Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (59)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kivirikko, S.
Right arrow Articles by Christiano, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kivirikko, S.
Right arrow Articles by Christiano, A. M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 231-238
Mutational hotspots in the LAMB3 gene in the lethal (Herlitz) type of junctional epidermolysis bullosa
Introduction
Results
   Identification of the mutation R635X in 15 LAMB3 alleles
   Identification of the mutation R42X in five LAMB3 alleles
   Demonstration of de novo occurrence of R42X
   Frequency of the R42X and R635X mutations in H-JEB
Discussion
Materials And Methods
   Clinical
   Mutation detection in the LAMB3 gene
   Verification of the hotspot mutations by restriction enzyme digestion
   Haplotype analysis
Abbreviations
Acknowledgements
References

Mutational hotspots in the LAMB3 gene in the lethal (Herlitz) type of junctional epidermolysis bullosa

Mutational hotspots in the LAMB3 gene in the lethal (Herlitz) type of junctional epidermolysis bullosa Sirpa Kivirikko1, John A. McGrath1, Leena Pulkkinen1, Jouni Uitto1,2,* and Angela M. Christiano1

Departments of 1Dermatology and Cutaneous Biology, and 2Biochemistry and Molecular Biology, Jefferson Medical College, and Section of Molecular Dermatology, Jefferson Institute of Molecular Medicine, Thomas Jefferson University, Philadelphia, PA 19107, USA

Received September 22, 1995; Revised and Accepted November 6, 1995

The Herlitz type of junctional epidermolysis bullosa (H-JEB) is a severe blistering disease affecting the skin and mucous membranes, and laminin 5 has been implicated as the candidate gene/protein system for most patients with H-JEB. In this study, we have examined a cohort of 14 families with H-JEB for mutations in the LAMB3 gene. Premature termination codon mutations were delineated in both alleles of each proband in all pedigrees. Interestingly, two recurrent mutations, R42X and R635X, were noted in over 50% of the mutant LAMB3 alleles. These nonsense mutations occurred at CpG dinucleotide sequences, suggesting hypermutability of 5-methylcytosine to thymine. Additional evidence suggested that R42X and R635X represent mutational hotspots. First, the inheritance of R635X in a homozygous individual on two different genetic backgrounds was demonstrated by haplotype analysis. Furthermore, in one family, R42X was shown to be inherited on the maternal allele which lacked this mutation, suggesting that it arose as a result of maternal germline mutation. Elucidation of these two hotspot mutations will facilitate screening of additional JEB patients for the underlying mutations.

INTRODUCTION

Epidermolysis bullosa (EB) is a heterogeneous group of blistering skin diseases which can be divided into three major categories on the basis of the level of tissue separation (1 ,2 ). In the junctional forms of EB (JEB), tissue separation occurs within the dermal-epidermal basement membrane, at the level of the lamina lucida. JEB has been divided into lethal (Herlitz) and non-lethal (non-Herlitz) types on the basis of the clinical findings (1 ). The lethal variants present with marked and widespread fragility of the skin, laryngotracheal epithelia and mucous membranes, with early demise of affected individuals often during the first year of life. The non-lethal forms demonstrate a life-long tendency for less extensive blistering and erosions as a result of trauma. However, extracutaneous manifestations, including dental anomalies, nail and hair abnormalities, and gastrointestinal and vesico-urinary tract involvement, are the cause of considerable long-term morbidity.

Recent immunofluorescent observations have suggested that the components of the hemidesmosome-anchoring filament complexes serve as potential candidate gene/protein systems for mutations in JEB (2 -7 ). This conclusion has been reinforced by demonstration of ultrastructural abnormalities in the hemidesmosome-anchoring filament structures in JEB (8 ). The protein components of the hemidesmosomes and anchoring filaments include laminin 5, the 230 kDa and 180 kDa bullous pemphigoid antigens, and the [alpha]6[beta]4 integrin (2 ,3 ). We have recently demonstrated mutations in JEB in all three genes, LAMA3, LAMB3 and LAMC2, encoding the subunit polypeptides of laminin 5, the [alpha]3, [beta]3 and [gamma]2 chains, respectively (9 -13 ). In addition, specific mutations in the gene for the [beta]4 integrin have been demonstrated in a subset of patients with JEB associated with pyloric atresia (14 ). Finally, a non-lethal variant of JEB, known as generalized atrophic benign EB, results from mutations in the 180 kDa bullous pemphigoid antigen gene (BPAG2), also known as type XVII collagen (COL17A1) (15 ).

The vast majority of DNA methylation and subsequent hypermutability occurs within the regions of the genome containing CpG sequences, and the C-to-T transition is a frequently observed mutation in a variety of heritable diseases (16 -18 ). In genes with low intron-exon ratios, the rate of C-to-T substitutions in the exons is approximately the same in the introns. Furthermore, it is predicted that for uniformly methylated genes, the numbers of mutations due to CpG deamination in large exons will exceed that in small exons (16 ). Among the candidate genes for JEB, the intron-exon organization of LAMB3 has recently been elucidated (19 ). The gene consists of 23 exons, 22 of them containing coding sequences, and the intron-exon ratio of this gene is relatively low, 7.3:1. Thus, one could predict that C-to-T transitions due to hypermutability of cytosine residues in CpG dinucleotide sequences might occur relatively frequently in this gene, potentially resulting in the JEB phenotype.

