Isolation of a new clathrin heavy chain gene with muscle-specific expression from the region commonly deleted in velo-cardio-facial syndrome
Isolation of a new clathrin heavy chain gene with muscle-specific expression from the region commonly deleted in velo-cardio-facial syndromeHoward Sirotkin1, Bernice Morrow1, Ruchira DasGupta1,+, Rosalie Goldberg3, Sankhavaram R. Patanjali4, Guangping Shi2, Linda Cannizzaro2, Robert Shprintzen3, Sherman M. Weissman4 and Raju Kucherlapati1,*
1Department of Molecular Genetics and 2Department of Pathology, Albert Einstein College of Medicine, Bronx, NY 10461, USA, 3Center for Craniofacial Disorders, Montefiore Medical Center, Bronx, NY, USA and 4Boyer Center for Molecular Medicine, Yale University School of Medicine, New Haven, CT 06540, USA
Received December 8, 1995;Revised and Accepted February 2, 1996GenBank accession no. U41763
Velo-cardio-facial syndrome (VCFS) and DiGeorge syndrome (DGS) are developmental disorders characterized by a spectrum of phenotypes including velopharyngeal insufficiency, conotruncal heart defects and facial dysmorphology among others. Eighty to eighty-five percent of VCFS/DGS patients are hemizygous for a portion of chromosome 22. It is likely that the genes encoded by this region play a role in the etiology of the phenotypes associated with the disorders. Using a cDNA selection protocol, we isolated a novel clathrin heavy chain cDNA (CLTD) from the VCFS/DGS minimally deleted interval. The cDNA encodes a protein of 1638 amino acids. CLTD shares significant homology, but is not identical to the ubiquitously expressed clathrin heavy chain gene. The CLTD gene also shows a unique pattern of expression, having its maximal level of expression in skeletal muscle. Velopharyngeal insufficiency and muscle weakness are common features of VCFS patients. Based on the location and expression pattern of CLTD, we suggest hemizygosity at this locus may play a role in the etiology of one of the VCFS-associated phenotypes.
Velo-cardio facial syndrome (VCFS MIM19243), originally described by Shprintzen in 1978 (1 ), has an estimated incidence of 1 in 5000 (2 ). A majority of VCFS cases are sporadic, and familial cases show an autosomal dominant pattern of inheritance (3 ). Characteristic features of this syndrome include conotruncal cardiac abnormalities, velopharyngeal insufficiency (VPI), clefting of the soft palate (vellum), hypernasal speech, learning disabilities and mild facial dysmorphology (1 ,4 -9 ). To date, >40 phenotypes have been described in association with VCFS, including psychiatric disorders, microcephaly, hypotonia and renal agenesis (1 ,10 -14 ). The phenotypic spectrum of VCFS overlaps with that of DiGeorge syndrome (DGS) (15 ,16 ), which is generally considered to be a more severe disorder encompassing many of the VCFS phenotypes with the additional features of thymic gland aplasia and hypoparathyroidism (16 ,17 ). Both syndromes may share a common etiology.
VCFS and DGS have been associated with haploinsufficiency of a portion of chromosome 22q11. Cytogenetically detectable deletions of 22q11 were the first evidence of linkage of these disorders to chromosome 22 (18 -21 ). Dosage analysis (22 -25 ), fluorescence in situ hybridization (FISH) (26 ,27 ) and, more recently, polymorphic marker analysis (28 ) confirmed that 80-85% of patients have detectable deletions. A minimal region of overlap that is deleted in VCFS patients, termed the critical region, was estimated to be 1-2 Mb in length (27 ). The remaining set of patients may carry a small deletion or a point mutation in a critical gene or may be phenocopies with a different etiology.
