Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (61)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wilson, P. J.
Right arrow Articles by Haines, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilson, P. J.
Right arrow Articles by Haines, J. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 249-256

Novel mutations detected in the TSC2 gene from both sporadic and familial TSC patients
Introduction
Results
   RT-PCR assays for the TSC2 gene
   Scanning for mutations in the TSC2 gene by SSCP analysis
   Identification of TSC2 mutations
   Clinical findings
Discussion
Materials And Methods
   Patient samples
   cDNA synthesis
   Primary PCR assays
   SSCP analysis
   DNA sequencing
Acknowledgements
References


Novel mutations detected in the TSC2 gene from both sporadic and familial TSC patients

Novel mutations detected in the TSC2 gene from both sporadic and familial TSC patients Peter J. Wilson, Vijaya Ramesh, Arthur Kristiansen, Catherine Bove, Serguisy Jozwiak1, David J. Kwiatkowski2, M. Priscilla Short3 and Jonathan L. Haines*

Molecular Neurogenetics Unit, MGH East, Building 149, 13th Street, Charlestown, MA 02129, USA, 1Division of Child Neurology, Children's Health Center, Warsaw, Poland, 2Division of Experimental Medicine, Brigham and Women's Hospital, Boston, MA 02115, USA and 3Department of Pediatric Neurology, 5841 South Maryland Ave, Chicago, IL 60637, USA

Received September 27, 1995; Revised and Accepted November 17, 1995

Tuberous sclerosis (TSC) is an autosomal dominant disorder characterized by hamartomas in one or more organs, including the brain, skin, heart and kidneys. Linkage studies have shown locus heterogeneity with one TSC gene mapped to chromosome 9q34 and a second to 16p13.3. The gene on 16p13.3, TSC2, has been cloned and shown to encode a 5.5 kb transcript that is widely expressed. To facilitate the search for mutations in the TSC2 gene product, tuberin, we have designed an RT-PCR-based assay system to scan the expressed coding region of the TSC2 gene in lymphoblasts. Using 34 overlapping PCR assays we performed single-strand conformation polymorphism analysis of DNA from 26 apparently sporadic TSC cases, two TSC families non-informative for linkage analysis and two confirmed chromosome 16-linked TSC families. Of the 60 chromosomes scanned, 14 showed abnormal SSCP mobility shifts. Using direct PCR sequencing we have identified five missense mutations, one 3 bp in-frame deletion and one 2 bp frameshift deletion, one nonsense mutation, one 29 bp tandem duplication and five silent nucleotide changes that are likely to be polymorphisms. There is no apparent clustering of mutations within TSC2. The diversity of mutation types argues that TSC2 may not act in a classic tumor suppressor fashion. In addition, we saw no specific correlation between the different mutations and clinical severity or expression. These data confirm that TSC2 is indeed the relevant gene, and that a substantial number of sporadic cases arise from mutations in the TSC2 gene.

INTRODUCTION

Tuberous sclerosis complex (TSC) is a multisystem disorder characterized by the widespread development of tumor-like growths known as hamartomas usually occurring in the brain, eyes, skin, kidneys, lungs, heart and skeleton (1 ,2 ). It is the unpredictable distribution of these lesions that is thought to result in the broad range of clinical phenotypes seen in this disease even within the same family (3 ). Seizures are the most common neurologic symptom of TSC occurring in 80-90% of all cases (3 ). In addition to the lesions and seizures, delayed psychomotor development and behavioral problems, especially of an autistic type, have been reported (4 ).

TSC is inherited as an autosomal dominant disease with an incidence of approximately 1 in 10 000 in the population (5 ); however, between one-half to three-quarters of patients appear as sporadic cases (6 ,7 ). Linkage studies have shown locus heterogeneity for TSC, with disease determining genes on chromosomes 9 (TSC1) and 16 (TSC2) (8 -15 ). Frequent loss of heterozygosity for alleles in 16p13.3 and rare loss in 9q34 has been observed in hamartomas from TSC patients indicating that a second somatic mutation may be required to produce the TSC phenotype at the cellular level (16 -18 ). This observation is consistent with the TSC1 and TSC2 genes acting as growth suppressors in a manner similar to other tumor suppressor genes (19 -21 ).

The TSC2 gene in chromosome 16p13.3 has been isolated by positional cloning, and large intragenic deletion mutations within this gene have been demonstrated in several TSC cases (22 ). The 5.5 kb TSC2 transcript encodes a 1784 amino acid protein (tuberin) with little similarity to other known genes. To optimize the search for mutations in the TSC2 gene, we have designed a set of 34 overlapping PCR assays that encompass the entire expressed TSC2 gene in lymphoblasts (exons 25 and 31A are alternatively spliced in lymphoblasts and so were not specifically examined in this study) (23 ,24 ). Using this system we have scanned the TSC2 gene in 26 apparently sporadic TSC cases, two TSC families of unknown linkage and patients from two chromosome 16-linked TSC families and have identified multiple independent mutations that appear to be distributed randomly across the TSC2 gene.

RESULTS

RT-PCR assays for the TSC2 gene

Using cDNA derived from lymphoblasts of both patients and controls three primary overlapping PCR products were generated to encompass the expressed TSC2 gene, consisting of a 2074, 2388 and 1533 bp PCR product. Utilizing the primary products as templates, secondary PCR was performed with 34 overlapping primer sets (Table 1 ) designed to yield product sizes optimal for single-strand conformation polymorphism (SSCP) analysis. All assays were run under a standardized set of amplification conditions, varying only the annealing temperature and the addition of 10% DMSO to optimize results.