In this study, we report two mutational hotspots in the LAMB3 gene, which both occur at a CpG dinucleotide and convert an arginine codon (CGA) to a premature termination codon (TGA) in patients with lethal JEB. The most prevalent nonsense mutation, R635X, accounts for nearly 50% of all mutant LAMB3 alleles. The second common mutation, R42X, has been observed in about 10% of LAMB3 mutant alleles in patients with this disease. We also provide evidence in support of the hypermutable nature of these cytosines by demonstrating the presence of R635X on different polymorphic LAMB3 backgrounds in a patient homozygous for the mutation, and by reporting a de novo occurrence of R42X probably in the maternal germ line of one proband. Collectively, these findings indicate that the hypermutability of CpG dinucleotides corresponding to amino acids 42 and 635 in the LAMB3 gene product accounts for almost 60% of all JEB allelic mutations disclosed thus far.

RESULTS

Identification of the mutation R635X in 15 LAMB3 alleles

The initial discovery of the R635X mutation was based on the demonstration of a C-to-T transition in nucleotide position 1903 of the LAMB3 cDNA (GenBank no. L25541) in a family with an affected individual with H-JEB (11 ). As a consequence of this mutation, a new restriction enzyme site for BglII was generated. Amplification of exon 14 by the primers indicated in Materials and Methods yielded a product of 578 bp (Fig. 1 ). Digestion of this PCR product in patients containing the C-to-T substitution generated new digestion products of 428 and 150 bp, as shown in Figure 1 . The affected individual, who died at the age of 2 weeks from complications of H-JEB, was shown to be homozygous for the mutation R635X (Fig. 1 ). The parents were heterozygous carriers of the same mutation, as shown by the presence of a normal allele (578 bp band) and the mutated allele (428 and 150 bp bands). This restriction enzyme digestion was used to screen for the presence of this mutation in 13 additional families with H-JEB. Among the total number of 34 alleles examined, including those in previous reports on LAMB3 mutations in JEB (11 ,20 ,21 ), 15 of them were shown to carry the mutation R635X (Table 1 ). In five pedigrees studied, the affected individual was homozygous for this mutation, while in five additional cases, this mutation was inherited in combination with another mutation resulting in a premature termination codon of translation on the other allele (Table 1 ). Thus, the mutation R635X appears to be a frequent genetic lesion in the LAMB3 gene in patients with H-JEB.


Figure 1. Detection of the recurrent mutation R635X by restriction enzyme digestion. The PCR product spanning exon 14 in LAMB3 gene was subjected to digestion with BglII. In control individuals (C) the 578 bp PCR product is not digested. In an individual homozygous for the mutation, the PCR product is digested to 428 and 150 bp fragments (lane 2). The parents demonstrate the presence of 578, 428, and 150 bp bands, indicating that they are heterozygous carriers of the mutation R635X. M, molecular weight markers, HaeIII ØX174.

To examine the possibility that the mutation R635X represents a mutational hotspot, rather than propagation of an ancestral mutation, haplotype analysis with six intragenic LAMB3 polymorphisms in alleles containing this mutation was performed in a family with an affected individual homozygous for the mutation. The results demonstrated that the haplotype of the alleles containing the mutation R635X in both parents was different, indicating that this mutation arose independently on the two different alleles (Fig. 2 ).


Figure 2. Pedigree of a family with one deceased male proband who was homozygous for the hotspot mutation R635X in LAMB3. Analysis of the haplotype of each of the parental mutant alleles revealed that the proband and/or parents displayed different combinations of heterozygous and homozygous genotypes for silent intragenic polymorphisms in exon 4, 9 and 23 of LAMB3. The proband and both parents were also heterozygous for a polymorphism in exon 8 (not shown). These data establish that R635X is inherited with two different parental haplotypes.

Identification of the mutation R42X in five LAMB3 alleles

We have developed a methodology to scan the entire LAMB3 gene by PCR amplification of individual exons, followed by heteroduplex analysis by CSGE. When the amplification product containing the exon 3 sequences was examined using this technique, a heteroduplex in addition to the homoduplex was initially noted using DNA from an affected individual who died shortly after birth from complications of JEB (Fig. 3 A, and see below). Sequencing of the mutant allele demonstrated a C-to-T substitution at nucleotide position 124 of the LAMB3 cDNA (Fig. 3 B). This mutation changes an arginine codon to a stop codon, and is designated R42X.


Figure 3. Identification of the maternal mutation R42X. (A) Analysis of a PCR product spanning exon 3 sequences in a family with H-JEB revealed two heteroduplex bands in the proband, one migrating close to the homoduplex seen in the father (lane 1) and an unrelated control (C). In addition, a distinct heteroduplex migrating further above the homoduplex band is seen. The proband's mother demonstrates only the heteroduplex band migrating close to the homoduplex, similar to that seen in the proband. (B) Direct sequencing of the PCR product demonstrated a C-to-T transition in the affected individual, indicating heterozygosity for this mutation, R42X. In addition, the maternal sequence demonstrated a heterozygous C-to-T polymorphism, which does not change the amino acid (threonine, ACT to ACC). Note that the proband had inherited the allele containing the C from the mother and the T allele from the father, who was homozygous for the T allele (not shown). (C) The mutation R42X results in the generation of a new restriction enzyme site for DdeI. The proband (lane 2) demonstrates digestion of one of the 273 bp fragments into 241 and 32 bp fragments, indicating heterozygosity for the mutation R42X. Note that neither of the parents carries the same mutation, suggesting that this mutation is a de novo event.