Several of the organs and tissues affected in VCFS patients are of neural crest origin and are derived from the third and fourth pharyngeal pouches. Therefore, VCFS has been considered to be a developmental field defect and may result from haploinsufficiency of one or more genes from the interval that is commonly deleted in patients. Although the cardinal features of VCFS might result from the haploinsufficiency of a single gene, additional features associated with VCFS might result from haploinsufficiency of other genes located in the deleted interval in each patient. Therefore, to fully understand the molecular basis of the VCFS-associated phenotypes, it is necessary to isolate all the genes encoded in the 22q11 region and ascertain their role in each of the phenotypes associated with VCFS. Towards this goal, we constructed a physical map of 22q11 and defined a region that is commonly deleted in VCFS patients (28 ). We have also begun a systematic effort to isolate the genes in this interval. Here we describe the isolation and characterization of a new gene which shows considerable homology to the clathrin heavy chain gene (CLTC) which has been mapped to chromosome 17 (29 ). The new gene, designated clathrin D (CLTD) is located in the VCFS commonly deleted interval. Although clathrin is ubiquitous and plays a critical role in both endocytosis and exocytosis (30 ), CLTD is most abundantly expressed in adult skeletal muscle. Skeletal muscle insufficiency and weakness are associated with VCFS. VPI is present in >90% of VCFS patients and results from hypoplasia and hypotonia of the lateral pharyngeal wall musculature. A more generalized hypotonia during infancy was also among the initial phenotypes described in VCFS (1 ). We propose that hemizygosity of CLTD may play a role in the hypotonia that is a common feature of VCFS patients.
To isolate genes from the VCFS critical region, the 250 kb ICRF (Imperial Cancer Research Fund) YAC, Y5A11 (28 ,31 ), was used as a substrate for cDNA selection (32 -34 ). Total DNA from the yeast clone was digested with HindIII, immobilized onto nylon membranes and hybridized with a composite of human short fragment cDNA libraries prepared by pooling six individual cDNA libraries from total fetus (8-9 week abortus), fetal brain, adult brain, spleen, testes and thymus. The initial insert size of the libraries wasin the range of300-2000 bp. The cDNAs that hybridized to the membrane were PCR amplified and used for a second round of hybridization selection. Amplified material from the second round of hybridization selection containing cDNAs putatively arising from genes on the YAC Y5A11 were cloned into the [lambda]gt10 vector for analysis. The plaques were screened with rDNA probes and 25 non-hybridizing inserts were sequenced. The sequences were examined for homologies among sequences deposited in the GenBank/EMBL databases using the BlastN and BlastX algorithms.
One of these phage inserts, termed V1-5, was 301 bp in length and showed a strong similarity to the human, rat and Drosophila clathrin heavy chain (CHC) genes at both the nucleotide and deduced amino acid levels. Of particular interest was the observation of substantial differences at the nucleotide level from the previously described human gene, CLTC (GenBank accession no. 434761), suggesting that we discovered a gene that corresponds to a novel CHC isoform.
The human clathrin heavy chain gene (CLTC) had previously been mapped to chromosome 17q11-qter (29 ). The V1-5 cDNA fragment was obtained by using a YAC which contained chromosome 22 markers, suggesting that the gene corresponding to V1-5 is located on chromosome 22. To ascertain the validity of this assignment, genomic DNA from a panel of somatic cell hybrids (35 ) was screened with PCR primers designed from the V1-5 cDNA sequence (RK1138/RK1139). This panel permits unambiguous distinction between genes on chromosomes 17 and 22. The primer pair yielded the expected 119 bp amplification product from total human genomic DNA, DNA from a somatic cell hybrid containing only chromosome 22, GM10888 and from XOL-2, a hybrid that contains both chromosome 17 and 22 (Fig. 1 ). A PCR product was not produced from DNA from somatic cell hybrids, DUA-3BSAGA, WIL-14, WIL-15, WIL-2, WIL-6 (35 ) that contain chromosome 17 but not chromosome 22 or in hybrid 35R14 which contains neither human chromosome 17 or 22. Conversely, primers designed from the CLTC sequence (RK1187/RK1188) yielded a 290 bp amplification product on human genomic DNA and genomic DNA from cell lines containing chromosome 17 (data not shown). These results confirmed the notion that there are two human clathrin heavy chain loci, one on chromosome 17 and the second located on chromosome 22. We designate the second locus, located on chromosome 22, clathrin D, (CLTD).
We utilized both PCR and hybridization based strategies to isolate the complete CLTD cDNA. To reduce the effort in direct screening, we prepared 14 pools of 50 000 phage each from a HeLa cell library (Stratagene) and screened phage lysates from each pool with the CLTD-specific primers. Ten of 14 pools were positive. RK1138 was used in combination with vector-specific primer T7 to screen one positive pool, pool 7, which yielded an 834 bp product termed HS1 which was cloned into the Bluescript KS vector (Stratagene) and sequenced. Sequence of this product showed overlap with the V1-5 insert but was distinct from the CLTC cDNA sequence. The HS1 clone was then used as a hybridization probe to isolate 3.7 and 3.2 kb cDNAs (HS6 and HS7) from the HeLa library and a 3.0 kb cDNA (HS2) from a fetal brain cDNA library (Clonetech). All four clones shared sequence overlap (Fig. 3 ) and could be distinguished from CLTC based on significant differences in the nucleotide sequence. Clones corresponding to CLTC were also isolated from the library screens.