Table 1 SSCP PCR assay
Primer #1 (5'-3')

Primer #2 (5'-3')

Product

Temp.1

 

 

(bp)

(oC)

TCCACCATGGCCAAACCAACAAGC

TCCAGAGTGCTTCCACTGCGTGCT

253

67

GGGCAGATTTGTGAAGTCGCAAAA

AAACCTCCAGCCTTTCGTGAAGGT

244

67

CATCAAGGATTACCCTTCCAACGA

GATCATCTGAACCATCCTTGCGAT

229

67

TCAATAGCTGTTACCTCGACGAGT

GGTTCCGCATCAGCTTCCAGCAAG

231

60

CATCAACGTCAAGGAGCTCTGCGA

TAAAATGATGGAAACACAGATGTC

235

60

CACCGGCTCTATTCTCTCAGGAAC

GTTCGATGATGTTCAGCAGAATGT

181

60

AACGAGGTGGTGTCCTATGAGATC

CCCGTGGAACTCGTTCTGGTCACA

216

67

TGACCTGTTGACCACGGTGGAGGA

AGCACGTCCAGCACCTTGATGCGC

252

67

GATTCTTCAGGAGCGAGTCCCGAG

TTGAAGTGGTGTGTGTGGCAGCCC

212

67

AAAGCTGGCCACCCAGTTGCTGGT

AGCATCTCATACACACGCGTGGCG

255

67

CCAAGCTGTACACCCTGCCTGCAA

TCTCTGGCTCCATGTAGTCGCAGA

240

65

TGCAGGCCTTTGACTTCCTGTTGC

CAGGAGGCCCTGTGGGAGGAGAAA

177

65

GAGGCTCTGAGAAGAAGACCAGCG

GATGAGCACTTTATAGCGCAGGGA

213

68*

TGAAGCTGGTTCTGGGCAGGCTGC

CGCTGTTTGGTTTTGTCCAGGTAG

241

65

GCTGACAGCATTAATCTCTTACCA

GAACTCCAGCAGTGGGACGGCCAT

232

65

AAGCTCACGCACATCTCAGCCACA

AAGGGCAGGCGGCACCTGATGAAC

227

65

TCTGGCCCATCACGTCATAGCCAT

AATTCTTTCACGGGTGGAGAGTTA

237

65

AGCCAGACCCCCCAAACAAGGCTT

AGCCATCATGTCCAGACAGGTTTC

247

67

CAGCTTGGGGTCTGCAGATGAGAA

CTTGTCGTCACAGTGACAAGCTTG

222

65

GCAGGACCAAAACCTGGCTGGTGG

CCTCCTTGGTCTGTCTCACATGCA

159

67

TGCAGTCCGGCCCGGAGTCGAGCT

TTCTCAGGTTTCGCGGCTGGTGCA

241

68*

GCAGTGCCACTTCTCCAGGACCAC

TGTTGTTGATGTCCGAGGAGAAAG

225

65*

TGATGAGCCTGGAGAACCCGCTCA

AGCACAGGAACCTCGCCCGGACTT

238

67

AACACAGACTCCGCCGTGGTCATG

CTGGCTGGAGACTGAGGACGACCT

150

65

TGGACAGGCGCACGGATGCCTACA

GATGTCCTGCAGAGTCTGCAGCTC

231

65*

ATCCCCATCGAGCGAGTCGTCTCC

ACCAGGCAGCACTTTCCCCGTCCA

223

67

TTAAGGCCCGGTCACAGTCAGGGA

GGAGGCTGTGGCTCTGCTCTTTAA

221

67

AGGGGCAAGAGAGTAGAGAGGGAC

TTCTCCAACATACAGGACGGCGAT

246

67

AGATCCCATCATACGACACCCACA

CAGTAGGTGAACTGGCCGTCCTCA

220

70

TACCTGGGAGGCCTGGACGTGTGT

CGGAGTCATTGTAGACAATGGACA

184

67

CATCATGCAAGCCGTCTTCCACAT

TGTCTTTCCTGCACTGCAGGGACA

233

67

CCCGCTGGACTACGAGTGCAACCT

TTGATGTGGCGGAGCCGGGCAATC

223

70

CCACCGATATCTACCCCTCCAAGT

TTCCGCTGGCCCACCTCATAGCCA

187

67

ATAGCAAAGCCCCTGCACAGACTC

ATTTCACTGACAGGCAATACCGTC

161

67

1Annealing temperature for PCR reactions.*PCR reactions with 10% DMSO.

Scanning for mutations in the TSC2 gene by SSCP analysis


Figure 1. Representative SSCP analyses. For each RT-PCR product analyzed a normal denatured control (lane 2 in a and lane 3 in b) and a non-denatured control (ND; a, lane 3 and b, lane 4) were included to indicate the expected and observed banding pattern. The SSCPs not presented here are available upon request.


Figure 2. Direct DNA sequence analysis of the SSCP mobility shifts indicated in Figure 1a; lane 1 and sequence from a pCR script clone containing the relevant PCR product indicated from the SSCP mobility shift in Figure 1b, lane 2. The sequencing data for the other characterized mutations is available upon request. (a) (TSC-115) indicates a single base pair substitution, two nucleotides, the mutant T (indicated by the arrow) and normal G are seen at the same position due to the presence of the normal allele in direct PCR sequencing (the sequence is from the 3' direction). (b) (TSC-077), the site of the 3 bp deletion is indicated by the boxed nucleotides, this deletion does not change the reading frame of TSC2.We have used the PCR assays to scan the expressed tuberin coding sequence for mutations using RNA extracted from transformed peripheral blood leukocytes. SSCP analysis was applied to the RNA from 30 TSC patients. SSCP analysis of the expressed coding region of the TSC2 gene in 30 affected TSC patients revealed 14 unique SSCP mobility shifts. Representative results of the SSCP analyses for two of the PCR assays are shown in Figure 1 (a,b). For each assay a lane of PCR product was run without denaturation (ND) to identify fully reannealed, double-stranded DNA in the test lanes. The other bands in the test lanes represent various conformations of the single-stranded DNAs in the product. For PCR assay 32, sporadic patient TSC-115 (Fig. 1 a; lane 1) displays an abnormal mobility shift when compared with the denatured control (lane 2) and the non-denatured control (ND; lane 3). For PCR assay 28, both sporadic patient TSC-077 (Fig. 1 b; lane 1) and familial patient TSC-442 (Fig. 1 b; lane 2) display mobility shifts when compared with the normal denatured (lane 3) and non-denatured control (ND; lane 4). Both normal and altered PCR products were compared by direct DNA sequence analysis to identify the precise base change(s) involved (Figs 2 a,b and 3 ).