The C-to-T transition created a new restriction site for the enzyme DdeI. In the presence of a mutant allele, the 273 bp PCR amplification product was digested into four fragments, consisting of a new 241 bp fragment, in addition to the 103, 85 and 38 bp fragments derived from the normal allele (Fig. 3 C). Screening of patients with JEB by this restriction enzyme digestion revealed that the mutation R42X was present in three additional families (Table 1 ). Among the four families, in one case the affected individual was homozygous for this mutation (R42X/R42X), in two of the cases this mutation was associated with the other hotspot mutation R635X (see above) on the other allele, while in one case the mutation R42X was compounded by a 28+2insT mutation affecting the 5' donor splice site of intron 2 of LAMB3 (see below).

Demonstration of de novo occurrence of R42X

Support for the hypermutable nature of the C at nucleotide position 124 was provided by a case apparently demonstrating de novo formation of the mutation R42X. In particular, the affected individual's DNA demonstrated a complex heteroduplex pattern consisting of two additional bands in addition to the homoduplex, when exon 3 sequences were analyzed (Fig. 3 A). Examination of the maternal DNA revealed a heteroduplex band migrating close to the homoduplex, but neither parent's DNA showed the distinct heteroduplex band moving further above the homoduplex noted in the proband (Fig. 3 A). Sequencing of the mutant allele in the proband demonstrated a C-to-T transition indicative of the mutation R42X (Fig. 3 B). In addition, the normal allele derived from the mother demonstrated the presence of another C-to-T transition (asterisk in Fig. 3 B), which did not change the corresponding amino acid (ACC to ACT, amino acid Threonine-46). Thus, the latter C-to-T transition represents a silent polymorphism present in the clinically unaffected mother and the proband. The father of the proband was homozygous for T with respect to this polymorphism (data not shown). However, analysis of DNA from both parents did not reveal evidence for the presence of the R42X mutation.

The pathogenetic mutation, R42X, was confirmed in the proband by DdeI restriction enzyme digestion, while the parents showed the presence of normal allele only (Fig. 3 C). It should be noted that as the mother was heterozygous for the C/T silent polymorphism and the father was homozygous for the T, the proband had inherited the allele containing R42X from the maternal side, yet the mother's DNA isolated from peripheral blood lymphocytes did not demonstrate this mutation. This observation indicated that the mutation was a de novo event, most likely in the maternal germ line.

To identify the paternal mutation in this family, the remaining exons were screened for potential sequence variants. Examination of the PCR product containing exon 2 sequences revealed a distinct heteroduplex pattern, which was identical in the father and the affected proband (Fig. 4 A). Sequencing of the mutant allele indicated insertion of a T into the 5' donor splice site at position +2 of intron 2 (Fig. 4 B) This nucleotide insertion displaces the G at position +5, predicting a splicing error, and resulting in out-of-frame skipping of exon 2 (ref. 22 ). As exon 2 contains the translation initiation codon (ATG) (19 ), this mutation is expected to result in non-expression of the paternal allele in the affected proband. This conclusion is consistent with our inability to amplify the mutant paternal allele by RT-PCR from the father's cells (data not shown).

Table 1 Mutations in the laminin 5 genes in patients with JEB this study this study this study this study 9
Herlitz (lethal) JEB

 Consequence*

 Origin

 Reference
LAMA3
R650X/R650X

 PTC/PTC

  

 13
R650X/R650X

 PTC/PTC

  

 27
R650X/R650X

 PTC/PTC

  

 29
300delG/300delG

 PTC/PTC

  

 28
LAMB3
R635X/R635X

 PTC/PTC

  

 11
R635X/R635X

 PTC/PTC

 Caucasian

 this study
R635X/R635X

PTC/PTC

 Caucasian

 this study
R635X/R635X

PTC/PTC

 Caucasian (North European)

R635X/R635X

 PTC/PTC

 Caucasian

 this study
R635X/R144X

 PTC/PTC

 Caucasian (German)

R635X/29insC

 PTC/PTC

 Caucasian

 this study
R635X/462insT

 PTC/PTC

 Caucasian (North European & Jewish)

R635X/R42X

PTC/PTC

 Caucasian

 this study
R635X/R42X

 PTC/PTC

 Caucasian

 this study
R42X/R42X

 PTC/PTC

 Caucasian (Eastern European)

28+2insT/R42X

 PTC/PTC

 Caucasian

 this study
R569X/Q243X

 PTC/PTC

 Caucasian

 this study
957ins77/R660X

 PTC/PTC

 Nigerian

 this study
685-1G -> C/685-1G -> C

PTC/PTC

 Pakistani

 this study
957ins77/957ins77

 PTC/PTC

  

 20
1760delC/1760delC

 PTC/PTC

  

 21
LAMC2
Y394X/Y394X

 PTC/PTC

  

 10
1070G -> T/1070G -> T

 PTC/PTC

  

 30
R95X/R95X

 PTC/PTC

  

 31
Non-Lethal JEB
LAMB3
R42X/E210K

 PTC/missense

 

 12
R635X/T350P

 PTC/missense

  

 37
R635X/E210K

 PTC/missense

  

 37
LAMC2
2336del20 -> G

 PTC/?

