Mutations in the Ca2+-sensing receptor gene cause autosomal dominant and sporadic hypoparathyroidism
Mutations in the Ca 2+ -sensing receptor gene cause autosomal dominant and sporadic hypoparathyroidismJeffrey Baron1,*, Karen K. Winer1, Jack A. Yanovski1, Adrienne W. Cunningham1, Louisa Laue1,2, Donald Zimmerman3 and Gordon B. Cutler, Jr1
1Developmental Endocrinology Branch, National Institute of Child Health and Human Development, Building 10 Room 10N262, National Institutes of Health, 10 Center Dr MSC 1862, Bethesda, MD 20892-1862, USA, 2Department of Pediatrics, Georgetown University Medical Center,2PHC 3800 Reservoir Road, N.W., Washington, D.C. 20007, USA and 3Department of Pediatrics, Mayo Clinic, 200 First Street, S.W., Rochester, MN 55905, USA
Received November 24, 1995;Revised and Accepted February 20, 1996
Parathyroid hormone secretion is negatively regulated by a 7-transmembrane domain, G-protein coupled Ca2+-sensing receptor. We hypothesized that activating mutations in this receptor might cause autosomal dominant hypoparathyroidism (ADHP). Consistent with this hypothesis, we identified, in two families with ADHP, heterozygous missense mutations in the Ca2+-sensing receptor gene that cosegregated with the disorder. None of 50 normal controls had either mutation. We also identified a de novo, missense Ca2+-sensing receptor mutation in a child with severe sporadic hypoparathyroidism. The amino acid substitution in one ADHP family affected the N-terminal, extracellular domain of the receptor. The other mutations involved the transmembrane region. Unlike patients with acquired hypoparathyroidism, patients with these mutations had hypercalciuria even at low serum calcium concentrations. Their greater hypercalciuria presumably reflected activation of Ca2+-sensing receptors in kidney cells, where the receptor negatively regulates calcium reabsorption. This augmented hypercalciuria increases the risk of renal complications and thus has implications for the choice of therapy.
Hypoparathyroidism is characterized by hypocalcemia and hyperphosphatemia due to inadequate secretion of parathyroid hormone (PTH). Although most cases are sporadic, some have autosomal dominant, autosomal recessive, or X-linked modes of inheritance. In one family with autosomal dominant inheritance, a mutation in the preproPTH gene has been implicated (1 ).
PTH secretion is regulated by a 7-transmembrane domain, G-protein coupled Ca2+-sensing receptor (2 ). Receptor activation increases intracellular calcium and inositol trisphosphate levels and decreases PTH secretion (2 ). Homozygous inactivating mutations of the human Ca2+-sensing receptor cause neonatal severe hyperparathyroidism. Heterozygous inactivating mutations cause a milder disorder, familial hypocalciuric hypercalcemia (3 ).
Recently, Finegold et al. showed, in one family with asymptomatic hypocalcemia, that the disease cosegregates with markers on chromosome 3q, the region that contains the Ca2+-sensing receptor gene (4 ). Subsequently, Pollack et al. found an activating mutation in the N-terminal, extracellular domain of the Ca2+-sensing receptor in another family with mild, essentially asymptomatic hypocalcemia (5 ). We hypothesized that autosomal dominant hypoparathyroidism with severe hypocalcemia could also result from activating mutations of the Ca2+-sensing receptor.
It was further hypothesized that such activating mutations would occur either in the N-terminal, extracellular region of the receptor, near the mutation responsible for asymptomatic hypocalcemia (5 ), or in the transmembrane domain portion of the receptor, the location of activating mutations in other G-protein coupled receptors (6 -15 ).We also predicted that such mutations would activate Ca2+-sensing receptors not only in the parathyroid gland, leading to decreased PTH secretion, but also in the kidney, leading to hypercalciuria. Finally, we hypothesized that sporadic hypoparathyroidism might be caused by de novo mutations in the Ca2+-sensing receptor.
Affected members of family N had low serum calcium concentrations, elevated serum phosphate concentrations, and low serum levels of parathyroid hormone (Table 1 ). Most of the affected members presented in childhood with seizures or tetany. All affected family members required treatment with calcium and vitamin D. The pedigree suggested autosomal dominant transmission (Fig. 1 ).