Identification of TSC2 mutations

The appropriate PCR products from the observed SSCP shifts were PCR amplified and prepared for direct DNA sequencing. Five of the shifts, including two chromosome 16-linked familial patients (TSC-001 and TSC-028) and one of the unknown linkage TSC families (TSC-382), revealed missense mutations (Table 2 ). These changes were all unique and resulted in non-conservative amino acid substitutions. To determine if these changes were related to the disease we carried out SSCP on 50 normal controls using the relevant exons and observed no abnormal mobility shifts when compared with the mutants (primers were designed from intronic sequence communicated by J. Sampson). The mutations that were observed in chromosome 16-linked families were further confirmed by observing that these changes segregated with other affected family members (Fig. 4 ). Two of these changes occurred in the same exon, exon 37 (Table 2 ).

Table 2 TSC2 mutations in both sporadic and familial patients
Patient

Exon

DNA sequence

Codon

Consequence

 

 

alteration

change

TSC-001

E29

3616 C-T

Arg1199Trp

Missense

TSC-028

E12

1365 G-C

Met449Iso

Missense

TSC-115

E37

5084 C-A

Ala1689Glu

Missense

TSC-117

E37

5075 C-T

Pro1186Leu

Missense

TSC-382

E16

1849 C-T

Arg611Trp

Missense

TSC-037

E14

1531 C-T

Arg505X

Nonsense

TSC-086

E10

1112 to 1113

Iso365fs >

Frameshift

 

 

del 2 bp (TC)

385X

 

TSC-077

E33

4474 to 4476

Phe1486

In frame deletion

 

 

del 3 bp (TTC)

 

 

TSC-422

E34

4519-4547

Leu1510fs>

Frameshift

 

 

29 bp tandem duplication

1541X

Numbering of bases showing alteration is given relative to the cDNA sequence with the initiator ATG beginning at base 19. All coding sequence bases are given in upper case. For deletions, the span of deleted bases (numbered as above) is given, followed by the deletion size (`del'). For deletions of less than 5 bp, the deleted bases are also named.Original amino acid and position of the residues in the protein (numbered from the initiator Met as 1) is followed by new amino acid for missense mutation, X for nonsense mutation, or fs for frameshift, followed by the position of the next in frame stop codon.


Figure 3. Sequence analysis of SSCP mobility shift from Figure 1b, lane 1 (TSC-422). The arrows indicate the 29 bp region that has been duplicated. The location of the arrows denotes a starting point for the duplication at nucleotide position 4445 according to the numbering of ref. 23. One nonsense mutation was detected in the remaining unknown linkage TSC family (TSC-037) resulting in a predicted truncated protein at Arg505. Two additional mutations were deletions, including a 2 bp deletion resulting in a frameshift (patient TSC-086) and a 3 bp in-frame deletion (patient TSC-077), which resulted in the loss of Phe1486 (Table 2 ). The remaining mutation was a 29 bp tandem duplication occurring at the beginning of exon 34 (patient TSC-422), which also resulted in a frameshift and predicted a prematurely truncated protein. To determine if the duplication was due to a mutation (i.e. a cryptic splice site) occurring in the intronic sequence between exons 33 and 34, the patient genomic DNA sequence was compared with a normal control and found to be identical (data not shown) (TSC2 exon/intron boundaries were personally communicated by J. Sampson). The other five alterations detected by SSCP mobility shifts proved to be silent nucleotide changes resulting in no change to the predicted amino acid (Table 3 ). It is likely that these changes are rare polymorphisms as they were only seen once in 60 chromosomes, but it will be necessary to screen the normal population to determine if these polymorphisms are unique to TSC affected individuals.

Table 3 Summary of presumptive TSC2 polymorphisms
Exon

DNA sequence

Codon

 

alteration

change

E9

889C-T

Lys291Lys

E22

2637G-T

Lys873Lys

E14

1596C-T

Ser526Ser

E22

2598T-C

Phe860Phe

E40

5346G-C

Ser1776Ser

Clinical findings

Table 4 presents a summary of the clinical findings in each of the patients with identified mutations. The only consistent finding is the occurrence of seizures in every patient. It should be noted that the clinical findings even within the two chromosome 16-linked TSC families and unknown linkage TSC families vary substantially.