  

 9
1184-1G -> A/1184-1G -> A

 In-frame exon skip

 

*PTC, premature termination codon.


The insertion of a T created a new restriction enzyme site for MseI. The 287 bp PCR product in controls or in the mother of the proband was not digested by this enzyme, while the PCR products from the father and the affected individual were shown to be heterozygous for this mutation (Fig. 4 C). Thus, the proband is a compound heterozygote for a de novo R42X mutation and a paternally inherited splice site mutation, 28+2insT. The combination of these mutations is expected to result in complete absence of the synthesis of the [beta]3 chain of laminin 5, explaining the severe clinical phenotype resulting in the early demise of the affected individual.


Figure 4. Identification of the paternal mutation in the patient with Herlitz-JEB containing the mutation R42X (see Fig. 3). (A) Electrophoretic analysis of a PCR product containing exon 2 revealed a heteroduplex pattern in the proband and the father, while the mother showed a homoduplex only, similar to that seen in an unrelated control (C). (B) Sequencing of the cloned PCR product demonstrated an insertion of a T at the 5' donor splice site of intron 2, in comparison with the normal allele. This insertion displaces the obligatory G nucleotide from the +5 position of the splice site, predicting out-of-frame skipping of exon 2. (C) The mutation 28+2insT creates a new restriction endonuclease site for MseI. Digestion of proband's and father's PCR product demonstrates that one of the alleles has been digested into 210 and 78 bp fragments, indicating that they are heterozygous for this mutation. The mother and the unrelated control demonstrate the presence of the 287 bp band only, indicating that they do not carry the mutation.

Frequency of the R42X and R635X mutations in H-JEB

As indicated above, we have identified both parental mutations in the three laminin 5 genes, LAMA3, LAMB3 and LAMC2, in a total of 24 families with the Herlitz type of JEB. Of the mutations identified in the LAMB3 gene in these families, 59% can be accounted for by the two hotspot mutations, R42X and R635X (Table 1 ). Thus, these two hotspot mutations are frequent genetic lesions underlying H-JEB, and screening for these mutations by restriction enzyme digestions, as illustrated above, will facilitate rapid evaluation of the genetic basis of families with JEB.

DISCUSSION

In this study, we describe LAMB3 mutations in both parental alleles in 14 previously unreported families with lethal (Herlitz) JEB. This study, together with three previous case reports (11 ,20 ,21 ), indicates that LAMB3 is a frequent site of mutations in H-JEB. Our first reported mutation in LAMB3, designated R635X (11 ), has now been identified in 13 additional LAMB3 alleles. Furthermore, we report the identification of another frequent mutation, R42X, which has been observed in five LAMB3 alleles. Collectively, these two mutations account for >50% of all mutations identified thus far in the LAMB3 gene in JEB, and their presence illustrates the hypermutability of CpG dinucleotides in general. Haplotype analysis of the LAMB3 gene in one family demonstrated that the mutation R635X occurred as a separate event on different LAMB3 backgrounds. Furthermore, in one proband, we were able to demonstrate that R42X arose as a de novo event, most likely due to spontaneous deamination of 5-methylcytosine in the maternal germ line. In addition to these prevalent C-to-T transitions, we also identified three other nonsense mutations converting arginine codons to termination codons, presumably by the same mechanism, as each of these mutations occurs at a CpG dinucleotide. These mutations were designated as R144X, R569X, and R660X (see Table 1 ). In addition to arginine codon mutations, five previously unrecognized mutations, 29insC, 462insT, Q243X, 685-IG -> C and 28+2insT, were disclosed. Collectively, we report 14 probands with premature termination codons on both alleles of LAMB3. Using CSGE heteroduplex analysis, the rate of mutation detection in this cohort of patients was 100%.

Initially, there appeared to be a discrepancy in the proportion of mutations identified thus far in each of the three chains of laminin 5 in patients with lethal junctional EB, with a striking preponderance for mutations in LAMB3 (Table 1 ). This finding was unexpected, as all three constitutive polypeptides, [alpha]3, [beta]3 and [gamma]2, are required for assembly of trimeric laminin 5 molecules (23 ). However, if we exclude the number of mutant alleles bearing the two hotspot mutations reported in this study, R42X and R635X, the mutation rate in the three genes LAMA3, LAMB3 and LAMC2, is approximately equal, with unique mutations appearing in each family (Table 1 ). Two exceptions to this general trend are represented by the mutation 957ins77 in LAMB3, which was observed in two families of Middle Eastern origin (20 ), and the R650X mutation in LAMA3, which has been identified in three families of Pakistani origin (Table 1 ). In the latter cases, the arginine-to-stop codon mutation appears to represent propagation of an ancestral genetic lesion in the population, and is not a mutational hotspot, as determined by haplotype analysis using microsatellite markers in the region of chromosome 18q11.2 flanking the LAMA3 gene (29 ).

