Chaperonin-mediated assembly of wild-type and mutant subunits of human propionyl-CoA carboxylase expressed in Escherichia coli
Chaperonin-mediated assembly of wild-type and mutant subunits of human propionyl-CoA carboxylase expressed in Escherichia coli Todd L. Kelson, Toshihiro Ohura1 and Jan P. Kraus*
Department of Pediatrics, Box C-233, University of Colorado School of Medicine, 4200 E. 9th Avenue, Denver, CO 80262, USA and 1Department of Pediatrics, Tohoku University School of Medicine, Sendai, Japan
Received October 27, 1995;Revised and Accepted January 2, 1996
We developed a bacterial expression system for the human [alpha] and [beta] cDNAs of propionyl-CoA carboxylase (PCC). These cDNAs (less the putative mitochondrial matrix targeting presequences) were co-expressed in Escherichia coli on one plasmid vector with each cDNA having its own IPTG-inducible promoter. Only negligible amounts of active PCC were measured despite the presence of both [alpha] and [beta] subunits as indicated by Western blot analysis and the almost complete biotinylation of the [alpha] subunit. Co-expression of this plasmid with a second plasmid vector over-expressing the E.coli chaperonin proteins, groES and groEL, resulted in a several hundred-fold increase in PCC specific activity, to a level comparable with that found in crude human liver extracts. PCC was partially purified on monomeric avidin affinity resin and the presence of both [alpha] and [beta] subunits was demonstrated, thereby confirming the assembly of both subunits into an active enzyme. Deficiency of either [alpha]PCC or [beta]PCC results in propionic acidemia, an autosomal recessive disorder. We used this expression system to characterize one missense mutation previously described in five Japanese alleles, namely C1283T (Thr428Ile) in [beta]PCC. This mutation, when expressed in E.coli under the same conditions as that of wild-type PCC, had null activity, despite the presence of assembled [alpha]PCC and [beta]PCC subunits. This bacterial expression system can be useful for analysis of either [alpha]PCC or [beta]PCC mutations. Our findings indicated that the groES and groEL chaperonin proteins were essential for folding and assembly of the human PCC heteromeric subunits.
Propionyl-CoA carboxylase (PCC; EC 6.4.1.3) catalyzes the biotin-dependent carboxylation of propionyl-CoA to D-methylmalonyl CoA, a reaction that occurs in the mitochondrial matrix (1 ). PCC is involved in the catabolism of several essential amino acids (methionine, isoleucine, threonine and valine), as well as odd chain fatty acids and cholesterol. Deficiency of PCC results in propionic acidemia, a metabolic disorder characterized by severe metabolic ketoacidosis, vomiting, lethargy and hypotonia.
PCC consists of nonidentical subunits ([alpha] and [beta]) encoded by different genes (PCCA and PCCB, respectively) and probably exists as a dodecamer in its native state ([alpha]6[beta]6) (1 ). Human [alpha]PCC (2 ,3 ) and [beta]PCC (4 -6 ) cDNAs have previously been cloned and characterized. The [alpha]PCC cDNA contains an open reading frame of 2106 nucleotide bases and codes for a 702 amino acid polypeptide. The mature length subunit is 70 kDa and contains the biotin binding site. The PCCA gene has been localized to human chromosome 13 (4 ,7 ). The [beta]PCC cDNA contains an open reading frame of 1617 nucleotide bases encoding a 539 amino acid polypeptide. The mature-length subunit is 56 kDa in size. The PCCB gene has been localized to the long arm of human chromosome 3 (4 ,8 ).
Recombinant [alpha]PCC and [beta]PCC subunits have been expressed in both eukaryotic and prokaryotic expression systems (3 ,6 ,9 ). The full-length wild-type [alpha]PCC cDNA cloned into an eukaryotic expression vector was electroporated into fibroblasts from a propionic acidemia patient having an [alpha]PCC mutation (3 ). Complementation of the defect in [alpha]PCC after plasmid expression led to a reconstitution of PCC activity to a level similar to that found in normal fibroblasts. The full-length [beta]PCC cDNA cloned into a eukaryotic expression vector was microinjected into two separate fibroblast cell lines cultured from two propionic acidemia patients having [beta]PCC mutations (6 ). PCC activity was restored in these cell lines and the mature protein was shown to correctly transport to mitochondria. A truncated [alpha]PCC cDNA containing the terminal 80 amino acids of [alpha]PCC was cloned into a prokaryotic expression plasmid and expressed in E.coli as a means of studying the effect of peptide chain length and the amino acid sequences requisite for [alpha]PCC biotinylation by the E.coli biotin ligase (9 ).
