencing primers on an ABI 373A sequencer (Pharmacia). The above approach was used in an effort to maximize the amount of sequence obtained with the least number of runs. Our goal was to acquire enough sequence information to discern interesting or important characteristics of lambda 247. Most of the sequence has been obtained on one strand only. A few gaps were filled in using specific synthetic oligosequencing primers. The sequences were assembled and analyzed using the Wisconsin Genetics Computer Group DNA-analysis programs FASTA, Lineup, Bestfit, Findpatterns, Repeats and Stemloop (29 ), as well as the BLAST (26 ) and Grail servers (27 ) and the DNASIS program G/C Content (Hitachi). The GenBank accession numbers for the 9.5 kb of sequence characterized here are U39793-U39801 and U39804.
Southern hybridization probes were 32P-labeled by the random priming technique (52 ). Five to 50 ng of probe was denatured and preanealed for 1 h in Church's phosphate buffer (53 ) in the presence of the following sheared DNAs: 10 µg/ml Cot1 DNA (BRL), 25 µg/ml human placental DNA, 100 µg/ml salmon sperm DNA and 2.5 µg/ml lambda DNA. Hybridizations were carried out at 65oC overnight in Church's phosphate buffer. The filters were then washed to a stringency of 0.1* SSC, 0.1% SDS at 65oC for 10-15 min. DNA oligomer probes were 32P-end labeled with T4-kinase (52 ), hybridized for at least 4 h at 50oC in Church's phosphate buffer and washed to a stringency of at least 2* SSC, 0.1% SDS at 50oC for 30 min and sometimes to 1* SSC, 0.1% SDS at 50oC for 30 min.
The two 20-mer PCR primers SA5mfp'(GCATGAGAGCTGAAGATCCT) and SA4mfp1 (ACAGAGATTGAGGCCA GG TG) were derived from the lambda 247 sequence and give rise to a 386 bp PCR product spanning the HPV16 integration site of Wagatsuma et al. (24 ). Template DNA amounts in 100 µl reactions were 100 ng total human DNA, 10 ng total yeast DNA containing YAC850A6 and 5 ng lambda DNA. Each 100 µl reaction contained 20 pmol (0.2 µM) of each primer, 200 µM of each dNTP, 1*PCR buffer (Amersham), 1.5 mM MgCl2 and 2.5 U Taq DNA polymerase (Amersham). The reactions were subjected to 30 cycles of 1 min denaturation at 94oC, 1 min annealing at 62oC, 2 min extension at 72oC, followed by a final extension at 72oC for 10 min. The PCR products were electrophoresed on a 2% Nusieve GTG (FMC, Rockland ME) agarose gel and then stained with ethidium bromide.
The authors thank Herman Dierick for critically reading the manuscript and helpful discussion, James L. Beals from the UM Biomedical Communications for help in preparing the figures and F. V. Rassool et al. for sharing unpublished data. We are especially grateful to Diane Miller for help in FISH experiments. This research was supported by Grant CA43222 from the National Cancer Institute. The GCG package was supported in part by Grant M01RR00042 from the National Center for Research Resources, NIH.
1 Sutherland,G.R. and Hecht,F. (1985) Fragile sites on Human Chromosomes. Oxford Monographs on Medical Genetics, Oxford University Press, Oxford.
2 Wenger,S.L., Hennessey,J.C. and Steele,M.W. (1987) Increased sister chromatid exchange frequency at Xq27 site in affected fragile X males. Am. J. Med. Genet.26, 909-914.MEDLINE Abstract
3 Glover,T.W. and Stein,C.K. (1987) Induction of sister chromatid exchanges at common fragile sites. Am. J. Hum. Genet.41, 882-890.MEDLINE Abstract
4 Warren,S.T., Zhang,F., Licambi,G.R. and Peters,J.F. (1987) The fragile X site in somatic cell hybrids. Science237, 420-423.MEDLINE Abstract
5 Glover,T.W. and Stein,C.K. (1988) Chromosome breakage and recombination at fragile sites. Am. J. Hum. Genet.43, 265-273.MEDLINE Abstract
6 Wang,N-D., Testa,J.R. and Smith,D.I. (1993) Determination of the specificity of aphidicolin-induced breakage of the human 3p14.2 fragile site. Genomics17, 341-347.MEDLINE Abstract
7 Rassool,F.V., McKeithan,T.W., Neilly,M.E., van Melle,E., Espinosa III,R. and Le beau,M.M. (1991) Preferential integration of marker DNA into the chromosomal fragile site at 3p14: An approach to cloning fragile sites. Proc. Natl Acad. Sci. USA88, 6657-6661.MEDLINE Abstract