As indicated in Table 1 , we have now identified mutations in both parental alleles in 24 patients with the lethal Herlitz type of JEB, and in four patients with non-lethal forms of JEB. Based on the information gathered thus far, certain preliminary conclusions about the genotype/phenotype correlations can be drawn. Specifically, it appears that premature termination codon mutations in both alleles of one of the laminin 5 genes result in the severe Herlitz type of JEB. Although the premature termination codon predicts the synthesis of a truncated polypeptide, the major consequence of such mutations has been shown to relate to reduced steady-state levels of the corresponding mRNA due to nonsense-mediated RNA decay (24 ,25 ). In fact, in the first report of a LAMB3 mutation, the proband was homozygous for the hotspot mutation R635X, and Northern analysis failed to reveal any detectable LAMB3 mRNA in the proband's keratinocytes (11 ). Thus, as a result of premature termination codon mutations affecting both alleles of the LAMB3 gene, no [beta]3 polypeptides are synthesized, and consequently, no functional laminin 5 molecules are assembled. Although molecular compensation for the laminin [beta]2 chain by the [beta]1 chain has been demonstrated in the LAMB2 gene knockout mice, this compensation does not rescue the phenotype (26 ). However, in H-JEB patients lacking the [beta]3 chain, such molecular compensation is not evident. This conclusion is supported by immunofluorescent staining of H-JEB patients' skin with an antibody GB3 which recognizes a laminin 5 epitope only in a conformationally intact molecule (38 ); the immunofluorescent staining in these cases is universally negative (4 ,5 ). Furthermore, there is no ultrastructural evidence for reconstitution of anchoring filaments by a compensatory [beta] chain (8 ).

In some patients with non-lethal forms of JEB, premature termination codons (including R42X and R635X in LAMB3) have been detected in one allele, but in at least two cases in which the mutations in both alleles have been detected, the other genetic lesion is a missense mutation (Table 1 ). In addition, a homozygous in-frame exon skipping mutation in LAMC2 has been demonstrated in a non-lethal JEB patient (9 ). Thus, in the case of premature termination codon mutations, the polypeptide synthesized from the other allele is apparently able to assemble into partially functional laminin 5 molecules, explaining the milder phenotype with less pronounced fragility of the skin and the mucous membranes. This conclusion is also supported by immunofluorescence staining, which in most cases of non-lethal JEB demonstrates detectable, although attenuated, staining for laminin 5 epitopes.

As further evidence for the genetic heterogeneity present in JEB, we have recently demonstrated specific premature termination codon mutations in a different gene, BPAG2, in a subset of non-lethal JEB, known as generalized atrophic benign epidermolysis bullosa (GABEB) (15 ). In addition, the combination of a premature termination codon and an in-frame exon skipping mutation in a patient with JEB associated with pyloric atresia has been demonstrated in the [beta]4 integrin gene (14 ). Therefore, the multiplicity of candidate genes, the consequences of the genetic lesions, and the dynamic interplay between the two mutations all contribute to the spectrum of phenotypic variability displayed within this group of genetic skin diseases.

MATERIALS AND METHODS

Clinical

Fourteen families with the lethal (Herlitz) type of JEB were included in this study. The diagnosis was based on a combination of clinical observations, immunofluorescence staining with a monoclonal antibody GB3 directed against laminin 5 (32 ), and/or ultrastructural examination of the skin by transmission electron microscopy. In each case, the parents were clinically unaffected, consistent with an autosomal recessive inheritance pattern. DNA for mutational analysis was isolated from peripheral blood leukocytes (33 ).

Mutation detection in the LAMB3 gene

Total genomic DNA was used as a template for PCR amplification of individual exons in the LAMB3 gene, as described previously (34 ). The primers used for PCR amplification were placed on the adjacent introns, and the individual PCR products contained the entire coding sequence of each of the 22 exons encompassing the coding region of LAMB3. For identification of the two specific hotspot mutations, the following PCR primer pairs were used: for detection of the mutation R635X in exon 14, the following primers were used: sense primer, 5'GCTG CGACTTCTGTTATTCT3'; anti-sense primer, 5'AAATGTAAGGAAGGACCAGC3'. For detection of the mutation R42X in exon 3, the following primers were used: sense primer, 5'AATTATTACTGCCAGCAGCG3'; anti-sense primer, 5'TACATTTCCTCTTGCCCAAC3'. For the primers used for amplification of the remaining 20 exons corrresponding to the coding region within LAMB3, see reference 34 .

The PCR amplification conditions were the same as described previously (34 ). The PCR products were examined on 2% agarose gels, and subjected to heteroduplex analysis for detection of sequence variants by conformation sensitive gel electrophoresis (CSGE) (35 ). In some cases, the probands' PCR product was mixed with an equal amount of amplified DNA from normal unrelated controls, to allow detection of homozygous mutations. If a PCR product of altered mobility was detected by heteroduplex analysis, the product was subcloned into a PCR-compatible vector (TA, InVitrogen) and sequenced manually by the dideoxynucleotide chain termination method (36 ), or subjected directly to automated sequencing (ABI).