Clinical and biochemical characteristics of seven patients with hypoparathyroidism
Subjecta
Serum calciumb
Serum phosphateb
Serum PTH
Clinical featuresd
(mmol/l)
(mmol/l)
N: I-2
1.8 (2.2-2.5)
1.4 (0.83-1.5)
14 [mu]lEq/mlc (<50)
p, m, b, nl
N: II-2
1.9 (2.2-2.5)
2.0 (1.3-1.7)
9 [mu]lEq/mlc (<50)
p, m
N: II-3
1.8 (2.4-2.6)
2.0 (1.2-1.8)
27 [mu]lEq/mlc (<50)
p, m, s
N: III-2
1.9 (2.4-2.6)
2.6 (1.43-1.8)
29 [mu]lEq/mlc (<50)
s, nc
B: II-4
1.7 (2.2-2.55)
1.55 (0.74-1.42)
6 pg/mlc (10-65)
m
B: III-1
2.0 (2.2-2.6)
1.45 (0.81-1.45)
54 pg/mlb (50-330)
m
H: II-4
1.2 (2.2-2.6)
2.94 (1.3-1.9)
<30 pmol/lc (30-100)
m, l, s
aFamily: pedigree designation.bPrior to treatment.cDuring treatment with vitamin D and calcium but while hypocalcemic.dAbbreviations: p, paraesthesias; m, muscle cramps/tetany; l, laryngospasm; s, seizures; nc, nephrocalcinosis; nl, nephrolithiasis; b, basal ganglia calcification. Normal ranges for age (from different laboratories) are given in parentheses.
Affected members of family B had milder symptoms than those in family N, primarily muscle cramps. They did not present to medical attention until adolescence (III-1) or adulthood (II-4). Serum PTH levels were low despite low serum calcium concentration (Table 1 ). The pedigree suggested an autosomal dominant inheritance (Fig. 1 ).
Direct sequencing of PCR-amplified genomic DNA from patient II-4 in family B unexpectedly revealed both a T to A transversion at position 2551 and a G to A transition at position 346 (Fig. 2). The T2551A mutation encodes a cysteine to serine substitution at residue 851 within the seventh transmembrane domain (Fig. 3 ). The mutation also eliminates a recognition site (TGCA) for restriction enzyme CviRI, which allowed the mutant and wild-type alleles to be distinguished by CviRI digestion. Both affected family members were heterozygous for the mutation. However, the mutation was also present in family members I-1 and II-2 who had normal serum calcium, serum phosphate, and urinary calcium levels (data not shown). The other family members showed the homozygous wild-type pattern (Fig. 1 ). Fifty unrelated normal control subjects were also homozygous for the wild-type pattern by CviRI digestion (data not shown).
The second mutation, G346A, encoded an alanine to threonine substitution at residue 116 within the N-terminal, extracellular region of the receptor (Fig. 3 ). The mutation also created a recognition site for restriction enzyme MaeIII, which allowed the mutant and the wild-type alleles to be distinguished by MaeIII digestion. Both affected members of family N were heterozygous for the mutation, whereas the seven unaffected members showed the homozygous wild-type pattern (Fig. 1 ). Fifty unrelated normal control subjects were also homozygous for the wild-type pattern by MaeIII digestion (data not shown).
We measured serum calcium concentration and 24 h urine calcium excretion on the same day in four patients with ADHP from families B and N and 10 patients with acquired hypoparathyroidism (either post-surgical or autoimmune). Measurements were taken during standard therapy with oral calcium and vitamin D. We had hypothesized that patients with ADHP, unlike patients with acquired hypoparathyroidism, would fail to decrease urine calcium excretion when serum calcium was low. Thus, we identified days when each subject's serum calcium was either below normal or in the lower half of the normal range, determined the average serum and urine calcium for each patient on such days, and compared results for patients with ADHP and acquired hypoparathyroidism. The serum calcium levels were similar in the patients with ADHP and those with acquired hypoparathyroidism (1.97 +- 0.05 vs 2.02 +- 0.03 mmol/l, mean +- SEM, p >0.5). However, the corresponding urine calcium excretion was significantly greater in patients with ADHP than in patients with acquired hypoparathyroidism (9.7 +- 1.1 vs 4.6 +- 0.9 mmol/24 h, p <0.007; Fig. 4 ).
The proband in family H had severe hypoparathyroidism, presenting in infancy with hypocalcemic seizures (Table 1 ). Neither her parents nor any of her four siblings were affected (Fig. 1 ). The presence of hypercalciuria, even during hypocalcemia, suggested an activating mutation in the Ca2+-sensing receptor gene.