The entire sequence of HS6 and the three RACE products permitted assembly of the complete CLTD cDNA sequenceof this gene (GenBank U41763). The assembled sequence consists of 5568 bp and contains an open reading frame of 4914 bp with a good Kozak translation initiation signal (37 ). Several stop codons are 5' to the ATG, suggesting that this is the authentic translation initiation site. An accepted poly(A) signal variant, ATTAAA, is present 17 nucleotides upstream of the poly(A) tail. This alternative poly(A) signal is also seen 16 bp upstream of the poly(A) tail in the rat CHC gene (38 ) and in both the mouse pancreatic [alpha]-amylase (39 ) and chicken lysozyme genes (40 ). At the nucleotide sequence level CLTD is 75% homologous to the rat clathrin heavy chain and 74% homologous to both the bovine clathrin heavy chain (GenBank U31757) and human CLTC.
The amino acid sequence of the CLTD product was deduced from the cDNA sequence (Fig. 4 ). The protein is composed of 1638 amino acids, has a predicted molecular weight of 186 796 and a pI of 5.55. The other mammalian clathrins are larger, with predicted molecular weights of >191 000. The other mammalian CHCs are 1675 amino acids in length and the yeast protein is also somewhat smaller, having a length of only 1653 amino acids. The CLTD protein is truncated 37 amino acids prior to the C-terminus of the other mammalian clathrin genes. CLTD protein shares 85% identity and 93% similarity to the corresponding N-terminal portion of the mammalian CHCs. The similarity is not confined to any one portion of the protein, but extends throughout the entire molecule. The human CLTC is 99.9% and 99.7% identical to the bovine and rat proteins respectively. CLTD shares an identity of 77% with the Drosophila protein and an identity of 52% within a 1069 amino acid stretch of the C-terminal portion of the yeast protein. The similarity between CLTD and the other CHCs is illustrated in a phylogenetic tree generated from the deduced amino acid sequence of the various CHCs (Fig. 5 ). The relationship of the mammalian CHCs suggests that CLTD and the other clathrin heavy chain genes have a common vertebrate ancestor, but that the human CLTD is distinct from all of the other CHCs. This raises the possibility that other mammalian species may also have a homolog to the human CLTD gene.
The HS1 clone (Fig. 3 ) which corresponds to nucleotides 2331-3065 of the CLTD cDNA and shares an identity of 74% with the corresponding portion of the CLTC gene at the nucleotide sequence level was used as a probe for Northern blot analysis of poly(A) RNA from several human adult tissues. This probe detected an ~6 kb transcript in skeletal muscle after a 24 h exposure (Fig. 6 A). With a significantly longer exposure (>1 week) less abundant transcripts could be detected in all tissues, with heart showing a slightly greater level of expression than the other tissues (not shown). As a control, the same blot was hybridized with a 3495 bp SmaI-SpeI fragment of the CLTC cDNA which corresponds to the N-terminal region of the protein (Fig. 6 B). This probe detected a message of 6-6.4 kb in all tissues. The complete CLTC cDNA is 6111 bp in length. The CLTC probe also detected a 1.7 kb transcript in skeletal muscle and heart. The 1.7 kb skeletal muscle transcript was not detected using the portions of the CLTD corresponding to the N-terminal half of the protein. The nature of the 1.7 kb transcript is unclear and may represent a CLTC splice variant or it may be the product of an as yet undescribed gene.
A cosmid containing CLTD, 15A10 (LL22NC03 library), and a cosmid mapping to the telomeric region of chromosome 22 were used for FISH of metaphase chromosomes from a VCFS patient carrying a 22q11 deletion (BM14) and the patient's unaffected mother [BM12; cell lines are described in (28 )]. Results from this experiment are shown in Figure 7 . Each member of the pair of chromosome 22 in BM12 showed the two expected distinct signals. In BM14, one chromosome 22 had two signals while the second had only one, that corresponded to the telomeric probe. These results showed that BM14 is hemizygous for CLTD. We have previously shown that BM14 carries a small deletion (28 ). Therefore we can conclude that all VCFS patients who have detectable deletions are hemizygous for CLTD.