Verification of the hotspot mutations by restriction enzyme digestion

Each of the hotspot mutations, reflecting C-to-T transitions, resulted in the generation of a new restriction enzyme site. Specifically, for the mutation R42X, a new site for DdeI, and for R635X, a new restriction site for BglII were generated (see text). Aliquots of the corresponding PCR products were subjected to restriction enzyme digestion according to the manufacturer's recommendations (New England Biolabs). The digestion products were fractionated on 2% agarose gels.

Haplotype analysis

To establish that the mutation R635X occurred on two different LAMB3 alleles, we performed heteroduplex analysis or restriction endonuclease digestions on four PCR products containing exons 4, 8, 9 and 23 of LAMB3 using primers and conditions described previously (34 ). Exons 4, 9 and 23 were digested with BsmFI, NarI and DdeI, respectively (34 and J.A.M. et al., unpublished), while the product containing exon 8 was fractionated on a heteroduplex gel (35 ) to assign the genotype.

ABBREVIATIONS

H-JEB, Herlitz-type of junctional epidermolysis bullosa; CSGE, conformation sensitive gel electrophoresis.

ACKNOWLEDGMENTS

We gratefully acknowledge the participation of the JEB families in this study, and the referral of cases from Drs Amy Paller, Mary Spraker, Leena Bruckner-Tuderman, Susan Mallory and Anne Lucky, as well as Dr Virginia Sybert at the National Epidermolysis Bullosa Registry in Seattle. We appreciate the expert technical help of Xin Zhang and Yili Xu. Dr Hansjürg Alder of the Jefferson Cancer Institute Automated Sequencing Facility provided invaluable assistance. This work was supported by USPHS, NIH grants R29-AR43602, PO1-AR38923 and T32-AR07561, the March of Dimes Birth Defects Foundation, the Dystrophic Epidermolysis Bullosa Research Association of America and the UK, the British Association of Dermatologists, and the Dermatology Foundation.

REFERENCES

1 Fine, J-D., Bauer, E.A., Briggaman, R.A., Carter, D.M., Eady, R.A.J., Esterly, N.B., Holbrook, K.A., Hurwitz, S., Johnson, L., Lin, A., Pearson, R. and V.P. Sybert. (1991) Revised clinical and laboratory criteria for subtypes of epidermolysis bullosa. A consensus report by the Subcommittee on Diagnosis and Classification of the National Epidermolysis Bullosa Registry. J. Am. Acad. Dermatol. 24: 119-135. MEDLINE Abstract

2 Uitto, J. and Christiano, A.M. (1992) Molecular genetics of the cutaneous basement membrane zone. Perspectives on epidermolysis bullosa and other blistering skin diseases. J. Clin. Invest. 90: 687-692.

3 Uitto, J., Pulkkinen, L. and Christiano, A.M. (1994) Molecular basis of the dystrophic and junctional forms of epidermolysis bullosa: mutations in the type VII collagen and kalinin (laminin 5) genes. J. Invest. Dermatol. 103: 39-46S.

4 Verrando, P., Schofield, O., Ishida-Yamamoto, A., Aberdam, D., Partouche, O., Eady, R.A.J. and Ortonne, J-P. (1993) Nicein (BM-600) in junctional epidermolysis bullosa: polyclonal antibodies provide new clues for pathogenic role. J. Invest. Dermatol. 101: 738-743.

5 Meneguzzi, G., Marinkovich, M.P., Aberdam, D., Pisani, A., Burgeson, R.E. and Ortonne, J-P. (1992) Kalinin is abnormally expressed in epithelial basement membranes of Herlitz's junctional epidermolysis bullosa patients. Exp. Dermatol. 1: 221-229.

6 Jonkman, M.F., de Jong, M.C.J.M., Heeres, K., Pas, H.H., van der Meer, J.B., Owaribe, K., Martinez de Velasco, A.M., Niessen, A.M. and Sonnenberg, A. (1995) Bullous pemphigoid antigen (BP180) is deficient in generalized atrophic benign epidermolysis bullosa. J. Clin. Invest. 95: 1345-1352. MEDLINE Abstract

7 Gil, S.G., Brown, T.A., Ryan, M.C. and Carter, W.G. (1994) Junctional epidermolysis bullosa: defects in expression of epiligrin/nicein/kalinin and integrin [beta]4 that inhibit hemidesmosome formation. J. Invest. Dermatol. 103: 31-38S.

8 Tidman, M.J. and Eady, R.A.J. (1986) Hemidesmosome heterogeneity in junctional epidermolysis bullosa revealed by morphometric analysis. J. Invest. Dermatol. 86: 51-56.

9 Pulkkinen, L., Christiano, A.M., Airenne, T., Haakana, H., Tryggvason, K. and Uitto, J. (1994) Mutations in the [gamma]2 chain gene (LAMC2) of kalinin/laminin-5 in the junctional forms of epidermolysis bullosa. Nature Genet. 6: 293-298.

10 Aberdam, G., Galliano, M-F., Vailly, J., Pulkkinen, L., Bonifas, J., Christiano, A.M., Uitto, J., Epstein, E.H. Jr., Ortonne, J-P. and Meneguzzi, G. (1994) Herlitz's junctional epidermolysis bullosa is linked to mutations in the gene (LAMC2) for the [gamma]2 subunit of nicein/kalinin (laminin-5). Nature Genet. 6: 299-304.