Direct sequencing of PCR-amplified genomic DNA revealed a heterozygous T to C transition at position 2417 (Fig. 2 ). This mutation encodes a phenylalanine to serine substitution at residue 806, which lies in the sixth transmembrane domain (Fig. 3 ). Because this mutation did not eliminate or create any known restriction site, we evaluated the parents' genotype by directly sequencing their PCR-amplified genomic DNA. Neither parent had the mutation (Fig. 2 ). Sequencing the opposite strand of the PCR products in the proband and her parents confirmed these findings (data not shown). To confirm paternity and maternity, five polymorphic red cell antigens (ABO, Rh, MNS, Kell, Duffy, Kidd) and eight polymorphic HLA loci (A, B, C, DR[beta]1*, DR[beta]3*, DR[beta]4*, DR[beta]5*, DQ[beta]1*) were typed; all were confirmatory.
We discovered Ca2+-sensing receptor gene mutations in two families with ADHP. In family N, there was perfect concordance between the genotype (presence or absence of a mutation) and phenotype (presence or absence of hypoparathyroidism). In family B, we unexpectedly found two mutations. These mutations were probably allelic since they cosegregated in patients II-4 and III-1. Mutation C851S was present in unaffected family members and thus appeared to be a rare, innocent polymorphism. In contrast, the presence or absence of mutation A116T correlated precisely with the phenotype, suggesting that it was responsible for the disease. This mutation arose de novo in patient II-4. We also identified a fourth mutation in the Ca2+-sensing receptor gene in a child with sporadic, severe hypoparathyroidism. Neither of the parents had the mutation which indicated that it arose de novo. All of the mutations occurred in residues conserved between the human and bovine Ca2+-sensing receptors (2 ,16 ).
Four lines of evidence suggest that mutations Q681H, A116T, and F806S are not simply innocent polymorphisms but, instead, activate the receptor and cause the disease:
(i) in the two families with ADHP, there was a perfect correlation between phenotype (presence or absence of disease) and genotype (presence or absence of Q681H or A116T);
(ii) neither of these mutations were observed in 50 normal control individuals;
(iii) one of these mutations, A116T in family B, and an additional mutation, F806S in family H, arose de novo. If hypoparathyroidism in these families were not due to these mutations, then their de novo appearance in the first affected family members would have been coincidental. The probability of such a coincidence, based on the reported frequency of spontaneous germ line mutations (~3 * 10-9 per base-pair per generation) (17 ), and the number of base-pairs examined (<4000), was extremely small, p <0.00002 for each of the two mutations;
(iv) the receptor activation hypothesis predicted an otherwise unexpected phenotype, hypercalciuria even at low serum calcium concentrations. This prediction was tested in vivo and confirmed.
To account for the ADHP phenotype, these mutations must constitutively activate the Ca2+-sensing receptor. Inactivating mutations in the Ca2+-sensing receptor cause parathyroid gland insensitivity to calcium, leading to hypercalcemia in familial hypocalciuric hypercalcemia and severe neonatal hyperparathyroidism (3 ). Conversely, activating mutations of the Ca2+-sensing receptor would be expected to decrease parathyroid hormone secretion and thus to cause hypocalcemia and hyperphosphatemia, the cardinal laboratory features of ADHP.
Pollack et al. demonstrated an activating mutation in the N-terminal, extracellular domain of the Ca2+-sensing receptor in a family with mild, essentially asymptomatic hypocalcemia (5 ). Our study extends these findings with several fundamentally new observations that have important clinical implications for this disorder. First, our studies indicate that activating mutations of the Ca2+-sensing receptor may result not only in asymptomatic hypocalcemia but also in severe hypoparathyroidism, presenting with tetany and hypocalcemic seizures in childhood.
Second, our studies showed that these mutations produce hypercalciuria even at low serum calcium concentrations. Under normal circumstances, urine calcium excretion increases as serum calcium rises. This increase is mediated, in part, by Ca2+-sensing receptors in kidney cells (3 ). Thus, patients with familial hypocalciuric hypercalcemia, due to loss-of-function mutations in the Ca2+-sensing receptor, excrete less calcium than do patients with hypercalcemia due to other causes. Conversely, patients with activating mutations of the calcium receptor would be expected to excrete more urine calcium, for a given level of serum calcium, than patients with acquired hypoparathyroidism, a prediction that we confirmed empirically. The clinical implication for patients with ADHP is that they may benefit from treatment that specifically addresses their greater tendency to hypercalciuria, such as thiazide (18 ) or PTH administration (19 ).