8 Yunis,J.J. and Soreng,A.L. (1984) Constitutive fragile sites and cancer. Science226, 1199-1204.MEDLINE Abstract
9 Le Beau,M.M. and Rowley,J.D. (1984) Heritable fragile sites and cancer. Nature308, 607-608.
10 Fu,Y.H., Kuhl,D.P.A., Pizzuti,A., Pieretti,M., Sutcliffe,J.S., Richards,S., Verkerk,A.J.M.H., Holden,J.J.A., Fenwick,R.G., Warren,S.T., Oostra,B.A., Nelson,D.L. and Caskey,C.T. (1991) Variation of the CGG repeat at the fragile X site results in genetic instability: Resolution of the Sherman paradox. Cell67, 1047-1058.MEDLINE Abstract
11 Knight,S.J.L., Flannery,A.V., Hirst,M.C., Campbell,L., Christodoulou,Z., Phelps,S.R., Pointon,J., Middleton-Price,H.R., Barnicoat,A., Pembrey,M.E., Holland,J., Oostra,B.A., Bobrow,M. and Davies,K.E. (1993) Trinucleotide repeat amplification and hypermethylation of a CpG island in FRAXE mental retardation. Cell74, 1-20.
12 Nancarrow,J.K., Kremer,E., Holman,K., Eyre,H., Dogget,N.A., Le Paslier,D., Callen, D.F., Sutherland,G.R. and Richards,R.I. (1994) Implications of FRA16A structure for the mechanism of chromosomal fragile site genesis. Science264, 1938-1941.MEDLINE Abstract
13 Parrish,J.E., Oostra,B.A., Verkerk,A.J.M.H., Richards,C.S., Reynolds,J., Spikes,A.S., Shaffer,L.G. and Nelson,D.L. (1994) Isolation of a CCG repeat showing expansion in FRAXF, a fragile site distal to FRAXA and FRAXE. Nature Genet.8, 229-235.MEDLINE Abstract
14 Jones,C., Slijepcevic,P., Marsh,S., Baker,E., Langdon,W.Y., Richards,R.I. and Tunnacliffe, A. (1994) Physical linkage of the fragile site FRA11B and the Jacobsen syndrome chromosome deletion breakpoint in 11q23.3. Hum. Mol. Genet3, 2123-2130.MEDLINE Abstract
15 Pieretti,M., Zhang,F, Fu,Y-H., Warren,S.T., Oostra,B.A., Caskey,C.T. and Nelson,D.L. (1991) Absence of expression of the FMR-1 gene in fragile X syndrome. Cell66, 817-822.MEDLINE Abstract
16 Laird,C., Jaffe,E., Karpen,G., Lamb,M. and Nelson,R. (1987) Fragile sites in human chromosomes as regions of late replicating DNA. Trends Genet.3, 274-281.
17 Hansen,R.S., Canfield,T.K., Lamb,M.M., Gartler,S.M. and Laird,C.D. (1993) Association of Fragile X syndrome with delayed replication of the FMR1 gene. Cell73, 1403-1409.MEDLINE Abstract
18 Popescu,N.C. and DiPaolo,J.A. (1989) Preferential sites for viral integration on mammalian genome. Cancer Genet. Cytogenet. 42, 157-171.MEDLINE Abstract
19 Popescu,N.C., Zimonjic,D. and Dipaolo,J.A. (1990) Viral integration, fragile sites and proto-oncogenes in human neoplasia. Hum. Genet.84, 383-386.MEDLINE Abstract
20 Cannizzaro,L.A., Durst,M., Mendez,M.J., Hecht,B.K. and Hecht,F. (1988) Regional chromosome localization of human papillomavirus integration sites near fragile sites, oncogenes and cancer chromosome breakpoints. Cancer Genet. Cytogenet. 33, 93-98.MEDLINE Abstract
21 Bosch,F.X., Manos,M.M., Munoz,N., Sherman,M., Jansen,A.M., Peto,J., Schiffman,M.H., Moreno,V., Kurman,R., Shah,K.V., International Biological Study on Cervical Cancer Study Group. (1995) Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. J. Natl Cancer Inst.87, 796-802.MEDLINE Abstract
22 Boldog,F., Gemmill,R.M., Wilke,C.M., Glover,T.W., Nilsson,A., Chandrasekharappa,S.C., Brown,R.S., Li,F.P. and Drabkin,H.A. (1993) Positional cloning of the hereditary renal carcinoma 3;8 chromosome translocation breakpoint. Proc. Natl Acad. Sci. USA90, 8509-8513.MEDLINE Abstract
23 Wilke,C.M., Guo,S-W., Hall,B.K., Boldog,F., Gemmill,R.M., Chandrasekharappa,S.C., Barcroft,C.L., Drabkin, H.A. and Glover,W.G. (1994) Multicolor FISH mapping of YAC clones in 3p14 and identification of a YAC spanning both FRA3B and the t(3;8) associated with hereditary renal carcinoma. Genomics22, 319-326.