Table 4 . Summary of TSC patient clinical findings
FAM #

Skin

 

 

 

Brain

 

Eye

EEG

Seizures

Mental

Behavioral

Renal

 

Ashleaf

Adenoma

Subungual

Shagreen

CT

MRI

 

 

 

retardation

problems LD

abnormalities

 

 

sebaceum

fibroma

patch

 

TSC-001

+

-

-

-

-

-

 

-

+

+

 

TSC-001

+

+

-

 

-

+

 

 

 

 

 

 

TSC-001

+

-

-

+

-

-

-

+

+

+

 

 

TSC-028

+

-

+

-

+

 

+

+

+

-

-

 

TSC-028

+

+

-

-

 

 

-

 

+

+

 

 

TSC-028

 

+

+

 

-

 

 

 

 

 

 

+

TSC-028

+

-

-

-

+

 

-

+

+

+

 

 

TSC-115

-

+

+

-

+

 

+

+

+

+

-

+

TSC-117

+

+

+

-

 

+

+

+

+

+

+

+

TSC-382

+

+

+

+

+

 

-

 

+

+

 

+

TSC-037

 

+

+

 

+

 

 

 

+

-

 

 

TSC-037

+

+

+

-

 

 

 

 

+

-

-

 

TSC-086

+

+

-

+

+

+

-

+

+

?

+

-

TSC-077

+

 

-

+

+

 

+

+

+

+

-

-

TSC-422

+

+

-

+

+

 

-

 

+

+

 

+

TSC-422

+

+

+

+

 

 

-

 

-

?

 

+

DISCUSSION


Figure 4. Pedigree of one of the chromosome 16-linked families showing segregation of the mutation.The TSC1 and TSC2 genes are hypothesized to function as classic tumor suppressor genes. Frequent loss of heterozygosity for alleles at 16p13.3 is found in hamartomas from TSC patients (16 -18 ). This is similar to the other phakomatoses, neurofibromotosis type I (NFI) (19 ) and type II (NF2) (20 ) and von Hippel-Lindau disease (VHL) (21 ), which also show this phenomenon and act in a tumor suppressor fashion. If a two-hit mechanism, as proposed by Knudson (25 ), is necessary for a TSC phenotype, then inactivating constitutional mutations would be anticipated and the majority of mutations observed would be ones leading to early truncation of the protein, i.e. nonsense mutations or frameshift mutations (20 ,26 -29 ). Also concordant with the tumor suppressor/two-hit hypothesis is the variability of clinical symptoms between patients carrying the same mutation (e.g. patients in families 1 and 28).

To date, the mutations that have been identified in the TSC2 gene include the five large-scale deletions and five intragenic deletions defined in the original report describing the cloning of the TSC2 gene (22 ) and a further six patients that were described in a subsequent report with deletions including both the TSC2 and PKD1 genes (30 ). In addition, three other mutations have been described, including two single base pair deletions (5110delA and 4591delC) that cause frameshift mutations altering the position of the stop codon and a 156 G -> A transition which destroys a splice site (31 ,32 ).

The approach used in this study, RT-PCR amplification of the expressed coding sequence of the TSC2 gene from lymphoblasts combined with SSCP analysis, identified only nine mutations of a possible 30. Because TSC displays heterogeneity, it is likely that many of the sporadic cases examined here are caused by mutations in the TSC1 gene on chromosome 9, which remains uncharacterized. Estimates from linkage studies in families suggest that about 50% of the cases are related to each locus. If this distribution is representative of sporadic cases as well, then we would expect to observe 13 changes of the 26 sporadic TSC cases examined rather than the five actually observed. In this study the SSCP analysis was carried out under identical conditions for each primer set. Therefore it is quite possible that varying the SSCP conditions could increase sensitivity, and utilizing an alternative mutation scanning technique, such as denaturing gradient electrophoresis (33 ) or chemical cleavage of mismatches (34 ), could detect additional mutations. As some mutations might affect RNA expression or stability, our RT-PCR approach would only amplify the normal message RNA and not detect the mutant form (35 ,36 ). However, large-scale deletions are unlikely as patients included in this study were examined by Southern blot hybridization with the TSC2 cDNA clones and none revealed any altered banding patterns. Additional mutations in the TSC2 gene might be detected by amplifying and scanning each exon from genomic DNA. Alternatively, it may be possible to use polymorphisms within the TSC2 coding sequence to assess genomic vs mRNA levels to imply mutations or provide a means of mutation confirmation. It is also conceivable that some of the mutations lie outside of the coding sequence that we have amplified, either in 5' regulatory elements, within intronic sequences, or in the 3' UTR. Thus the true rate of TSC2 mutations among sporadic patients may still be about 50%.

Three of the nine mutations predict a prematurely truncated protein. We detected a C-T transition at Arg505 which results in a premature stop codon. This mutation results in a severely truncated protein and it is likely that a functional protein is not produced and this mutation is indeed pathological. It is interesting to note that in NF2 there are also a number of examples of C-T transitions within the CpG dinucleotide of the arginine-specifying CGA codon (29 ). In addition to this missense mutation we detected a 2 bp deletion which causes the reading frame of TSC2 to be altered resulting in 20 altered amino acids prior to early protein truncation.

A 3 bp in-frame deletion was detected which results in the loss of a single amino acid Phe1486. The loss of this single amino acid may contribute to the severe clinical phenotype seen in this patient and may suggest that this residue lies in either a functionally or structurally critical domain. Another mutation described in this report involves a 29 bp tandem duplication beginning at exon 34, resulting in a frameshift predicting 40 altered amino acids prior to protein truncation. Mutations with tandem duplications of short stretches of nucleotides are quite rare and have only been reported in the NF1 gene (a 42 bp in-frame duplication within exon 28) (37 ) and the COL2A1 gene (a 45 bp in-frame duplication within exon 48) (38 ). A possible mechanism that could explain the tandem duplication of a limited number of nucleotides is the intrastrand slipped-mispairing model (39 ). This model suggests that mispairing between slipped short homologies (usually a few nucleotides) upon breakage of single-stranded DNA followed by repair synthesis and an additional round of replication will generate a tandem duplication. A similar model had been proposed to explain the formation of deletions of the same size range (40 ).