We used a hybrid selection protocol to isolate cDNAs encoded within YAC Y5A11 which map to the minimally deleted region in VCFS. One of the cDNA fragments recovered from the YAC encoded a portion of a novel clathrin heavy chain gene that we have designated CLTD. This 301 bp fragment was used to recover the entire coding sequence of the gene. Several lines of evidence support the view that we have recovered a novel expressed CHC gene. The initial cDNA fragment showed homology but not identity, to the previously cloned human CLTC gene. Primers derived from the initial CLTD short fragment cDNA amplified a 119 bp genomic fragment from total human DNA and from somatic cell hybrids containing chromosome 22, but not in hybrids containing chromosome 17 but not chromosome 22. A primer pair derived from the CLTC gene yielded a 290 bp amplification product from human genomic DNA and somatic cell hybrids containing chromosome 17.
The protocol used for cDNA selection was previously described (33 ,34 ). Briefly, 50 ng of total genomic DNA from the yeast strain containing the Y5A11 YAC was digested with HindIII and spotted onto a Hybond-N membrane (Amersham). The membranes were prehybridized with human and yeast repetitive elements and ribosomal DNA. PCR amplified inserts from the six human cDNA libraries (total fetus from an 8-9 week abortus, fetal brain, adult brain, adult thymus, testes and spleen) were hybridized to the filters. Membranes were washed at 65oC in decreasing concentrations of SSC and SDS. cDNAs retained on the filters were eluted by boiling, re-amplified using linker specific primers and used for a second round of selection. Twice-selected cDNAs were cloned into [lambda]gt10 and plated on C600 bacteria.
PCR was performed on the somatic cell hybrid panel DNA according to standard procedures (32 ). The V1-5 EST primers were RK1138 (5'CCGGGATCCTGAAGAGATTT3') and RK1139 (5'TGTGCTCGCTGAAGACAGAG3'). Primers designed from the chromosome 17 clathrin heavy chain gene were RK1187 5'AAAACGTGCAGTGGTTCACA3' and RK1188 5'AGATTCTGACGGATGTTGGC3'.
Genomic DNAs (10-20 [mu]g/mammalian source, 1-2 [mu]g yeast) were digested with EcoRI overnight. Samples were phenol extracted, precipitated and electrophoresed on 0.8% agarose in 1* TAE (32 ). Capillary blotting was used to transfer the DNAs to Hybond-N membranes (Amersham). Probes were prepared by random primed labeling using the Boehringer Mannheim Biochemica kit as per the manufacturer's instructions. Hybridizations were performed at 65oC in Church-Gilbert buffer (0.5 M NaPO4 pH 7.6, 7% SDS, 1% BSA). Washes were performed at 42oC in 1* SSC, 0.1% SDS for 15 min and at 65oC in 0.5* SSC and 0.1% SDS for 30 min.
The initial HS1 clone was isolated by PCR using primer RK1138 and T7 (5'CGCGTAATACGACTCACTATAGG3'). The PCR product (after 35 cycles with an annealing temperature of 60oC) was cloned into the EcoRV site of Bluescript SKvector (Stratagene).
The HS1 clone was used as a hybridization probe to screen the HeLa (Stratagene) and fetal brain (Clonetech) cDNA libraries. Approximately 500 000 clones were plated on the appropriate bacterial host strain, LE392 (HeLa) or K802 (fetal brain). Phage were grown overnight and plaque lifts performed (32 ) using HybondN (Amersham). Hybridization conditions were the same as described above. Clones hybridizing to the probe were plaque purified.
5' Race-ready Human Muscle cDNA was obtained from Clonetech. PCR was performed for 30-35 cycles at an annealing temperatures of 58-62oC using the following three sets of primers: race 1, RK21682 (5'TCCAAGGATGGCATCTGCAAC3') and RK21683 (5'GGGTGCATGAACAAGGTTCA3'); race 2 RK22325 (5'ATAGCTGCCCTGTGCAAGAG3') and RK22324 (5'TTCTCACAAACAACTTCTCTGCG3'); race 3 RK23198 (5'GATCTGAAGTGTCTTCCCAGC3') and RK23197 (5'GTCACTCATGTCAATGATCGTG3'). RACE products were cloned into the PCR2 vector (Invitrogen) for sequencing. The primers used to verify the chromosomal origin of the RACE products were RK24442 (5'GCTCACCAACTTTCTCTCGG3') and RK24443 (5'CTTCCAGCTCCAAAACCTTG3').