11 Pulkkinen, L., Christiano, A.M., Gerecke, D.R., Wagman, D.W., Burgeson, R.E., Pittelkow, M.R. and Uitto, J. (1994) A homozygous nonsense mutation in the [beta]3 chain of laminin 5 (LAMB3) in Herlitz junctional epidermolysis bullosa. Genomics 24: 357-360.

12 McGrath, J.A., Pulkkinen, L., Christiano, A.M., Leigh, I.M., Eady, R.A.J. and Uitto, J. (1995) Altered laminin 5 expression due to mutations in the gene encoding the [beta]3 chain (LAMB3) in generalized atrophic benign epidermolysis bullosa. J. Invest. Dermatol. 104: 467-474.

13 Kivirikko S., McGrath, J.A., Baudoin, C., Aberdam, D., Ciatti, S.., Dunnill, M.G.S., McMillan, J.R., Eady, R.A.J., Ortonne, J.-P., Meneguzzi, G., Uitto, J. and Christiano, A.M. (1995) A homozygous nonsense mutation in the [alpha]3 chain gene of laminin 5 (LAMA3) in lethal (Herlitz) junctional epidermolysis bullosa. Hum. Mol. Genet. 4: 959-962.

14 Vidal, F., Aberdam, D., Christiano, A.M., Uitto, J., Ortonne, J-P and Meneguzzi, G. (1995) Mutations in the gene for the integrin [beta]4 subunit are associated with junctional epidermolysis bullosa with pyloric atresia. Nature Genet. 10: 229-234.

15 McGrath, J.A., Gatalica, B., Christiano, A.M., Li, K., Owaribe, K., McMillan, J.R., Eady, R.A.J. and Uitto, J. (1995) Mutations in the 180-kDa bullous pemphigoid antigen (BPAG2), a transmembrane hemidesmosomal collagen (COL17A1), in generalized atrophic benign epidermolysis bullosa. Nature Genet. 11: 83-86. MEDLINE Abstract

16 Magewu, A.N. and Jones, P.A. (1994) Ubiquitous and tenacious methylation of the CpG site in codon 248 of the p53 gene may explain its frequent appearance as a mutational hot spot in human cancer. Mol. Cell. Biol. 14: 4225-4232.

17 Cooper, D.N. and Youssoufian, H. (1988) The CpG dinucleotide and human genetic disease. Hum. Genet. 78: 151-155.

18 Laird, P.W. and Jaenisch, R. (1994) DNA methylation and cancer. Hum. Mol. Genet. 3: 1487-1495.

19 Pulkkinen, L., Gerecke, D.R., Christiano, A.M., Wagman, D.W., Burgeson, R.E. and Uitto, J. (1995) Cloning of the [beta]3 chain gene (LAMB3) of human laminin 5, a candidate gene in junctional epidermolysis bullosa. Genomics 25: 192-198.

20 McGrath, J.A., McMillan. J.R., Dunnill, M.G.S., Pulkkinen, L., Christiano, A.M., Rodeck, C.H., Eady, R.A.J. and Uitto, J. (1995) Genetic basis of lethal junctional epidermolysis bullosa in an affected fetus: Implications for prenatal diagnosis in one family. Prenatal Diagn. 15: 647-654.

21 Vailly, J., Pulkkinen, L., Miquel, C., Christiano, A.M., Gerecke, D.R., Burgeson, R.E., Uitto, J., Ortonne, J-P. and Meneguzzi, G. (1995) Identification of a one basepair deletion in exon 14 of the LAMB3 gene in a patient with Herlitz junctional epidermolysis bullosa, and prenatal diagnosis in a family at risk for reoccurrence. J. Invest. Dermatol. 104: 462-466.

22 Senapathy, P., Shapiro, M.B. and Harris, N.L. (1990) Splice junctions, branch point sites, and exons: Sequence statistics, identification, and application to genome project. Methods Enzymol. 183: 252-278. MEDLINE Abstract

23 Burgeson, R.E., Chiquet, N., Deutzmann, R., Ekblom, P., Engel, J., Kleinman, H., Martin, G.R., Meneguzzi, G., Paulsson, M., Sanes, J., Timpl, R., Tryggvason, K., Yamada, Y. and Yurchenko, P.D. (1994) A new nomenclature for laminins. Matrix Biol. 14: 209-211.

24 Cui Y., Hagan, K.W., Zhang, S. and Peltz, S.W. (1995) Identification and characterization of genes that are required for the accelerated degradation of mRNAs containing a premature translational termination codon. Genes Dev. 9: 423-436.

25 Urlaub, G., Mitchell, P.J., Ciudad, C.J. and Chasin, L.A. (1989) Nonsense mutations in the dihydrofolate reductase gene affect RNA processing. Mol. Cell Biol. 9: 2868-2880.

26 Noakes, P.G., Miner, J.H., Gautam, M., Cunningham, J.M., Sanes, J.R. and Merlie, J.P. (1995) The renal glomerulus of mice lacking S-laminin/laminin [beta]2: nephrosis despite molecular compensation by laminin [beta]1. Nature Genet. 10: 400-405.