Molecular chaperones, or heat shock proteins, are a class of oligomeric proteins found in various cellular organelles that promote correct folding and assembly of a variety of newly synthesized polypeptides (10 ,11 ). One of the major classes of chaperonins, Hsp60, consists of members that are highly conserved in prokaryotes and eukaryotes (11 ). To date, all known Hsp60 proteins interact with a smaller co-chaperonin, Hsp10. GroEL and groES, the prokaryotic chaperonin members within the Hsp60/10 class, share sequence and functional similarities with the human mitochondrial matrix proteins, cpn60 and cpn10, respectively (12 ). Reconstitution of multimeric enzymes via interaction with groES and groEL has previously been reported for several proteins (13 -18 ).
We describe the construction of a bacterial expression vector that over-expresses functional PCC in the presence of chaperonin proteins and report the usefulness of this system in expressing and characterizing a previously described [beta]PCC mutation.
Mature-length [alpha]PCC and [beta]PCC cDNAs were constructed from the full-length cDNA clones by moving the translation start site downstream to the amino acid residue where the amino terminus of the mature enzyme was postulated to be. The mitochondrial leader sequence serves no known function in bacteria and was removed as a precaution against it inhibiting the proper folding of the expressed subunits. A highly conserved amino acid motif has been reported for the proteolytic cleavage of several mitochondrial targeted proteins (19 ). Using these published consensus sequences and a previous report on rat [beta]PCC (20 ), we hypothesized the proteolytic cleavage site of the putative mitochondrial matrix leader sequence of [alpha]PCC and [beta]PCC. We engineered the expression plasmid so that the initiator methionine of the mature-length [alpha]PCC cDNA corresponded to amino acid residue 26 of the full-length precursor. Translation of this cDNA was driven by the tac promoter from the original PinPoint Xa vector. The tac promoter and ribosomal binding site consensus sequence were localized immediately upstream of the ATG start site. The [beta]PCC cDNA was constructed so that the initiator methionine of the mature-length cDNA corresponded to amino acid residue 31 of the full-length precursor. Translation of [beta]PCC was driven by a trc promoter from the pKK388.1 vector and this promoter and ribosomal binding site were ligated 20 bp upstream of the [beta]PCC cDNA translational start site. Construction of the pGroESL plasmid was described previously (21 ). A diagram of the final plasmid constructs, pGroESL and pPCCAB, is shown in Figure 1 .
Western blot analysis revealed that expression of pPCCAB resulted in the synthesis of [alpha]PCC and [beta]PCC subunits (Fig. 2 , lane 5) similar in size to hepatic [alpha]PCC and [beta]PCC subunits (Fig. 2 , lane 3). There was no cross-reacting material (Fig. 2 , lane 6) and no endogenous PCC activity(Table 1 ) detectable in wild-type E.coli. When crude lysates expressing pPCCAB were assayed for PCC activity, the measured values were similar to those found in wild-type E.coli (Table 1 ). We investigated the properties of this expressed recombinant PCC in order to discover why there was no activity despite the presence of subunits.
In order to determine if chaperonin proteins could assist in the assembly of [alpha] and [beta] subunits, we co-expressed pPCCAB with a plasmid that has previously been shown to synthesize groES and groEL (pGroESL) (21 ). The plasmid, pGroESL, utilizes two different promoters to simultaneously over-express groES and groEL. The lac promoter is induced by isopropyl [beta]-D-thiogalactopyranoside (IPTG); whereas, the heat shock element (HSE) is dependent on temperature for optimal induction.
Co-expression studies were initiated by electroporating pPCCAB and pGroESL into the same E.coli host. PCC activity was assayed in crude lysates and a several hundred-fold increase in PCC specific activity was measured (Table 1 ). In Figure 2 , Western blot analysis of extracts in which only pPCCAB (lane 5) or both pPCCAB and pGroESL (lane 4) were expressed indicated that, in both cases, [alpha]PCC and [beta]PCC subunits were synthesized. Avidin mobility shift assays of lysates co-expressing both pPCCAB and pGroESL demonstrated that the [alpha]PCC subunit was biotinylated to the full extent as previously observed for pPCCAB expression in the absence of pGroESL (Fig. 2 , lane 1). Furthermore, extracts were made from soluble and insoluble material after co-expressing pPCCAB and pGroESL. Analysis of these extracts indicated that the vast majority of the [beta]PCC and [alpha]PCC subunits were in the soluble fraction (results not shown).