Double-stranded plasmid templates for sequencing were prepared using Qiawell-8 plasmid prep columns (Qiagen) as per the manufacturer's instructions. DNA sequencing was performed on Applied Biosystems Inc. 373/377 DNA sequencers. Sequencing reactions were performed using the dye terminator chemistry and either the ampli-Taq or Taq-fs enzymes (as per the manufacturer's recommendations). Sequence contigs were assembled using the Sequencher program (Genecodes).
Human Multiple Tissue Northern Blot 1 (Clonetech) was purchased. Hybridization and washes were performed in accordance to the manufacturers recommendations.
Metaphase spreads were prepared from Epstein-Barr virus-transformed lymphoblast cell lines by colcemid, potassium chloride hypotonic and methanol/acetic acid fixation according to standard protocols. Cosmid DNA was labeled with biotin using the Bio-Nick translation kit (Gibco). The labeled DNA was purified from the reaction using a spin column (Boehringer-Mannheim). A hybridization mixture was made containing 50% formamide, 10% dextran sulfate, 2* SSC, biotinylated probe DNA 10 ng/ml and human Cot1 DNA 100 ng/ml (Gibco-BRL). The mixture was denatured at 75oC for 8 min and preannealed at 37oC for 30 min. The slide was treated at 37oC with RNase A (Sigma) in 2* SSC, washed three times in 2* SSC for 2 min, immediately passed through an alcohol series (70-80-95-100%), and air dried. Chromosomal DNA was denatured at 70oC in 70% formamide, 2* SSC and passed through an alcohol series. Hybridization was performed at 37oC in a moist chamber for 16 h. Washes were carried out at 45oC in 50% formamide, 2* SSC (3 times), 2* SSC once, and 0.1 M PN buffer (0.1 M sodium phosphate/0.1% NP-40, pH 8.0), each for 5 min. Probe was detected using the Fluorescein detection kit (Oncor). Slides were counterstained with propidium iodide (0.6 [mu]g/ml).
We acknowledge Nobuo Nomura and Reiko Munetoh for providing the chromosome 17 clathrin heavy chain cDNA, Thomas Shows for providing the hybrid mapping panel, Peter Scambler for providing the Y5A11 YAC and Geofrey Childs for providing an aliquot of the HeLa library. We thank Frances Brodsky for several discussions and sharing data prior to publication and Arthur Skoultchi for constant support and discussions. This work was supported by NIH grants HD 31601 (R.K. and S.W.), March of Dimes grant 5-FY95-0115 (B.M.) a NARSAD award (B.M.) and a cancer center grant (CA13330) to AECOM. H.S. is supported by a NIH training grant 5T32GM07128.
1 Shprintzen, R.J., Goldberg, R.B., Lewin, M.L., Sidoti, E.J., Berkman, M.D., Argamaso, R.V. and Young, D. (1978) A new syndrome involving cleft palate, cardiac anomalies, typical facies, and learning disabilities: velo-cardio-facial syndrome. Cleft Palate J., 15, 56-62.MEDLINE Abstract
2 Scambler, P.J. (1993) Deletions of human chromosome 22 and associated birth defects. Curr. Opin. Genet. Dev., 3, 432-437.MEDLINE Abstract
3 Williams, M.A., Shprintzen, R.J. and Goldberg, R.B. (1985) Male-to-male transmission of the velo-cardio-facial syndrome: a case report and review of 60 cases. J. Craniofacial Genet. Devel. Biol., 5, 175-180.MEDLINE Abstract
4 Shprintzen, R.J., Goldberg, R.B., Young, D. and Wolford, L. (1981) The velo-cardio-facial syndrome: a clinical and genetic analysis. Pediatrics, 67, 167-172.MEDLINE Abstract
5 Shprintzen, R., Siegel-Sadewitz, V.L., Amato J. and Goldberg, R.B. (1985) Retrospective diagnoses of previously missed syndromic disorders amongst 1,000 patients with cleft lip, cleft palate or both. Birth Defects, 21, 85-91.MEDLINE Abstract
6 Young, D., Shprintzen, R. and Goldberg, R. (1980) Cardiac malformations in the velo-cardio-facial syndrome. Am. J. Cardiol., 46, 643-647.MEDLINE Abstract
7 Jedele, K.B., Michels, V.V., Puga, F.J. and Feldt, R.H. (1992) Velo-cardio-facial syndrome associated with ventricular septal defect, pulmonary atresia, and hypoplastic pulmonary arteries. Pediatrics, 89, 915-919.MEDLINE Abstract
8 Lipson, A., Yuille, D., Angel, M., Thomson, P., Vanderwoord, J. and and Beckenham, E. (1991) Velo-cardio-facial syndrome: an important syndrome for dismorphologists to recognize. J. Med. Genet., 28, 133-137.