Third, we showed that de novo mutations in the Ca2+-sensing receptor cause sporadic hypoparathyroidism. Thus, this diagnosis should be considered in patients with sporadic as well as familial hypoparathyroidism, particularly if the patient is hypercalciuric despite hypocalcemia. Knowledge of this diagnosis has implications for treatment and for genetic counseling.
The transmembrane location of mutations F806S and Q681H in our study contrasts with the extracellular location of the mutation described previously (5 ), but conforms to the location of activating mutations in other G-protein coupled receptors. The location of F806S in the sixth transmembrane domain of the Ca2+-sensing receptor resembles the location of activating mutations reported in the sixth transmembrane domain of the luteinizing hormone receptor (6 ,7 ). The location of Q681H, just proximal to the third transmembrane domain of the Ca2+-sensing receptor, resembles that of an activating mutation in the thyroid-stimulating hormone receptor (8 ). Activating mutations in or near transmembrane domains have also been observed in the [alpha]1B-, [alpha]2-, and [beta]2- adrenergic receptors (9 -11 ), the melanocyte-stimulating hormone receptor (13 ), rhodopsin (14 ), and the parathyroid hormone-parathyroid hormone-related peptide receptor (15 ).
Loss-of-function mutations are often recessive because the presence of a single wild-type allele provides a sufficient quantity of functional protein. Gain-of-function mutations, in contrast, usually show a dominant inheritance since the excessive function of the mutant gene product creates a phenotype regardless of the presence of the wild-type gene product. However, in the families described in the current study, loss of parathyroid function was inherited in an autosomal dominant fashion. Our findings suggest a simple explanation for this dominant loss of function. Since the Ca2+-sensing receptor participates in a negative feedback loop regulating parathyroid function, gain-of-function at the molecular level causes a loss of function at the physiologic level.
We conclude that activating mutations of the Ca2+-sensing receptor may result not only in asymptomatic hypocalcemia but also in severe hypoparathyroidism accompanied by hypercalciuria. These findings have implications both for genetic counseling and for choice of therapy in patients with this disorder.
Genomic DNA was isolated from white blood cells. Based on the reported locations of activating mutations in 7-transmembrane domain receptors, we PCR-amplified exon 2 (using oligonucleotides AGCTTCCCATTTTCTTCCACTTCTT and CCCGTCTGAGAAGGCTTGAGTACCT) and an ~800 bp region in exon 6 encoding the six membrane-spanning domains closest to the carboxy terminus and the intervening intracellular and extracellular loops (using oligonucleotides TTCCGCAACACACCCATTGTCAAGG and GGATCCCGTGGAGCCTCCAAGGCTG) (3 ). The nucleotide sequence of the PCR product was directly determined (without cloning) from both strands by the dideoxy method using an automated, sequencing system (Applied Biosystems model 373A) (20 ).
To screen for specific mutations, PCR products were digested with restriction enzymes BsrFI (New England Biolabs, Beverly, MA), CviRI (Megabase Research Products, Lincoln, Nebraska), or MaeIII (Boehringer Mannheim, Indianapolis, IN) followed by electrophoresis through 6% polyacrylamide and visualization with ethidium bromide.
We thank the following individuals for technical assistance: Jo Proctor; Julia Hackett; Kathy Barracchini; Sharon Adams; Toni Simonis; and Michael Chin.
1 Arnold, A., Horst, S.A., Gardella, T.J., Baba, H., Levine, M.A., Kronenberg, H.M. (1990) Mutation of the signal peptide-encoding region of the preproparathyroid hormone gene in familial isolated hypoparathyroidism. J. Clin. Invest. 86, 1084-1087.MEDLINE Abstract
2 Brown, E.M., Gamba, G., Riccardi, D., Lombardi, M., Butters, R., Kifor, O., Sun, A., Hediger, M., Lytton, J., and Hebert, S.C. (1993) Cloning and characterization of an extracellular Ca2+-sensing receptor from bovine parathyroid. Nature366,575-580.MEDLINE Abstract
3 Pollack, M.R., Brown, E.M., Chou, Y.W., Hebert, S.C., Marx, S.J., Steinmann, B., Levi, T., Seidman, C.E., Seidman, J.G. (1993) Mutations in the human Ca2+-sensing receptor gene cause familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Cell 75, 1297-1303.