Crude lysates obtained after expression of pPCCAB alone (Fig. 3 , lane 1) or pPCCAB together with pGroESL indicated that PCC activity correlated with the over-expression of groES and groEL chaperonin proteins (Fig. 3 , lane 2). When bacterial lysates co-expressing pPCCAB and pGroESL were partially purified on ion-exchange and avidin resins, silver-stained SDS-polyacrylamide gels indicated that [alpha]PCC and [beta]PCC subunits co-purified (Fig. 3 , lane 5). As only the biotin molecule on the [alpha] subunit interacts with avidin, these results confirmed that chaperonin proteins catalyzed the assembly of [alpha]PCC and [beta]PCC subunits into an active multimeric complex capable of binding to avidin.
This bacterial expression system was used to characterize PCC activity and subunit assembly of one mutation (C1283T) previously described in five [beta]PCC alleles in three unrelated Japanese propionic acidemia patients (23 ,24 ). pPCCAB/T428I was co- expressed with pGroESL for time lengths varying from 2 to 18 h. In no case was any PCC activity measured in bacterial homogenates (Table 2 ); however, Western blot analysis demonstrated the presence of [alpha]PCC and [beta]PCC subunits (Fig. 4 A, lane 2). This lysate was applied to a chromatography column containing monomeric avidin resin, washed extensively and eluted with biotin. The results indicate that this inactive PCC consists of assembled [alpha] and [beta] subunits (Fig. 4 B, lane 1). There appears to be some degradation of mutant [beta]PCC as demonstrated by the altered ratio of [alpha]/[beta] subunits in Figure 4 A, lane 2 as compared with wild type (Figure 4 A, lane 1), suggesting that the mutation may result in some instability of this subunit. Our results suggest that, although there is some instability, the T428I missense mutation in [beta]PCC is catalytic in nature as demonstrated by the presence of [beta]PCC subunits and assembly of these subunits with [alpha]PCC.
Our data show that we have expressed and assembled the [alpha] and [beta] subunits of human PCC in E.coli. Previously, we have demonstrated that the ratio of [alpha] to [beta] subunits is not equal due to the instability of the [beta] subunit when not assembled (25 ). We also show this in Figure 2 where the lack of assembly results in the degradation of [beta]PCC (Fig. 2 , lane 5) compared with assembled, active PCC (Fig. 2 , lane 4).
The E.coli chaperonin proteins reportedly prevent misfolding and aggregation of newly synthesized polypeptides resulting in more efficient assembly of oligomer complexes. Other mammalian mitochondrial proteins have been shown to properly fold in the presence of groEL and groES (13 -16 ). Therefore, our findings that PCC requires co-expression of groES and groEL for functional activity would strongly suggest that folding and assembly of mature-length [alpha]PCC and [beta]PCC in vivo is dependent on chaperonin proteins.
To date, 12 mutations have been reported in the [beta]PCC subunit (26 -31 ) and four mutations have been reported in the [alpha]PCC subunit (32 ,33 ). The T428I mutation lies in an exon where three other mutations have previously been described (28 ), suggesting that this exon may be a hot spot for mutations. Two patient fibroblast cell lines that are homozygous for this mutation had decreased amounts of normal size [beta]PCC subunits (23 ,24 ). The authors speculate that their experimental conditions may have influenced the rate of [beta]PCC degradation (24 ). The [alpha]PCC subunit was indistinguishable from normal in these same two patients. We demonstrate here that [beta]PCC T428I is not active in our bacterial expression system, even though [beta]PCC subunits are synthesized and assembled with [alpha]PCC.
Our expression system was used to evaluate the effect of a known mutation on enzyme activity. We anticipate the use of this expression system in evaluating other known [alpha]PCC and [beta]PCC mutations. Furthermore, we find that this system will also be useful to screen for pathogenic mutations hitherto unknown. A method has previously been described which can identify disease causing mutations in cystathionine [beta]-synthase (34 ). Briefly, this method consists of amplifying portions of a patient's cDNA by PCR and then replacing the corresponding segment of normal human cDNA in the bacterial expression vector. This segmental screening method was useful in localizing pathogenic mutations within 7-10 days of harvesting cultured fibroblasts. We anticipate using a similar approach to screen for mutations in either the [alpha]PCC or [beta]PCC cDNA of propionic acidemia patients.
