Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (24)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lotery, A. J.
Right arrow Articles by Hughes, A. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lotery, A. J.
Right arrow Articles by Hughes, A. E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 705-709

Localisation of a gene for central areolar choroidal dystrophy to chromosome 17p
Introduction
Results
Discussion
Materials And Methods
   Clinical description
   Genetic markers
   Linkage analysis
   mRNA extraction and cDNA synthesis
   RT-PCR and DNA sequencing
Acknowledgements
References


Localisation of a gene for central areolar choroidal dystrophy to chromosome 17p

Localisation of a gene for central areolar choroidal dystrophy to chromosome 17p Andrew J. Lotery, Kevin T. Ennis, Giuliana Silvestri1, Suzanne Nicholl, David McGibbon, Alan D. Collins1 and Anne E. Hughes*

Department of Medical Genetics and 1Department of Ophthalmology, The Queen's University of Belfast, BT9 7AB, Northern Ireland, UK

Received January 6, 1996; Revised and Accepted February 23, 1996

Central areolar choroidal dystrophy (CACD) is a rare inherited retinal disease which causes progressive profound loss of vision in patients during their 4th decade. We have identified a Northern Irish family with 19 affected individuals in three living generations. We have performed a total genome search and established linkage of CACD in this family to chromosome 17p (multipoint Zmax = 5.65 at D17S938). The genes for phosphatidylinositol transfer protein (PITPN), retinal guanylate cyclase (GUC2D), [beta]-arrestin 2 (ARRB2), pigment epithelium-derived factor (PEDF) and recoverin (RCV1) map to this region and are candidate genes for retinal disease. Analysis of the coding region of the PITPN gene failed to reveal any mutation in this family.

INTRODUCTION

Central areolar choroidal dystrophy affects the posterior pole of the eye (1 ). Early lesions consist of a non-specific area of granular hyperpigmentation at the fovea (2 ). It is only after several decades that the pathognomonic zone of atrophy, affecting retina, retinal pigment epithelium and choriocapillaris, develops in the macular region of the eye (3 ). Patients usually become aware of visual symptoms in the 3rd to 4th decade (4 ) with the development of absolute central visual scotomas, causing severe visual disability by the seventh decade. CACD may show autosomal recessive or dominant inheritance (5 ). The purpose of this study was to identify linkage for this condition in a large Northern Irish family with this disorder.

Previously mutations in the peripherin-RDS gene (6 -8 ) have been reported in patients with CACD. However, in our family linkage to known retinal candidate gene loci including peripherin-RDS, ROM-1, rhodopsin and the [beta]-subunit of cyclic GMP had been excluded (9 ). Therefore a total genome search was undertaken using microsatellite markers and standard linkage methodology.

RESULTS

This study involves a family with CACD affecting members of four generations (Fig. 1 ). A systematic search for linkage was undertaken in all available individuals over the age of 14 with an affected parent. More than 160 highly polymorphic microsatellite polymorphisms were typed with negative results before a cluster of markers from chromosome 17p showed evidence of linkage (Fig. 2 a, Table 1 ), with a maximum two-point lod score of 4.7 at [theta] = 0.00 with D17S796. No recombinants were identified in members of generation II or III (in whom diagnosis was unequivocal) with D17S938 or D17S796, or with D17S1298 which was relatively uninformative in this family. A haplotype of markers could be tracked with the disease in this family (Fig. 1 ). The maximum multipoint lod score of 5.65 was obtained at D17S938 (Fig. 2 b).


Figure 1.Pedigree of the CACD family showing types for markers D17S849, D17S5, D17S938, D17S796, D17S786, D17S804 and D17S520 in order from top to bottom. Alleles transmitted by the affected parent are shown on the left of each pair. The haplotype linked to the disease gene is shaded.


Figure 2.(a) Physical and linkage map of markers on chromosome 17p. Sex averaged distances between markers are shown in cM. (b) Multipoint analysis of CACD.

Analysis of the coding region of PITPN cDNA was performed by direct sequencing of RT-PCR or nested products. The sequence of this gene in both CACD and control cDNA was identical to the published sequence of PITPN from a human testis cDNA library (10 ). There was no evidence to suggest alternative splicing.