Five missense mutations were also identified, Arg1199Trp, Met449Iso, Ala1689Glu, Pro1186Leu and Arg611Trp. Three of these were C-T transitions indicating that the CpG dinucleotides at these positions may be prone to mutation and suggest areas of the tuberin protein critical for its function. None of the changes were in the region of homology to the GAP3-related domain (amino acids 1593-1631) or in the regions bearing homology to other possible functional domains, i.e. leucine zippers and membrane spanning regions (22 ). Until more is known about the function of tuberin via protein studies and until additional mutations have been characterized pin-pointing critical areas, it is difficult to speculate about the exact effects these mutations have on tuberin's function. However, all of the changes are non-conservative substitutions which may suggest that these changes cause either a disruption in the folding of the protein, or somehow alter the protein's stability making it susceptible either to early degradation or post-modification and therefore altering its function as a growth regulator.

Two of the mutations (TSC-001;Arg1199Trp and TSC-028;Met449Iso) were found in chromosome 16-linked families. The other affected and non-affected family members were examined to determine if the mutations segregated as would be expected if the mutation was a potential causative agent for TSC in these families. In both cases the mutation was only present in family members affected with the disease, indicating that this mutation may contribute to TSC in these families.

In contrast to our expectations only three of the nine mutations identified a prematurely truncated protein. Rather, the majority of mutations (five of nine) are apparently expressed missense mutations. As these changes were not found in a population of normal controls (100 chromosomes) and all predicted amino acid substitutions are non-conservative, these mutations likely contribute to the TSC phenotype in these patients. The proportion of missense mutations is similar to findings with the p53 tumor suppressor gene where missense mutations have been reported at a relatively high frequency (41 -43 ), but it is quite different from the mutations found in the other phakomatoses where truncating mutations are far more prevalent (19 -21 ). In p53 the wide spectrum of missense mutations has been shown to disrupt both DNA binding and the stability of the protein which may also be the case for tuberin. Obviously, it will be important to both identify the function of tuberin and the areas of the protein that are crucial for its role as a tumor suppressor. With p53 the identification of a broad spectrum of mutations and the determination of the crystal structure enabled investigators to gain an understanding of how p53 works as a tumor suppressor. It may be that by using a similar approach the role of tuberin in TSC will be elucidated.

We examined the clinical findings in all patients with identified mutations. The only consistent finding is seizures, but this is found in up to 90% of all TSC cases. There is no apparent correlation of findings with mutations in this limited sample. For example, in family 1 the only consistent clinical finding is ashleaf spots, while in family 28 there are no consistent intra-familial findings. However, until mutations are defined in a larger set of patients, correlation between genotype and phenotype will be difficult to discern.

The development of an RT-PCR based system that encompasses the expressed coding sequence of the TSC2 gene should greatly facilitate the cataloging of mutations in TSC2 patients. It is anticipated that a detailed mutational analysis of the TSC2 gene will potentially identify sites particularly prone to alteration. This in turn may pinpoint amino acid residues critical for tuberin function, and may eventually provide a basis for relating genotype alterations with variations in clinical phenotype.

MATERIALS AND METHODS

Patient samples

Both sporadic and familial patients were identified through neurology clinics, referrals from the National Tuberous Sclerosis Association (NTSA) and private physicians. All individuals were clinically examined by a physician knowledgeable about the clinical criteria for TSC, and medical records were obtained and reviewed by one of us (MPS). Additional tests including renal ultrasound, head and abdominal CT scan, retinal examination, and/or brain MRI were obtained when possible. Only individuals meeting standard diagnostic criteria (3 ) for TSC were considered as affected in our analyses.

Blood samples were collected and transformed into lymphoblastoid cell lines using Epstein-Barr virus as previously described (44 ). The ethnic origin of both the TSC patients and controls used in this study was Caucasian. Genomic DNA and cytoplasmic RNA were prepared from the cell lines using standard methods.

cDNA synthesis

Approximately 40 µg total RNA was used in the cDNA synthesis reaction which was as follows, initially 500 ng of random hexamers was added to the total RNA and this was incubated at 70oC for 10 min and placed directly on ice. To this reaction was then added 20 µl 5*first-strand synthesis buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2), 3 µl 10 mM dNTPs, 1 µl BSA (1mg/µl), 6 µl 0.1 M DTT, 2 µl RNasin (Promega) and 2 µl Superscript II Rnase H-reverse transcriptase (200 units/µl, Gibco BRL) made up to a final volume of 100 µl. The reaction was mixed and incubated at room temperature for 10 min, it was then placed at 42oC for 50 min and then heat inactivated at 70oC for 10 min. Finally, the reaction was incubated with 2 µl RNase H (2.5 units/µl; Gibco BRL) for 20 min at 37oC. The cDNA reaction was then extracted once with phenol/chloroform and then once with chloroform/isoamyl alcohol. The supernatant was then ethanol precipitated with an equal vol. 4 M NH4 acetate and 2 vols absolute ethanol. The cDNA pellet was then resuspended in 20 µl TE buffer.

Primary PCR assays

Three primary overlapping PCR products were generated to encompass the entire coding region of the TSC2 gene (Table 1 , primers in bold italics). PCRs were done as follows; 10 µl 10*PCR buffer (100 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2, 500 mM KCl, 0.1% gelatin), 2 µl 2 mM dNTPs, 10 pmol of each primer, 2 U Taq polymerase (Hoffman LaRoche), 10% DMSO and 1 µl cDNA (see previous section), reactions were made up to 100 µl with water, cycles were as follows; the first two overlapping products (2074 and 2388 bp) conditions for 30 cycles were: 92oC for 1 min, 67oC for 2 min and 70oC for 3 min, after an initial denaturation step of 92oC for 2 min. The remaining primary PCR (1533 bp product) was done under the same conditions, but with an annealing temperature of 65oC.