Lamhonwah et al. (6 ) have compared the amino acid sequences of [beta]PCC with those in the 12S subunit of transcarboxylase (TC) from Propionibacterium shermanii. TC consists of three subunits (1.3S, 5S and 12S) and, like PCC, catalyzes the same partial reaction involving propionyl-CoA, albeit in the reverse direction (35 ). The activity involving this partial reaction resides in the 12S subunit of TC. When [beta]PCC and TC 12S were compared in amino acid sequence, it was found that there is a contiguous sequence of 94 amino acids that share 75% identity. Thr428 is evolutionarily conserved between bacteria and humans and lies within this contiguous sequence of high identity, thereby implicating this residue as a significant one for catalytic activity in PCC and TC. Further experiments, including X-ray crystallography, will help delineate the amino acid residues involved in the substrate binding domain of the [beta]PCC subunit as well as those residues involved in the assembly of [alpha]PCC and [beta]PCC. Our expression system provides ample quantities of active PCC that can be used for further structural and functional analyses.
Restriction endonucleases and T4 DNA ligase were purchased from New England Biolabs. AmpliTaq DNA polymerase was obtained from Perkin Elmer. The 5' ends of restricted fragments were made blunt by extending the 3' end with Klenow fragment DNA polymerase (Boehringer Mannheim Corp.). Plasmid DNA was purified using Wizard DNA Purification Systems (Promega). Protogel acrylamide solution was acquired from National Diagnostics. Unless otherwise noted, all chemicals were purchased from Sigma.
Recombinant human [alpha]PCC and [beta]PCC cDNAs were cloned into the PinPoint Xa fusion expression vector (Promega). PinPoint Xa contains an ampicillin resistance marker and a naturally biotinylated fusion protein to assist in the purification of expressed foreign proteins using avidin affinity resin. Since [alpha]PCC is a biotinylated protein, the PinPoint expression vector was modified such that the biotinylated fusion protein was replaced by the [alpha]PCC cDNA. The full-length [alpha]PCC cDNA was previously cloned in the plasmid vector pGem-3Z (Promega). The mature-length cDNA was constructed by placing the initiator methionine in front of the deduced mature amino terminus of the [alpha]PCC cDNA by PCR amplification in a 100 µl of reaction mixture containing 8 µM each of primer 401 (sense, 5'CATGCCATGGGTTCAGTGGGATATGATCC3'), primer 402 (antisense, 5'CTGCTGCCAAACATCTGGC3') and 2.5 U of AmpliTaq DNA polymerase (the nucleotide base pairs in all PCR primers that hybridized to PCC are indicated in bold lettering). The full-length cDNA template was subjected to 1 cycle of 94oC for 5 min followed by 30 cycles of 94oC for 30 s, 50oC for 45 s and 72oC for 60 s in an OmniGene Thermal Cycler (Hybaid). The resulting 330 bp PCR product was digested with NcoI and made blunt. This blunt-ended fragment was digested with ApaI yielding a 250 bp fragment. pGem-3Z-PCCA digested with ApaI/BamHI yielded a 1780 bp fragment corresponding to bases 330-2110 in the full-length [alpha]PCC cDNA. The 250 bp PCR product and the 1780 bp fragment were ligated into the EcoRI (blunt-ended)/BamHI cut PinPoint Xa vector to yield a plasmid (pPCCA) with the mature-length [alpha]PCC cDNA immediately downstream of the PinPoint tac promoter. All ligation products were electroporated into a DH5[alpha] F'IQ E.coli strain (BRL) using an Electro Cell Manipulator 600 electroporator (BTX, Inc.) following the manufacturer's protocols. Transformed E.coli were selected on LB agar plates containing ampicillin (50 µg/ml).
The full-length [beta]PCC cDNA was synthesized by reverse transcription of 1 µg of mRNA and subjected to PCR using primers 1 and 2 (24 ) to amplify the entire coding region from either control (cell line 182) or patient (cell line 187) fibroblasts. Both primers contained an additional eight nucleotides (GCTCTAGA) at the 5' end that encoded artificial XbaI sites to facilitate subcloning of the PCR products. The amplified DNA fragments (1665 bp) were purified on 1% agarose TBE gels, cloned into the pGem-Blue (Promega) plasmid vector and sequenced by the dideoxy sequencing method.