9 Arvystas, M. and Shprintzen, R.J. (1984) Craniofacial morphology in the velo-cardio-facial syndrome. J. Craniofacial Genet. Devel. Biol., 4, 39-45.MEDLINE Abstract
10 Karayiorgou, M., Morris, M., Morrow, B., Shprintzen, R., Goldberg, R., Borrow, J., Gos, A., Nestadt, G., Wolyniec, P., Lasseter, V., Eisen, H., Childs, B., Kazazian, H., Kucherlapati, R., Antonarakis, S., Pulver, A. and Housman, D. (1995) Schizophrenia susceptibility associated with interstitial deletions of chromosome 22q11. Proc. Natl Acad. Sci. USA, 92, 7612-7616.
11 Pulver, A.E., Nestadt, G., Goldberg, R., Shprintzen, R.J., Lamacz, M., Wolyniec, P.S., Morrow, B., Karayiorgou, M., Antonarakis, S.E., Housman, D. et al. (1994) Psychotic illness in patients diagnosed with velo-cardio-facial syndrome and their relatives. J. Nerv. Ment. Dis., 182, 476-478.MEDLINE Abstract
12 Meinecke, P., Beemer, F.A., Schinzel, A. and Kushnick, T. (1986) The velo-cardio-facial (Shprintzen) syndrome. Clinical variability in eight patients. Eur. J. Pediatr., 145, 539-544.MEDLINE Abstract
13 Goldberg, R., Motzkin, B., Marion, R., Scambler, P.J. and Shprintzen, R.J. (1993) Velo-cardio-facial syndrome: a review of 120 patients. Am. J. Med. Genet., 45, 313-319.MEDLINE Abstract
14 Wilson, T.A., Blethen, S.L., Vallone, A., Alenick, D.S., Nolan, P., Katz, A., Amorillo, T.P., Goldmuntz, E., Emanuel, B.S. and Driscoll, D.A. (1993) DiGeorge anomaly with renal agenesis in infants of mothers with diabetes. Am. J. Med. Genet., 47, 1078-1082.MEDLINE Abstract
15 DiGeorge, A. (1965) A new concept of the cellular basis of immunity. J. Pediatr., 67, 907.
16 Wilson, D.I., Cross, I.E., Goodship, J.A., Brown, J., Scambler, P.J., Bain, H.H., Taylor, J.F., Walsh, K., Bankier, A., Burn, J. and Wolstenholme, J. (1992) A prospective cytogenetic study of 36 cases of DiGeorge syndrome. Am. J. Hum. Genet., 51, 957-963.MEDLINE Abstract
17 Greenberg, F. (1993) DiGeorge syndrome: an historical review of clinical and cytogenetic features. J. Med. Genet., 30, 803-806.MEDLINE Abstract
18 de la Chapelle, A., Herva, R., Koivisto, M. and Aula, P. (1981) A deletion in chromosome 22 can cause DiGeorge syndrome. Hum. Genet., 57, 253-256.MEDLINE Abstract
19 Kelley, R.I., Zackai, E.H., Emanuel, B.S., Kistenmacher, M., Greenberg, F. and Punnett, H.H. (1982) The association of the DiGeorge anomalad with partial monosomy of chromosome 22. J. Pediatr., 101, 197-200.MEDLINE Abstract
20 Augusseau, S., Jouk, S., Jalbert, P. and Prieur, M. (1986) DiGeorge syndrome and 22q11 rearrangements. Hum. Genet., 74, 206.MEDLINE Abstract
21 Rouleau, G.A., Haines, J.L., Bazanowski, A., Colella-Crowley, A., Trofatter, J.A., Wexler, N.S., Conneally, P.M. and Gusella, J.F. (1989) A genetic linkage map of the long arm of human chromosome 22. Genomics, 4, 1-6.MEDLINE Abstract
22 Driscoll, D.A., Spinner, N.B., Budarf, M.L., McDonald-McGinn, D.M., Zackai, E.H., Goldberg, R.B., Shprintzen, R.J., Saal, H.M., Zonana, J., Jones, M.C. et al. (1992) Deletions and microdeletions of 22q11.2 in velo-cardio-facial syndrome. Am. J. Med. Genet., 44, 261-268.MEDLINE Abstract
23 Wilson, D.I., Goodship, J.A., Burn, J., Cross, I.E. and Scambler, P.J. (1992) Deletions within chromosome 22q11 in familial congenital heart disease. Lancet, 340, 573-575.MEDLINE Abstract
24 Scambler, P.J., Kelly, D., Lindsay, E., Williamson, R., Goldberg, R., Shprintzen, R., Wilson, D.I., Goodship, J.A., Cross, I.E. and Burn, J. (1992) Velo-cardio-facial syndrome associated with chromosome 22 deletions encompassing the DiGeorge locus. Lancet, 339, 1138-1139.MEDLINE Abstract