SSCP analysis

SSCP analysis was performed according to the procedure of Orita et al. (45 ) with minor modifications. One µl of the primary PCR product (in some cases a 1 in 10 dilution was made) was used for all the nested sets of primers (Table 1 ). Each 25 µl reaction contained 70 µM of dATP, dCTP, dGTP, dTTP, 2.5 pmol of each primer, 0.2 U Taq polymerase (Hoffman La Roche), 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl2, 50 mM KCl, 0.01% gelatin and 0.2 µl [alpha]-33P-dATP [Amersham; 10 µCi/ml]. Amplification was carried out for 30 cycles as follows; 92oC for 1 min, 60-70oC for 1 min and 70oC for 1 min, after an initial denaturation step at 92oC for 2 min. (NB: where the annealing temperature was 70oC, the annealing/extension step was combined for 1.5 min.) One µl of the labelled amplified DNA was diluted into 9 µl 0.1% SDS and 10 mM EDTA, and an equal vol. of loading dye (95% formamide, 0.5 M EDTA, 0.05% bromophenol blue and 0.05% xylene cyanol) was added. The samples were denatured for 10 min at 95oC and placed immediately on ice prior to loading, the samples were separated on a 0.5*MDE gel according to the manufacturer's specifications (AT Biochem.), typically this was at 6-8 W for 14 h at room temperature. The gels were dried and then exposed to Kodak X-AR film overnight at room temperature.

DNA sequencing

For DNA sequencing PCR amplifications were performed in 100 µl volumes as described for SSCP analysis except for the addition of 200 µM dNTPs, 10 pmol of each primer and the omission of a radioactive nucleotide. The PCR product was directly sequenced without purification. Essentially, 2-5 µl (of the 100 µl reaction) was incubated with 1 unit exonuclease I (USB) and 2 units of shrimp alkaline phosphatase (USB) in a 9 µl reaction vol. at 37oC for 15 min and then 80oC for 15 min. The appropriate primer was added and annealed at 95oC for 3 min and the reaction was placed immediately on ice. The sequencing reactions were performed by the dideoxy chain termination method using Sequenase (T7 DNA polymerase, Amersham USB) under the conditions recommended by the supplier. Both strands of PCR amplified products with SSCP mobility shifts were analyzed in all cases. When it became necessary to separate the alleles, the PCR products were cloned into pCR script (Stratagene) according to the manufacturer's specifications. If the mutation occurred in a defined exon (both boundaries characterized) then the exon was amplified from the patients genomic DNA as an additional confirmation of the mutation. The intronic primer sequences used in this study are available upon request.

ACKNOWLEDGMENTS

We would like to thank Karen Pulaski and Chris Sterner for technical help and discussions. This work was supported by NIH grants RO1-NS24279, NS31535 and a grant from the NTSA. PJW is the Manuel R. Gomez research fellow of the NTSA. We thank Arun Kumar for sharing his results prior to publication. We would also like to thank the families and patients for giving of both time and themselves to make this work possible.

REFERENCES

1 Fitzpatrick, T.B., Szabo, G., Hori, Y., Simone, A.A., Reed, W.B. and Greenberg, M.H. (1968) Arch. Dermatol. 93, 1-6.

2 Mlynarczyk, G. (1991) Ann. N.Y. Acad. Sci. 615, 367-369. MEDLINE Abstract

3 Gomez, M.R. (1988) Tuberous sclerosis. Raven Press, New York.

4 Smalley, S., Tanguay, P., Smith, M. and Gutierrez, G. (1992) J. Autism. Dev. Disord. 22, 339-355. MEDLINE Abstract

5 Weiderholt, W.C., Gomez, M.R. and Kurland, L.T. (1985) Neurology 35, 600-603.

6 Sampson, J.R., Scahill, S.J., Stephenson, J.B., Mann, L. and Connor, J.M. (1989) J. Med. Genet. 26, 28-31. MEDLINE Abstract

7 Osborne, J.P., Fryer, A. and Webb, D. (1991) Ann. N.Y. Acad. Sci. 615, 125-127. MEDLINE Abstract

8 Fryer, A.E., Connor, J.M., Povey, S., Yates, J.R.W., Chalmers, A., Fraser, I., Yates, A.D., Yates, J.R. and Osborne, J. (1987) Lancet i, 659-661

9 Sampson, J.R., Yates, J.R., Pirrit, L.A., Fleury, P., Winship, I., Beighton, P. and Connor, J.M. (1989) J. Med. Genet. 26, 511-516. MEDLINE Abstract

10 Haines, J.L., Amos, J., Attwood, J., Bech-Hansen, N.T., Burley, M., Conneally, P.M.,Connor, J.M., Farsold, R., Fryer, A., Kandt, R., Northrup, H., Osborne, J., Pericak-Vance, M., Povey, S., Sampson, J.R., Short, M.P., Smith, M., Speer, M., Trofatter, J. and Yates, J.R.W. (1991) Ann. N.Y. Acad. Sci., 615, 256-264. MEDLINE Abstract

11 Janssen, L.A., Povey,S., Attwood, J., Sandkuyl, L.A., Lindhoud, D., Flrodman, P., Smith, M., Sampson, J.R., Haines, J.L., Short, M.P., Amos, J., Merkens, E.C., Fleury, P. and Halley, D.J.J. (1991) Am. J. Hum. Genet. 49, 764-772.