24 Wagatsuma,M., Hashimoto,K. and Matsukura,T. (1990) Analysis of human Papillomavirus type 16 DNA in cervical cancers: amplification of viral sequences together with cellular flanking sequences. J. Virol.64, 813-821.MEDLINE Abstract
25 Kohno,T., Takayama,H., Hamaguchi,MM., Takano,H., Yamaguchi,N., Tsuda,H., Hirohashi,S., Vissing,H., Shimizu,M., Oshimura,M. and Yokota,J. (1993) Deletion mapping of chromosome 3p in human uterine cervical cancer. Oncogene8, 1825-1832.MEDLINE Abstract
26 Altschul,S.F., Gish,W., Miller,W., Myers,E.W. and Lipman,D.J. (1990) Basic local alignment search tool. J. Mol. Biol.215, 403-410.MEDLINE Abstract
27 Uberbacher,E.C. and Mural,R.J. (1991) Locating protein-coding regions in human DNA by multiple sensor neural network approach. Proc. Natl Acad. Sci. USA88, 1161-1165.
28 Haendler,B., Hofer-Warbinek,R. and Hofer,E. (1987) Complementary DNA for T-cell cyclophilin. EMBO J.6, 947-950.MEDLINE Abstract
29 Genetics Computer Group, Program Manual for GCG Package, Version 8, April 1991, 575 Science Drive, Madison, Wisconsin, USA 53711.
30 Krowczynska,A.M., Rudders,R.A. and Krontiris,T.G. (1990) The human minisatellite consensus at breakpoints of oncogene translocations. Nucleic Acids Res.18, 1121-1127.MEDLINE Abstract
31 Sowerby,S.J., Kennedy,M.A., Fitzgerald,P.H. and Morris C.M. (1993) DNA sequence analysis of the major breakpoint cluster region of the BCR gene rearranged in Philadelphia-positive human leukemias. Oncogene8, 1679-1683.MEDLINE Abstract
32 Chen,S.J., Chen,Z., D'Auriol,L., Le Coniat,M., GrausZ,D. and Berger, R. (1989) Ph+bcr-acute leukemias: implications of Alu sequences in a chromosomal translocation occuring in the new cluster region within the BCR gene. Oncogene4, 195-202.MEDLINE Abstract
33 Kas,E. and Laemmli,U.K. (1992) In vivo topoisomerase II cleavage of the Drosophila histone and satellite II repeats: DNA sequence and structural characteristics. EMBO J.11,705-716.MEDLINE Abstract
34 Cullen,M., Erlich,H., Klitz,W. and Carrington,M. (1995) Molecular mapping of a recombination hotspot located in the second intron of the human TAP2 locus. Am. J. Hum. Genet.56, 1350-1358.MEDLINE Abstract
35 Krawczak,M. and Cooper,D.N. (1991) Gene deletions causing human genetic disease: mechanisms of mutagenesis and the role of local DNA sequence environment. Hum. Genet.86, 425-441.MEDLINE Abstract
36 Hecht,F. (1988) Fragile sites, cancer chromosome breakpoints and oncogenes all cluster in light G-bands. Cancer Genet. Cytogenet.31, 17-24.MEDLINE Abstract
37 Caporossi,D., Bachetti,S. and Nicoletti,B. (1991) Synergism between aphidicolin and adenoviruses in the induction of breaks at fragile sites on human chromosomes. Cancer Genet. Cytogenet.54, 39-53.MEDLINE Abstract
38 Glover,T.W., Berger,C., CoyleJ. and Echo,B. (1984) DNA polymerase alpha inhibition by aphidicolin induces gaps and breaks at common fragile sites in human chromosomes. Hum. Genet. 67, 136-142.MEDLINE Abstract
39 Zimonjic,D.B., Popescu,N.D. and DiPaolo,.A. (1994) Chromosome organization of viral integration sites in human Papillomavirus-immortalized human keratinocyte cell lines. Cancer Genet. Cytogenet.72, 39-43.MEDLINE Abstract
40 Smith,P.P., Friedman,C., Bryant,E.M. and McDougall,J.K. (1992) Viral integration and fragile sites in human papillomavirus-immortalized human keratinocyte cell lines. Genes Chrom. Cancer5, 150-157. MEDLINE Abstract
41 Kahn,T., Korn,B., Delius, H., Poustka,A. and zur Hausen,H. (1995) Suche nach Tumor-Suppressor-Genen in Papillomvirus-Integrationsorten am Beispiel einer HPV 6-DNA Integration in einem Tonsillen-Karzinom.Tagung der Gesellschaft fur deutsche Virologie, Giessen.