The mature-length [beta]PCC cDNA was engineered from the full-length [beta]PCC cDNA by placing the initiator methionine in front of the deduced mature amino terminus by PCR amplification. The 5' end of the full-length cDNA was amplified using primer 411 (sense, 5'CATGCCATGGCCACCTCTGTTAACG3') and primer 409 (antisense, 5'CCAGCCAAAGACTCCACTCC3'). The full-length [beta]PCC cDNA template was subjected to 1 cycle of 94oC for 5 min followed by 30 cycles of 94oC for 30 s, 62oC for 45 s and 72oC for 60 s. The resulting 430 bp PCR product was digested with NcoI/BamHI yielding a 400 bp fragment. The 1140 bp fragment of the [beta]PCC cDNA 3' end corresponding to bases 500-1640 of full-length [beta]PCC was prepared by BamHI/NotI digestion of the wild-type cDNA. The trc promoter used upstream of the [beta]PCC cDNA was subcloned from pKK388.1 by digesting with BamHI/NcoI. The expression vector, pPCCAB, was constructed by ligating the trc promoter (BamHI/NcoI), the 400 bp PCR product of the 5' end of the [beta]PCC cDNA (NcoI/BamHI) and the 1140 bp fragment corresponding to the 3' end of the [beta]PCC cDNA (BamHI/NotI) into the BamHI/NotI site of pPCCA. This ligation was done in two steps. The ligation products were electroporated as described above.
The plasmid pPCCAB/T428I was constructed by excising a fragment from the full-length [beta]PCC cDNA which had previously been cloned from a patient known to be homozygous for this mutation (cell line 187). The [beta]PCC cDNA carrying this mutation was digested with BglII/PstI and a 1060 bp fragment was gel purified in a 0.8% agarose TBE gel. The gel purified DNA was ligated to a BglII/PstI cut pPCCAB plasmid and ligation products were isolated as described above.
The plasmid pPCCAB/T428I was repaired by removing a small fragment around the region of the mutation and replacing it with a similar fragment excised from the wild-type [beta]PCC cDNA. This was done by digesting pPCCAB/T428I with HindIII/PstI and replacing the 250 bp fragment with the same fragment cut from the wild-type [beta]PCC cDNA. The repaired plasmid was named pPCCAB/I428T.
Co-expression studies were performed by electroporating both pGroESL and pPCCAB into E.coli DH5[alpha] F'IQ cells. The pGroESL plasmid confers resistance to chloramphenicol (21 ). Doubly transformed cells were selected on LB media containing 50 µg/ml ampicillin and 50 µg/ml chloramphenicol.
Bacterial cultures grown to confluence overnight were diluted 1/100 and used to inoculate 0.5 l aliquots of LB media which were grown with shaker aeration at 37oC in the presence of ampicillin (300 µg/ml), chloramphenicol (30 µg/ml) and biotin (5 µM) to a turbidity of ~0.4 at 600 nm prior to induction with 1 mM IPTG (BRL). The induced cells were allowed to grow for 2-24 h before collection. Cells were harvested on ice, collected by centrifugation (10 000 g for 10 min) followed by one washing with phosphate-buffered saline (PBS) and resuspended in 100 mM Tris-HCl, pH 7.5, 1 mM EDTA, 0.1 mM DTT and 1 mg/ml lysozyme followed by stirring for 1 h at 4oC. The lysate was sonicated twice for 5 min each time at 50% duty with a power setting of 3-4 using a model W225 sonicator (Heat-Ultrasonics, Inc.). Cell lysates were cleared by centrifugation at 15 000 g for 15 min and the supernatant (soluble fraction) was collected. The pellet (insoluble fraction) was resuspended in the original volume of Laemmli sample buffer and dissolved by boiling for 5 min.
PCC purification consisted of loading the crude bacterial homogenates on to monomeric avidin resin (SoftLink Soft Release, Promega) using the manufacturer's protocol suggested for PinPoint Xa fusion product purification. Column eluates were concentrated with Centricon-30 Concentrators (Amicon). Crude bacterial homogenates co-expressing pPCCAB and pGroESL were purified by ion-exchange chromatography prior to purification on avidin resin. Purification on ion-exchange resin was done according to previously published methods (36 ).