25 Kelly, D., Goldberg, R., Wilson, D., Lindsay, E., Carey, A., Goodship, J., Burn, J., Cross, I., Shprintzen, R.J. and Scambler, P.J. (1993) Confirmation that the velo-cardio-facial syndrome is associated with haplo-insufficiency of genes at chromosome 22q11. Am. J. Med. Genet., 45, 308-312.MEDLINE Abstract
26 Driscoll, D.A., Salvin, J., Sellinger, B., Budarf, M.L., McDonald-McGinn, D.M., Zackai, E.H. and Emanuel, B.S. (1993) Prevalence of 22q11 microdeletions in DiGeorge and velocardiofacial syndromes: implications for genetic counselling and prenatal diagnosis. J. Med. Genet., 30, 813-817.MEDLINE Abstract
27 Lindsay, E.A., Halford, S., Wadey, R., Scambler, P.J. and Baldini, A. (1993) Molecular cytogenetic characterization of the DiGeorge syndrome region using fluorescence in situ hybridization. Genomics, 17, 403-407.MEDLINE Abstract
28 Morrow, B., Goldberg, R., Carlson, C., Das Gupta, R., Sirotkin, H., Collins, J., Dunham, I., O'Donnell, H., Scambler, P., Shprintzen, R. and Kucherlapati, R. (1995) Molecular definition of the 22q11 deletions in velo-cardio-facial syndrome. Am. J. Hum. Genet., 56, 1391-1403.MEDLINE Abstract
29 Doge, G.R., Kovalszky, I., McBride, O.W., Yi, H.F., Chu, M., Saitta, B., Stokes, D. and Iozzo, R.V. (1991) Human clathrin heavy chain (CLTL): partial molecular cloning, expression, and mapping of the gene to human chromosome 17q11-qter. Genomics, 11, 174-178.
30 Pley, U. and Parham, P. (1993) Clathrin: its role in receptor-mediated vesicular transport and specialized functions in neurons. Crit. Rev. Biochem. Mol. Biol., 28, 431-464.MEDLINE Abstract
31 Collins, J., Cole, C., Smink, L., Garret, C., Leversham, M., Sodeerlund, C., Maslen, G., Everett, L., Rice, K., Coffey, A., Gregory, S., Gwilliam, R., Dunham, A., Davies, A., Hassock, S., Todd, C., Lehrach, H., Hulsebos, T., Weissenbach, J., Morrow, B., Kucherlapati, R., Wadey, R., Scambler, P., Kim, U., Simon, M., Peyrard, M., Xie, Y., Carter, N., Durbin, R., Dumanski, J., Bentley, D. and Dunham, I. (1995) A high density contig map of human chromosome 22. Nature, 337, 367-379.MEDLINE Abstract
32 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
33 Parimoo, S., Patanjali, S.R., Shukla, H., Chaplin, D.D. and Weissman, S.M. (1991) cDNA selection: efficient PCR approach for the selection of cDNAs encoded in large chromosomal DNA fragments. Proc. Natl Acad. Sci. USA, 88, 9623-9627.MEDLINE Abstract
34 Parimoo, S., Kolluri, R. and Weissman, S.M. (1993) cDNA selection from total yeast DNA containing YACs. Nucleic Acids Res., 21, 4422-4423.MEDLINE Abstract
35 Wade, R., Eddy, R., Shows, T. B. and Kedes, L. (1990) cDNA sequence, tissue-specific expression, and chromosomal mapping of the human slow-twitch skeletal muscle isoform of troponin 1. Genomics, 7, 346-357.MEDLINE Abstract
36 Apte, A. and Siebert, P.D. (1993) Anchor ligated cDNA libraries: a technique for generating a cDNA library for the immediate cloning of the 5' ends of mRNAs. BioTechniques, 15, 890-893.MEDLINE Abstract
37 Kozak, M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell., 44, 283-292.MEDLINE Abstract
38 Kirchhausen, T., Harrison, S.C., Chow, E.P., Mattaliano, R.J., Ramachandran, K.L., Smart, J. and Brosius, J. (1987) Clathrin heavy chain: molecular cloning and complete primary structure. Proc. Natl Acad. Sci. USA, 84, 8805-8809.MEDLINE Abstract
39 Hagenbuchle, O., Bovey, R. and Young, R. (1980) Tissue-specific expression of mouse [alpha]-amylase: nucleotide sequence of isoenzyme mRNAs from pancreas and salivary gland. Cell, 21, 179-187.MEDLINE Abstract
40 Jung, A., Sippel, A., Grez, M. and Shultz, G. (1980) Exons encode functional and structural units of chicken lysozyme. Proc. Natl Acad. Sci. USA, 77, 5759-5763.