DISCUSSION

The gene which causes CACD in this family shows linkage to markers on chromosome 17p (11 -13 ). Figure 1 shows haplotypes with markers D17S849, D17S5, D17S938, D17S796, D17S786, D17S804 and D17S520, and the 2-1-3-1-2-3-4 haplotype segregates with the disease in most members of this family. Analysis of recombination in affected members of generations II and III places the disease gene in the interval of approximately 16 cM between D17S5 and D17S520. Additional evidence of recombination in IV6 who has a 90% risk of being affected suggests a narrower localisation of the gene responsible for CACD to between D17S5 and D17S804. Linkage analysis implies that the gene is unlikely to lie close to D17S786, however, this is based on apparent double recombination within an interval of approximately 7 cM flanking this marker in II6. Unfortunately the absence of DNA from members of generation I or an unaffected member of generation II restricts the number of identifiable haplotypes when linkage is found. Neither of the D17S786 alleles inherited by II6 is shared with any of his siblings, and it appears likely that he received a new mutation with a 2 base increase in size of the 2 allele at this microsatellite marker within the common disease haplotype.

Table 1 Two point lod scores for CACD and markers on chromosome 17p Zmax[theta] *
Marker

Lod score (Z) at recombination fraction ([theta])

 

0

0.01

0.05

0.1

0.2

0.3

 

 

D17S849

-[infinity]

0.13

1.26

1.51

1.37

0.95

1.52

0.12

D17S5

-[infinity]

-1.17

0.01

0.35

0.43

0.29

0.44

0.17

D17S1298

0.44

0.42

0.35

0.26

0.13

0.05

0.44

0.00

D17S938

3.84

3.78

3.50

3.12

2.33

1.49

3.84

0.00

D17S796

4.70

4.62

4.29

3.86

2.95

1.97

4.70

0.00

D17S786

1.76

3.69

4.04

3.88

3.15

2.16

4.04

0.05

D17S804

0.47

0.56

0.75

0.83

0.77

0.55

0.84

0.12

D17S520

-[infinity]

1.12

1.71

1.81

1.58

1.11

1.81

0.10

The markers are in chromosome order, with D17S849 being the most telomeric and D17S520 the most centromeric marker.*Linkage analysis programs give Zmax at [theta] = 0 despite probable recombination in IV13 with all markers.

No mutation associated with CACD was identified within the coding region of the PITPN gene. All PCR products were of the predicted size, except for those primed with PIT1F. This primed cDNA correctly but extension with Taq polymerase skipped a section of 115 bases of exceptionally high GC content which included the first seven codons of the gene. This region was therefore sequenced from PCR products employing PIT3F as the forward primer.

Previously two separate mutations in the retinal degeneration slow (RDS) gene which codes for peripherin-RDS have been implicated as a cause of CACD. One mutation at codon 172 was found in one Spanish (8 ) and two British families (7 ) and another at codon 142 in a Dutch cohort (6 ). Our family was not linked to the peripherin-RDS gene (9 ). This is not surprising as genetic heterogeneity has been observed in several ophthalmic disorders. Peripherin-RDS mutations have been identified in both central and peripheral retinal dystrophies including autosomal dominant retinitis pigmentosa (14 ), macular dystrophies (15 ), adult vitelliform dystrophy (15 ), butterfly type of pattern dystrophy (16 ) and retinitis punctata albescens (17 ). A single peripherin-RDS mutation may produce a widely varying phenotype within the same family (18 ). Several retinal diseases have been mapped recently to chromosome 17p. These include autosomal dominant retinitis pigmentosa (19 ,20 ), Leber's congenital amaurosis (21 ) and an autosomal dominant cone degeneration (22 ).

It may be that, as is the case with the peripherin-RDS gene, one or more of these retinal dystrophies results from mutations in the same gene at the 17p13 locus. Candidate genes which have been localised to this region include PITPN, GUC2D, ARRB2, PEDF and RCV1.

The human gene for PITPN which maps to 17p13.3 (23 ) shares sequence and functional homology with part of the Drosophila retinal degeneration B gene (rdgB) (24 ). Flies carrying the rdgB mutation undergo light-enhanced retinal degeneration. It has been proposed that the rdgB mutation may alter lipid metabolism (23 ). Pathological changes in Bruch's membrane which may be related to altered lipid metabolism have been found in patients with CACD (25 ,26 ). PITPN is therefore an excellent candidate gene for inherited retinal dystrophies.