12 Povey, S., Janssen, B., Attwood, J., Burley, M., Smith, M., Flodman, P., Morton, N.E., Edwards, J.H., Sampson, J.R., Yates, J., Haines, J.L., Sandkuyl, L.A., Halley, D.J.J., Fryer, A.E., Meuller, R., Al-Ghazali, L., Super, M. and Osborne, J. (1991) Ann. N.Y. Acad. Sci. 615, 298-305. MEDLINE Abstract

13 Northrup, H., Kwiatkowski, D.J., Roach, E.S., Dobyns, W.B., Lewis, R.A., Herman, G.E., Rodriguez, E., Daiger, S.P. and Blanton, S.H. (1992) Am. J. Hum. Genet. 51, 709-720. MEDLINE Abstract

14 Sampson, J.R., Janssen, L.A.J., Sandkuijl, L.A. and the Tuberous Sclerosis Collaborative Group (1992) J. Med. Genet. 29, 861-866. MEDLINE Abstract

15 Kandt, R.S., Haines, J.L., Smith, M., Northrup, H., Gardner, R.J.M., Short, M.P., Dumars, K., Roach, E.S., Steingold, S., Wall, S., Blanton, S.H., Flodman, P., Kwiatkowski, D.J., Jewell, A., Weber, J.L., Roses, A.D. and Pericak-Vance, M.A. (1992) Nature Genet. 2, 37-41. MEDLINE Abstract

16 Green, A.J., Smith, M. and Yates, J.R.W. (1994) Nature Genet. 6, 193-196. MEDLINE Abstract

17 Green, A.J., Johnson, P.H. and Yates J.R.W. (1994) Hum. Mol. Genet. 3, 1833-1834. MEDLINE Abstract

18 Carbonara, C., Longa, L., Grosso, E., Borrone, C., Garre, M.G., Brisigotti, M. and Migone, N. (1994) Hum. Mol. Genet. 3, 1829-1832. MEDLINE Abstract

19 Legius, E., Marchuk, D.A., Collins, F.S. and Glover, T.W. (1993) Nature Genet. 3, 122-126. MEDLINE Abstract

20 Trofatter, J.A., MacCollin, M.M., Rutter, J.L., Murrell, J.R., Duyao, M.P., Parry, D.M., Eldridge, R., Kley, N., Menon, A.G., Pulaski, K., Haase, V., Ambrose, C.M., Munroe, D., Bove, C., Haines, J.L., Martuza, R.L., MacDonald, M.E., Seizinger, B.R., Short, M.P., Buckler, A.J. and Gusella, J.F. (1993) Cell 72, 791-800. MEDLINE Abstract

21 Latif, F., Tory, K., Gnarra, J., Yao, M., Duh, F-M., Orcutt, M.L., Stackhouse, T., Kuzmin, I., Modi, W., Geil, L., Schmidt, L., Zhou, F., Li, H., Wei, M.H., Chen, F., Glenn, G., Choyke, P., Walther, M.M., Weng, Y., Duan, D.-S.R., Dean, M., Glavac, D., Richards, F.M., Crossey, P.A., Ferguson-Smith, M.A., Le Paslier, D., Chumakov, I., Cohen, D., Chinault, A.C., Maher, E.R., Linehan, W.M., Zbar, B. and Lerman, M.I. (1993) Science 260, 1317-1320. MEDLINE Abstract

22 European Chromosome 16 Tuberous Sclerosis Consortium. (1993) Cell 75, 1305-1315.

23 Xu, L., Sterner, C., Maheshwar, M., Wilson, P.J., Nellist, M., Short, P.M., Haines, J.L., Sampson, J.R. and Ramesh, V. (1995) Genomics 27, 475-480. MEDLINE Abstract

24 Kobayashi, T., Nishizawa, M., Hirayama, Y., Kobayashi, E. and Hino, O. (1995) Nucleic Acids Res. 23, 2608-2613. MEDLINE Abstract

25 Knudson, A.G. (1971) Proc. Natl Acad. Sci. USA 68, 820-823. MEDLINE Abstract

26 Wallace, M.R., Anderson, L.B., Saulino, A.M., Gregory, P.E., Glover, T.W. and Collins, F.S. (1991) Nature 353, 864-866. MEDLINE Abstract

27 Wallace, M.R., Marchuk, D.A., Anderson, L.B., Letcher, R., Odeh, H.M., Saulino, A.M., Fountain, J.W., Brereton, A., Nicholson, J., Mitchell, A.L., Brownstein, B.H., and Collins, F.S. (1990) Science 249, 181-186. MEDLINE Abstract

28 Cawthon, R.M., Weiss, R., Xu, B., Viskochil, D., Weiss, R.B., Culver, M., Stevens, J., Robertson, M., Dunn, D., Gesteland, R., O'Connell, P. and White, R. (1990) Cell 62, 193-201. MEDLINE Abstract

29 Rouleau, G.A., Merel, P., Lutchman, M., Sanson, M., Zucman, J., Marineau, C., Hoang-Xuan, K., Demczuk, S., Desmaze, C., Plougastel, B., Pulst, S.M., Lenoir, G., Bijlsma, E., Fahsold, R., Dumanski, J., de Jong, P., Parry, D., Eldridge, R., Aurias, A., Delattre, O. and Thomas, G. (1993) Nature 363, 515-521. MEDLINE Abstract

30 Brook-Carter, P.T., Peral, B., Ward, C.J., Thompson, P., Hughes, J., Maheshwar, M.M., Nellist, M., Gamble, V., Harris, P.C. and Sampson, J.R. Nature Genet. 8, 328-332. MEDLINE Abstract

31 Kumar, A., Wolpert, C., Kandt, R.S., Segal, J., Pufky, J., Roses, A.D., Pericak-Vance, M.A., and Gilbert, J.R. (1995) Hum. Mol. Genet. 4, 1471-1472. MEDLINE Abstract

32 Kumar, A., Kandt, R.S., Wolpert,C., Roses, A.D., Pericak-Vance, M.A. and Gilbert, J.R. (1995) Hum. Mol. Genet., in press.