42 Lazo,P.A., Gallego, M.I., Ballester,S. and Feduchi,E. (1992) Genetic alterations by human papillomaviruses in oncogenesis. FEBS Lett.300, 109-113.MEDLINE Abstract
43 Gallego,M.I., Zimonjic,D.B., Popescu,N.C., DiPaolo,J.A. and Lazo,P.A. (1994) Integration site of human Papillomavirus type-18 DNA in chromosome band 8q22.1 of C4-I cervical carcinoma: DNase I hypersensitivity and methylation of cellular flanking sequences. Genes Chrom. Cancer9, 28-32.MEDLINE Abstract
44 Hibi,K., Takahashi,T., Yamakawa,K., Ueda,R., Sekido,Y., Ariyoshi,Y., Suyama,M., Takagi,H. and Nakamura,Y. (1992) Three distinct regions involved in 3p deletion in human lung cancer. Oncogene7, 445-449.MEDLINE Abstract
45 Chung,G.T., Huang,D.P., Wailo,K., Chan,M.K.M. and Wong,F.W.S. (1992) Genetic lesions in the carcinogenesis of cervical cancer. Anticancer Res.12, 1485-1490.MEDLINE Abstract
46 Jones,M.H. and Nakamura,Y. (1992) Deletion mapping of chromosome 3p in genital tract malignancies using microsatellite polymorphisms. Oncogene7, 1631-1634.MEDLINE Abstract
47 Sanchez,Y., El-Nagger,A., Pathak,S. and Killary,A.M. (1994) A tumor suppressor locus within human chromosome 3p14-p12 mediates rapid cell death of renal carcinoma in vivo. Proc. Natl Acad. Sci. USA91, 3383-3387. MEDLINE Abstract
48 Devilee,P. van den Broek,M., Kuipers-Dijkshoorn,N., Kolluri,R., Khan,P.M., Pearson,P.L. and Cornelisse,C.J. (1989) At least four different chromosomal regions are involved in loss of heterozygosity in human breast carcinoma. Genomics5, 554-560.MEDLINE Abstract
50 Couturier,J., Sastre-Garau,X., Schneider-Maunoury,S., Labib, A. and Orth,G. (1991) Integration of papillomavirus DNA near myc genes in genital carcinomas and its consequences for proto-oncogene expression. J. Virol. 65, 4534-4538.MEDLINE Abstract
51 Mercer,J.F.B., Livingston,J., Hall,B., Paynter,J.A., Begy,C., Chandrasekharappa,S., Lockhart,P., Grimes,A., Bhave,M., Siemieniak,D. and Glover,T.W. (1993) Isolation of a partial candidate gene for Menkes disease by positional cloning. Nature Genet.3, 20-25.MEDLINE Abstract
52 Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular cloning, a laboratory manual, 2nd Edition. (Cold Spring Harbor Laboratory Press, New York)
53 Church,G.M. and Gilbert,W. (1984) Genomic sequencing. Proc. Natl Acad. Sci. USA81, 1991-1995.MEDLINE Abstract
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Thu Oct 31 15:21:55 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