Proteins were separated by SDS-PAGE as described by Laemmli (38 ) using a 9% separating gel with a 4% stacking gel. Similar amounts of protein (20 µg) were prepared by boiling in Laemmli sample buffer for 5 min and loaded on to polyacrylamide gels. For Western blot analysis, samples were immunoprecipitated overnight before boiling in sample buffer. In all cases, identical amounts of protein (250 µg) were immunoprecipitated with rabbit antihuman PCC antibodies and incubated overnight at 4oC in the same volume of NETS buffer (150 mM NaCl, 10 mM EDTA, pH 7.5, 0.5% Triton X-100 and 0.1% SDS). The following day the antigen-antibody complexes were isolated by incubation in 10% w/v Staphylococcus aureus (Immunoprecipitin, BRL) for 30 min at 25oC. The tubes were centrifuged for 5 min at 15 000 g followed by two washes in RIPA buffer (150 mM NaCl, 10 mM Tris-HCl, pH 7.4, 1% Triton X-100, 1% deoxycholate and 0.1% SDS). Following these washes the samples were boiled in Laemmli sample buffer. In the case of avidin mobility shift assays, the immunoprecipitated samples were boiled in sample buffer, cooled to 37oC and then incubated with 10 µg avidin for 30 min at 37oC. After electrophoresis, the proteins were transferred for 90 min (0.8 mAmps/cm2 membrane) on to nitrocellulose membranes (Schleicher and Schuell) using a semi-dry electroblotting system (Sartorius). The blotted membrane was incubated in 5% nonfat dry milk (Carnation) in PBS, washed briefly with PBS and incubated with shaking, overnight at 4oC with anti-PCC antibodies diluted 1/100 in 3% BSA/PBS. The next day, after extensive washing with PBS/0.05% NP40 and PBS alone, the blot was incubated, with shaking, in 3.5 µCi I125-labeled protein A (Amersham) diluted in 10 ml of 3% BSA/PBS for 3 h at 25oC. After extensive washing, autoradiography was performed at -80oC.
We are grateful to the following for kindly providing us with plasmids: Fred Ledley (Baylor College of Medicine) and Roy Gravel (McGill University) for the [alpha]PCC cDNA plasmids; Jurgen Brosius (Columbia University) for pKK388.1; and Anthony Gatenby (DuPont, Wilmington, DE) for pGroESL. We thank Yoichi Suzuki (Tohoku University) for the gift of the rabbit anti-rat PCC polyclonal sera used in some of these studies. This work was supported by an NIH-NICHD grant to J.P.K (P01HD08315). T.L.K. was supported by an NIH Postdoctoral Research Training grant in Mental Retardation and Developmental Disabilities (T32HD0738505).
1 Fenton, W.A. and Rosenberg, L.E. (1995) In Scriver, C.R., Beaudet, A.L., Sly, W.S. and Valle, D. (eds), The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, Inc., Health Professions Division, New York, 7th edn, Vol. I, pp. 1423-1449.
2 Lamhonwah, A-M., Mahuran, D. and Gravel, R.A. (1989) Human mitochondrial propionyl-CoA carboxylase: localization of the N-terminus of the pro- and mature [alpha] chains in the deduced primary sequence of a full-length cDNA. Nucleic Acids Res.17, 4396.MEDLINE Abstract
3 Stankovics, J. and Ledley, F.D. (1993) Cloning of functional alpha propionyl-CoA carboxylase and correction of enzyme deficiency in pccA fibroblasts. Am. J. Hum. Genet.52, 144-151.MEDLINE Abstract
4 Lamhonwah, A.-M., Barankiewicz, T.J., Willard, H.F., Mahuran, D.J., Quan, F. and Gravel, R.A. (1986) Isolation of cDNA clones coding for the [alpha] and [beta] chains of human propionyl-CoA carboxylase: Chromosomal assignments and DNA polymorphisms associated with PCCA and PCCB genes. Proc. Natl Acad. Sci. USA83, 4864-4868.MEDLINE Abstract
5 Ohura, T., Ogasawara, M., Ikeda, H., Narisawa, K. and Tada, K. (1993) The molecular defect in propionic acidemia: exon skipping caused by an 8-bp deletion from an intron in the PCCB allele. Hum. Genet.92, 397-402.MEDLINE Abstract