41 Liu, S., Wong, M., Craik, C. and Brodsky, F. (1995) Regulation of clathrin assembly and trimerization defined using recombinant triskelion hubs. Cell, 83,MEDLINE Abstract
42 Nathke, I.S., Heuser, J., Lupas, A., Stock, J., Turck, C.W. and Brodsky, F.M. (1992) Folding and trimerization of clathrin subunits at the triskelion hub. Cell, 68, 899-910.MEDLINE Abstract
43 Lupas, A., Van Dyke, M., and Stock, J. (1991) Predicting coiled coils from protein sequences. Science, 252, 1162-1164.MEDLINE Abstract
44 Brodsky, F.M. (1985) Clathrin structure characterized with monoclonal antibodies. II. Identification of in vivo forms of clathrin. J. Cell Biol., 101, 2055-2062.MEDLINE Abstract
45 Brodsky, F.M. (1985) Clathrin structure characterized with monoclonal antibodies. I. Analysis of multiple antigenic sites. J. Cell Biol., 101, 2047-2054.MEDLINE Abstract
46 Kaufman, S.J., Bielser, D. and Foster, R.F. (1990) Localization of anti-clathrin antibody in the sarcomere and sensitivity of myofibril structure to chloroquine suggest a role for clathrin in myofibril assembly. Exp. Cell Res., 191, 227-238.MEDLINE Abstract
47 Lemmon, S.K., Pellicena-Palle, A., Conley, K. and Freund, C.L. (1991) Sequence of the clathrin heavy chain from Saccharomyces cerevisiae and requirement of the COOH terminus for clathrin function. J. Cell Biol., 112, 65-80.MEDLINE Abstract
48 Payne, G.S. and Schekman, R. (1985) A test of clathrin function in protein secretion and cell growth. Science, 230, 1009-1014.MEDLINE Abstract
49 Lemmon, S.K., Sens, D.A. and Buse, M.G. (1985) Insulin stimulation of glucose transport and metabolism in a human Wilms' tumor-derived myoblast-like cell line: modulation of hormone effects by glucose deprivation. J. Cell. Physiol., 125, 456-464.MEDLINE Abstract
50 Munn, A.L., Silveira, L., Elgort, M. and Payne, G.S. (1991) Viability of clathrin heavy-chain-deficient Saccharomyces cerevisiae is compromised by mutations at numerous loci: implications for the suppression hypothesis. Mol. Cell. Biol., 11, 3868-3878.MEDLINE Abstract
51 O'Halloran, T.J. and Anderson, R.G. (1992) Characterization of the clathrin heavy chain from Dictyostelium discoideum. DNA Cell Biol., 11, 321-330.MEDLINE Abstract
52 Bazinet, C., Katzen, A.L., Morgan, M., Mahowald, A.P. and Lemmon, S.K. (1993) The Drosophila clathrin heavy chain gene: clathrin function is essential in a multicellular organism. Genetics, 134, 1119-1134.MEDLINE Abstract
53 Dimario, P. and Mahowald, A. (1987) Female sterile (1) yolkless: a recessive female sterile mutation in Drosophila melanogaster with depressed numbers of coated pits and coated vesicles within the developing oocytes. J. Cell Biol., 105, 199-206.
54 McLean, S.D., Saal, H.M., Spinner, N.B., Emanuel, B.S. and Driscoll, D.A. (1993) Velo-cardio-facial syndrome. Intrafamilial variability of the phenotype. Am. J. Dis. Child., 147, 1212-1216.MEDLINE Abstract
*To whom correspondence should be addressed
+Present address: Dana Farber Cancer Center, Boston, MA 02115, USA
This page is maintained by OUP admin. Last updated Thu Oct 31 15:23:49 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