4 Finegold, D.N., Armitage, M.M., Galiani, M., Matise, T.C., Pandian M.R., Perry, Y.M., Deka, R., Ferrell, R.E. (1994) Preliminary localization of a gene for autosomal dominant hypoparathyroidism to chromosome 3q13. Pediatr. Res. 36, 414-417.MEDLINE Abstract
6 Shenker, A., Laue, L., Kosugi, S., Merendino, J.J., Minegishi, T., Cutler, G.B. (1993) A constitutively activating mutation of the luteinizing hormone receptor in familial male precocious puberty. Nature365, 652-654.MEDLINE Abstract
7 Laue, L., Chan, W.Y., Hsueh, A.J., Kudo, M., Hsu, S.Y., Wu, S.M., Blomberg, L., Cutler, G.B., Jr.(1995) Genetic heterogeneity of constitutively activating mutations of the luteinizing hormone receptor in familial male-limited precocious puberty. Proc. Natl Acad. Sci.USA92, 1906-1910.
8 Duprez, L., Parma., J., Van Sande, J., Allgeier, A., Leclere, J., Schvartz, C., Delisle, M-.J., Decoulx, M., Orgiazzi, J., Dumont, J., Vassart, G. (1994) Germline mutations in the thyrotropin receptor gene cause non-autoimmune autosomal dominant hyperthyroidism. Nature Genet. 7, 396-401.MEDLINE Abstract
9 Kjelsberg, M.A., Cotecchia, S., Ostrowski, J., Caron, M.G., Lefkowitz, R.J. (1992) Constitutive activation of the [alpha]1B-adrenergic receptor by all amino acid substitutions at a single site. J. Biol. Chem.267, 1430-1433.MEDLINE Abstract
10 Ren, Q., Kurose, H., Lefkowitz, R.J., Cotecchia, S. (1993) Constitutively active mutants of the [alpha]2-adrenergic receptor. J. Biol. Chem. 268, 16483-16487.MEDLINE Abstract
11 Samama, P., Cotecchia, S., Costa, T., Lefkowitz, R.J. (1993) A mutation-induced activated state of the [beta]2-adrenergic receptor J. Biol. Chem.268, 4625-4636.MEDLINE Abstract
12 Parma, J., Duprez, L., Van Sande, J., Cochaux, P., Gervy, C., Mockel, J., Dumont, J., Vassart, G. (1993) Somatic mutations in the thyrotropin receptor gene cause hyperfunctioning thyroid adenomas. Nature365, 649-651.MEDLINE Abstract
13 Robbins, L.S., Nadeau, J.H., Johnson, K.R., Kelly, M.A., Roselli-Rehfuss, L., Baack, E., Mountjoy, K.G., Cone, R.D. (1993) Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell72, 827-834.MEDLINE Abstract
14 Robinson, P.R., Cohen, G.B., Zhukovsky, E.A., Oprian, D.D. (1992) Constitutively active mutants of rhodopsin. Neuron9, 719-725.MEDLINE Abstract
15 Schipani, E., Kruse, K., Juppner H. (1995) A constitutively active mutant PTH-PTHrP receptor in Jansen-type metaphyseal chondrodysplasia. Science268,98-100.MEDLINE Abstract
16 Pearce, S.H.S., Thakker, R.V. Unpublished submission to EMBL/GENBank/DDBJ data bases. Accession number X81086.
17 Koeberl, D.D., Bottema, C.D.K., Ketterling, R.P., Bridge, P.J., Lillicrap, D.P., Sommer, S.S. (1990) Mutations causing hemophilia B: Direct estimate of the underlying rates of spontaneous germ-line transitions, transversions, and deletions in a human gene. Am. J. Hum. Genet.47: 202-217.MEDLINE Abstract
18 Porter R.H., Cox B.G., Hearney D., Hostetter, T.H., Stinebaugh, B.J., Suki, W.N. (1978) Treatment of hypoparathyroidism patients with chlorthalidone. N. Engl. J. Med.298, 577-581.MEDLINE Abstract
19 Winer, K.K.et al. (1993) Endocrine Society Abstracts, p. 454.
This page is maintained by OUP admin. Last updated Thu Oct 31 15:23:49 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