6 Lamhonwah, A-M., Leclerc, D., Loyer, M., Clarizio, R. and Gravel, R.A. (1994) Correction of the metabolic defect in propionic acidemia fibroblasts by microinjection of a full-length cDNA or RNA transcript encoding the propionyl-CoA carboxylase [beta] subunit. Genomics19, 500-505.MEDLINE Abstract
7 Kennerknecht, I., Klett, C. and Hameister, H. (1992) Assignment of the human gene propionyl coenzyme A carboxylase, [alpha] chain, (PCCA) to chromosome 13q32 by in situ hybridization. Genomics14, 550-551.MEDLINE Abstract
8 Kraus, J.P., Williamson, C.L., Firgaira, F.A., Yang-Feng, T.L., Munke, M., Francke, U. and Rosenberg, L.E. (1986) Cloning and screening with nanogram amounts of immunopurified mRNAs: cDNA cloning and chromosomal mapping of cystathionine [beta]-synthase and the [beta] subunit of propionyl-CoA carboxylase. Proc. Natl Acad. Sci. USA83, 2047-2051.MEDLINE Abstract
9 Leon-Del-Rio, A. and Gravel, R.A. (1994) Sequence requirements for the biotinylation of carboxyl-terminal fragments of human propionyl-CoA carboxylase [alpha] subunit expressed in Escherichia coli. J. Biol. Chem.269, 22964-22968.MEDLINE Abstract
10 Martinus, R.D., Ryan, M.T., Naylor, D.J., Herd, S.M., Hoogenraad, N.J. and Hoj, P.B. (1995) Role of chaperones in the biogenesis and maintenance of the mitochondrion. FASEB J.9, 371-378.MEDLINE Abstract
11 Wynn, R.M., Davie, J.R., Cox, R.P. and Chuang, D.T. (1994) Molecular chaperones: Heat-shock proteins, foldases and matchmakers. J. Lab. Clin. Med.124, 31-36.MEDLINE Abstract
12 Reading, D.S., Hallberg, R.L. and Myers, A.M. (1989) Characterization of the yeast HSP60 gene coding for a mitochondrial assembly factor. Nature337, 655-659.MEDLINE Abstract
13 Wynn, R.M., Davie, J.R., Cox, R.P. and Chuang, D.T. (1992) Chaperonins groEL and groES promote assembly of heterotetramers ([alpha]2[beta]2) of mammalian mitochondrial branched-chain [alpha]-keto acid decarboxylase in Escherichia coli. J. Biol. Chem.267, 12400-12403.MEDLINE Abstract
14 Zheng, X., Rosenberg, L.E., Kalousek, F. and Fenton, W.A. (1993) GroEL, groES and ATP-dependent folding and spontaneous assembly of ornithine transcarbamylase. J. Biol. Chem.268, 7489-7493.MEDLINE Abstract
15 Saijo, T., Welch, W.J. and Tanaka, K. (1994) Intramitochondrial folding and assembly of medium-chain acyl-CoA dehydrogenase (MCAD). J. Biol. Chem.269, 4401-4408.MEDLINE Abstract
16 Bross, P., Jespersen, C., Jensen, T.G., Andresen, B.S., Kristensen, M.J., Winter, V., Nandy, A., Krautle, F., Ghisla, S., Bolund, L., Kim, J-J.P. and Gregersen, N (1995) Effects of two mutations detected in medium-chain acyl-CoA dehydrogenase (MCAD)-deficient patients on folding, oligomer assembly and stability of MCAD enzyme. J. Biol. Chem.270, 10284-10290.MEDLINE Abstract
17 Persson, M., Aronsson, G., Bergenhem, N., Freskgard, P-O., Jonsson, B-H., Surin, B.P., Spangfort, M.D. and Carlsson, U. (1995) GroEL/ES-mediated refolding of human carbonic anhydrase II: Role of N-terminal helices as recognition motifs for groEL. Biochim. Biophys. Acta1247, 195-200.MEDLINE Abstract
18 Lee, S.C. and Olins, P.O. (1992) Effect of overproduction of heat shock chaperones groESL and dnaK on human procollagenase production in Escherichia coli. J. Biol. Chem.267, 2849-2852.MEDLINE Abstract
19 Hendrick, J.P., Hodges, P.E. and Rosenberg, L.E. (1989) Survey of amino-terminal proteolytic cleavage sites in mitochondrial precursor proteins: Leader peptides cleaved by two matrix proteases share a three-amino acid motif. Proc. Natl Acad. Sci. USA86, 4056-4060.MEDLINE Abstract
20 Kraus, J.P., Firgaira, F., Novotny, J., Kalousek, F., Williams, K.R., Williamson, C., Ohura, T. and Rosenberg, L.E. (1986) Coding sequence of the precursor of the [beta] subunit of rat propionyl-CoA carboxylase. Proc. Natl Acad. Sci. USA83, 8049-8053.MEDLINE Abstract