27 McGrath, J.A., Kivirikko, S., Ciatti, S., Moss, C., Dunnill, M.G.S., Eady, R.A.J., Rodeck, C.H., Christiano, A.M. and Uitto, J. (1995) A homozygous nonsense mutation in the [alpha]3 chain of laminin 5 (LAMA3) in Herlitz junctional epidermolysis bullosa: prenatal exclusion in a fetus at risk. Genomics 29: 282-284. MEDLINE Abstract

28 Vidal, F., Baudoin, C., Miquel, C., Christiano, A.M., Uitto, J., Ortonne, J.-P. and Meneguzzi, G. (1995) Cloning of the laminin [alpha]3 chain and identification of a homozygous deletion in a patient with Herlitz junctional epidermolysis bullosa. Genomics 30: 273-280. MEDLINE Abstract

29 McGrath, J.A., Kivirikko, S., Ciatti, S., Moss, C., Christiano, A.M. and Uitto, J. (in press) A recurrent homozygous nonsense mutation in the LAMA3 gene in Herlitz junctional epidermolysis bullosa patients of Pakistani origin: evidence for a founder effect. J. Invest Dermatol.

30 Vailly, J., Pulkkinen, L., Christiano, A.M., Tryggvason, K., Uitto, J., Ortonne, J-P. and Meneguzzi, G. (1995) Identification of a homozygous exon skipping mutation in the LAMC2 gene in a patient with Herlitz's junctional epidermolysis bullosa. J. Invest. Dermatol. 104: 434-437.

31 Baudoin, C., Miquel, C., Gagnoux-Palacios, L., Pulkkinen, L., Christiano, A.M., Uitto, J., Tadini, G., Ortonne, J-P. and Meneguzzi, G. (1994) A novel homozygous nonsense mutation in the LAMC2 gene in patients with the Herlitz junctional epidermolysis bullosa. Hum. Mol. Genet. 3: 1909-1910.

32 Verrando, P., Blanchet-Bardon, C., Pisani, A., Thomas, L., Cambazard, F., Eady, R.A.J., Schofield, O.M.V. and Ortonne, J-P. (1991) Monoclonal antibody GB3 defines a widespread defect of several basement membranes and a keratinocyte dysfunction in patients with lethal junctional epidermolysis bullosa. Lab. Invest. 64: 85-92.

33 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

34 Pulkkinen, L., McGrath, J.A., Christiano, A.M. and Uitto, J. (1995) Detection of sequence variants in the gene encoding the [beta]3 chain of laminin 5 (LAMB3) by heteroduplex analysis of PCR amplified segments. Hum. Mutat. 6: 77-84.

35 Ganguly, A., Rock, M.J. and Prockop, D.J. (1993) Conformation-sensitive gel electrophoresis for rapid detection of single-base differences in double-stranded PCR products and DNA fragments: evidence for solvent-induced bends in DNA heteroduplexes. Proc. Natl Acad. Sci. 90: 10325-10329.

36 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl Acad. Sci USA. 74: 5463-5467.

37 McGrath, J.A., Christiano, A.M., Pulkkinen, L., Eady, R.A.J. and Uitto, J. (in press) Compound heterozygosity for nonsense and missense mutations in the LAMB3 gene in non-lethal junctional epidermolysis bullosa. J. Invest. Dermatol.

38 Matsui, C., Nelson, C.F., Hernandez, G.T., Herron, G.C., Bauer, E.A. and Hoeffler, W.K. (1995) [gamma]2 chain of laminin-5 is recognised by monoclonal antibody GB3. J. Invest Dermatol. 105: 648-652. MEDLINE Abstract

*To whom correspondence should be addressed at: Department of Dermatology and Cutaneous Biology, Jefferson Medical College, 233 S. 10th Street, Suite 450, Philadelphia, PA 19107-5541, USA

This page is maintained by OUP admin. Last updated Thu Oct 31 15:21:55 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Med. Genet.Home page
R Varki, S Sadowski, E Pfendner, and J Uitto
Epidermolysis bullosa. I. Molecular genetics of the junctional and hemidesmosomal variants
J. Med. Genet., August 1, 2006; 43(8): 641 - 652.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
M. C. Ryan, K. Lee, Y. Miyashita, and W. G. Carter
Targeted Disruption of the LAMA3 Gene in Mice Reveals Abnormalities in Survival and Late Stage Differentiation of Epithelial Cells
J. Cell Biol., June 14, 1999; 145(6): 1309 - 1324.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
C. Matsui, P. Pereira, C. K. Wang, C. F. Nelson, T. Kutzkey, C. Lanigan, D. Woodley, M. Morohashi, E. A. Welsh, and W. K. Hoeffler
Extent of Laminin-5 Assembly and Secretion Effect Junctional Epidermolysis Bullosa Phenotype
J. Exp. Med., April 20, 1998; 187(8): 1273 - 1283.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
P. B. Robbins, Q. Lin, J. B. Goodnough, H. Tian, X. Chen, and P. A. Khavari
In vivo restoration of laminin 5 beta 3 expression and function in junctional epidermolysis bullosa
PNAS, April 24, 2001; 98(9): 5193 - 5198.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (59)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kivirikko, S.
Right arrow Articles by Christiano, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kivirikko, S.
Right arrow Articles by Christiano, A. M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?