33 Myers, R.M., Lumelsky, N., Lerman, L.S. and Maniatus, T. (1985) Nature 313, 495-498. MEDLINE Abstract

34 Cotton, R.G.H. (1992) Curr. Opin. Biotech. 3, 24-30.

35 Dietz, H.C. and Kendzior, R.J. (1994) Nature Genet. 8, 183-188. MEDLINE Abstract

36 Muhlrad, D. and Parker, R. (1994) Nature 370, 578-581. MEDLINE Abstract

37 Tassabehji, M., Strachan, T., Sharland, M., Colley, A., Donnai, D., Harris, R., Thakker, N. (1993) Am. J. Hum. Genet. 53, 90-95. MEDLINE Abstract

38 Tiller, G.E., Rimoin, D.L., Murray, L.W. and Cohn, D.H. (1990) Proc. Natl Acad. Sci. USA 87, 3889-3893. MEDLINE Abstract

39 Roth, D.B., Porter, T.N. and Wilson, J.H. (1985) Mol. Cell Biol. 5, 2599-2607. MEDLINE Abstract

40 Efstratiadis, A., Posakony, J.W., Maniatis, M., Lawn, R.M., O'Connell, C., Spritz, R.A., DeRiel, J.K., Forget, B.G., Weissman, S.W., Slightom, J.L., Blechl, A.E., Smithies, O., Baralle, F.E., Shoulders, C.C. and Proudfoot, N.J. (1980) Cell 21, 653-668. MEDLINE Abstract

41 Toguchida, J., Yamaguchi, T., Ritchie, B., Beauchamp, R.L., Dayton, S.H., Herrera, G.H., Yamamuro, T., Kotoura, Y., Sasaki, M.S., Little, J.B., Weichselbaum, R.R., Ishizaki, K. and Yandell, D.W. (1992) Cancer Res. 52, 6194-6199. MEDLINE Abstract

42 Baker, S., Presinger, A., Jessup, J., Paraskeva, C., Markowitz, S., Willson, J., Hamilton, S. and Vogelstein, B. (1990) Cancer Res. 50, 7717-7722. MEDLINE Abstract

43 Chiba, I., Takahashi, T., Nau, M., D'Amico, D., Curiel, D., Mitsudomi, T., Buchhagen, D., Carbone, D., Piantadosi, S., Koga, H., Reissman, P., Slamon, D., Holmes, E. and Minna, J. (1990) Oncogene 5, 1603-1610. MEDLINE Abstract

44 Anderson, M.A. and Gusella, J.F. (1984) In Vitro 20, 856-858. MEDLINE Abstract

45 Orita, M., Suzuki, Y., Sekiya, T. and Hayashi, K. (1989) Genomics 5, 874-879. MEDLINE Abstract


*To whom correspondence should be addressed


This page is maintained by OUP admin. Last updated Thu Oct 31 15:21:55 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Child NeurolHome page
V. Wong
Study of the Relationship Between Tuberous Sclerosis Complex and Autistic Disorder
J Child Neurol, March 1, 2006; 21(3): 199 - 204.
[Abstract] [PDF]


Home page
NeurologyHome page
P. B. Crino and E. P. Henske
New developments in the neurobiology of the tuberous sclerosis complex
Neurology, October 22, 1999; 53(7): 1384 - 1384.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
M. van Slegtenhorst, S. Verhoef, A. Tempelaars, L. Bakker, Q. Wang, M. Wessels, R. Bakker, M. Nellist, D. Lindhout, D. Halley, et al.
Mutational spectrum of the TSC1 gene in a cohort of 225 tuberous sclerosis complex patients: no evidence for genotype-phenotype correlation
J. Med. Genet., April 1, 1999; 36(4): 285 - 289.
[Abstract] [Full Text]


Home page
ThoraxHome page
S. Johnson
Rare diseases bullet  1: Lymphangioleiomyomatosis: clinical features, management and basic mechanisms
Thorax, March 1, 1999; 54(3): 254 - 264.
[Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. E. Clurman and P. Porter
New insights into the tumor suppression function of P27Kip1
PNAS, December 22, 1998; 95(26): 15158 - 15160.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Soucek, R. S. Yeung, and M. Hengstschlager
Inactivation of the cyclin-dependent kinase inhibitor p27 upon loss of the tuberous sclerosis complex gene-2
PNAS, December 22, 1998; 95(26): 15653 - 15658.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Soucek, O. Pusch, R. Wienecke, J. E. DeClue, and M. Hengstschlager
Role of the Tuberous Sclerosis Gene-2 Product in Cell Cycle Control. LOSS OF THE TUBEROUS SCLEROSIS GENE-2 INDUCES QUIESCENT CELLS TO ENTER S PHASE
J. Biol. Chem., November 14, 1997; 272(46): 29301 - 29308.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
M. v. Slegtenhorst, R. d. Hoogt, C. Hermans, M. Nellist, B. Janssen, S. Verhoef, D. Lindhout, A. v. d. Ouweland, D. Halley, J. Young, et al.
Identification of the Tuberous Sclerosis Gene TSC1 on Chromosome 9q34
Science, August 8, 1997; 277(5327): 805 - 808.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
G.-H. Xiao, F. Shoarinejad, F. Jin, E. A. Golemis, and R. S. Yeung
The Tuberous Sclerosis 2Gene Product, Tuberin, Functions as a Rab5 GTPase Activating Protein (GAP) in Modulating Endocytosis
J. Biol. Chem., March 7, 1997; 272(10): 6097 - 6100.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (61)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wilson, P. J.
Right arrow Articles by Haines, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilson, P. J.
Right arrow Articles by Haines, J. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?