21 Goloubinoff, P., Gatenby, A.A and Lorimer, G.H. (1989) GroE heat-shock proteins promote assembly of foreign prokaryotic ribulose bisphosphate carboxylase oligomers in Escherichia coli. Nature337, 44-47.MEDLINE Abstract
22 Gravel, R.A., Lam, K.F., Mahuran, D. and Kronis, A. (1980) Purification of human liver propionyl-CoA carboxylase by carbon tetrachloride extraction and monomeric avidin affinity chromatography. Arch. Biochem. Biophys.201, 669-673.MEDLINE Abstract
23 Ohura, T., Miyabayashi, S., Narisawa, K. and Tada, K. (1991) Genetic heterogeneity of propionic acidemia: Analysis of 15 Japanese patients. Hum. Genet.87, 41-44.MEDLINE Abstract
24 Ohura, T., Narisawa, K. and Tada, K. (1993) Propionic acidaemia: Sequence analysis of mutant mRNAs from Japanese [beta] subunit-deficient patients. J. Inher. Metab. Dis.16, 863-867.MEDLINE Abstract
25 Ohura, T., Kraus, J.P. and Rosenberg, L.E. (1989) Unequal synthesis and differential degradation of propionyl-CoA carboxylase subunits in cells from normal and propionic acidemia patients. Am. J. Hum. Genet.45, 33-40.MEDLINE Abstract
26 Lamhonwah, A-M., Troxel, C.E., Schuster, S. and Gravel, R.A. (1990) Two distinct mutations at the same site in the PCCB gene in propionic acidemia. Genomics8, 249-254.MEDLINE Abstract
27 Tahara, T., Kraus, J.P. and Rosenberg, L.E. (1990) An unusual insertion/deletion in the gene encoding the [beta]-subunit of propionyl-CoA carboxylase is a frequent mutation in Caucasian propionic acidemia. Proc. Natl Acad. Sci. USA87, 1372-1376.MEDLINE Abstract
28 Tahara, T., Kraus, J.P., Ohura, T., Rosenberg, L.E. and Fenton, W.A. (1993) Three independent mutations in the same exon of the PCCB gene: Differences between Caucasian and Japanese propionic acidaemia. J. Inher. Metab. Dis.16, 353-360.MEDLINE Abstract
29 Gravel, R.A., Akerman, B.R., Lamhonwah, A.-M., Loyer, M., Leon-Del-Rio, A. and Italiano, I. (1994) Mutations participating in interallelic complementation in propionic acidemia. Am. J. Hum. Genet.55, 51-58.MEDLINE Abstract
30 Perez-Cerda, C., Rodriguez-Pombo, P. and Ugarte, M. (1994) Identification of the insertion/deletion mutation in Spanish [beta]-propionyl-CoA carboxylase-deficient patients. J. Inher. Metab. Dis.17, 661-663.MEDLINE Abstract
31 Loyer, M., Leclerc, D. and Gravel, R.A. (1995) Interallelic complementation of [beta]-subunit defects in fibroblasts of patients with propionyl-CoA carboxylase deficiency microinjected with mutant cDNA constructs. Hum. Mol. Genet.4, 1035-1039.MEDLINE Abstract
32 Campeau, E., Leon-Del-Rio, A. and Gravel, R.A. (1994) Mutations in the PCCA gene encoding the [alpha] subunit of propionyl-CoA carboxylase in patients with propionic acidemia. Am. J. Hum. Genet.Suppl. 55, A41.
33 Campeau, E., Leclerc, D., Dupuis, L. and Gravel, R.A. (1995) Molecular genetics of propionic acidemia: A proposal for deficient biotin carboxylation of the [alpha]-subunit of propionyl-CoA carboxylase. Am. J. Hum. Genet.Suppl. 57, A177.
34 Kozich, V. and Kraus, J.P. (1992) Screening for mutations by expressing patient cDNA segments in E.coli: Homocystinuria due to cystathionine [beta]-synthase deficiency. Hum. Mutat.1, 113-123.MEDLINE Abstract
35 Samols, D., Thornton, C.G., Murtif, V.L., Kumar, G.K., Haase, F.C. and Wood, H.G. (1988) Evolutionary conservation among biotin enzymes. J. Biol. Chem.263, 6461-6464.MEDLINE Abstract
36 Kalousek, F., Darigo, M.D. and Rosenberg, L.E. (1980) Isolation and characterization of propionyl-CoA carboxylase from normal human liver. J. Biol. Chem.255, 60-65.MEDLINE Abstract
37 Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall, R.J. (1951) Protein measurement with the Folin Phenol reagent. J. Biol. Chem.193, 265-275.
38 Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature227, 680-685.MEDLINE Abstract
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Thu Oct 31 15:22:29 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