GUC2D maps to 17p13.1 (27 ). Its product, retinal guanylate cyclase, is responsible for the intracellular second messenger 3',5'-cyclic guanosine monophosphate (cGMP) which regulates phototransduction in mammals. No mutation, however, has yet been detected in this gene in inherited retinal disease.

The ARRB2 gene maps to 17p13 (28 ). It is part of a multigene family which includes [beta]-arrestin 1 and arrestin (also known as S-antigen). The primary structure of [beta]-arrestin 1 and [beta]-arrestin 2 represents a family of proteins that regulate receptor coupling to G proteins. A mutation in the arrestin gene has recently been shown to cause Oguchi disease (an autosomal recessive form of congenital stationary night blindness) (29 ).

The gene for PEDF maps to 17p13.1 (30 ). It is a member of the serine protease inhibitor gene family and is highly expressed in young adult retinal pigment epithelium cells (31 ). The PEDF protein possesses both neurotrophic and neuronal-survival activities and so its loss may produce cell senescence (31 ).

Recoverin mediates the recovery of the dark current after photoactivation in the retina and has been implicated as the self-antigen responsible for cancer associated retinopathy. One of our young affected patients (IV6) showed recombination at D17S945 (data not shown) which is within 50 kb of the RCV1 locus (32 ) and maps close to D17S804. RCV1 is therefore a less probable candidate.

Although CACD is a rare disorder, discovering linkage to chromosome 17 in this family is important not only in relation to this disease but also as it may highlight genes which may be implicated in the pathology of age related macular degeneration. This is the major cause of blindness in our elderly population and an underlying aetiology has yet to be discovered.

MATERIALS AND METHODS

Clinical description

We identified and examined a four generation family with CACD (Fig.1). Diagnosis was based on clinical ophthalmic examination including stereo fundus photography, fluorescein angiography and electrophysiological testing (33 ).Nineteen patients were found to be affected. Their findings, varying with disease state, agreed with Krill's previous classification of CACD (34 ). Individuals in generation IV showing signs suggestive of early disease were diagnosed as affected. All members of this generation were assigned to liability classes for linkage analysis as described below. The inheritance pattern in this family is autosomal dominant. One second generation member had also been seen in a reputable American retinal centre where an independent diagnosis of CACD had been made.

Approval for the study was obtained from the local Research Ethics Committee.

Genetic markers

Microsatellite polymorphisms were typed by PCR amplification of genomic DNA using standard methods. Mapping primers were purchased from Research Genetics. One primer of each pair was 5' end-labelled with [gamma] [32P] ATP. The amplification products were separated by denaturing gel electrophoresis and alleles were detected by autoradiography. Alternative primers (GTGGTCCTTGAAATCCTGGAGC and ATGTGTGAATCTGGTTTGCCCC) were synthesised for typing of D17S796. Alleles were approximately 180 base pairs in length. D17S5 was typed by Southern blotting of TaqI digested genomic DNA and hybridisation with probe pYNZ22 (35 ).

Linkage analysis

The MLINK and LINKMAP programs of FASTLINK (version 3.0) were used for computerised two-point and multipoint analysis of data (36 ,37 ), assuming autosomal dominant inheritance with a disease allele frequency of 0.0001 and complete penetrance in members of generations I, II and III. Members of generation IV were assigned to one of four age-related liability classes ranging from 80-95% likelihood of the assigned disease status. This was achieved by varying the penetrance to allow for either reduced penetrance or the presence of phenocopies in young individuals.

mRNA extraction and cDNA synthesis

Messenger RNA was extracted from whole blood using a Purescript kit (Gentra). Approximately 0.25 [mu]g of total RNA was primed with 0.5 [mu]g oligo(dT) in a reaction volume of 12 [mu]l. This was heated to 70oC for 10 min and chilled on ice. Reverse transcription was performed in a 20 [mu]l reaction mixture containing 50 mM Tris, pH 8.3; 75 mM KCl; 3 mM MgCl2; 10 mM DTT; 0.5 mM of each dNTP and 200 U of M-MLV reverse transcriptase and incubated at 37oC for 60 min.

RT-PCR and DNA sequencing

The coding region of the PITPN gene was amplified from 2 [mu]l cDNA, in a 10 [mu]l reaction mixture, initially by PCR using PIT1F and PIT1R primers (94oC for 3 min; 10 cycles of 94oC for 30 s, 70oC for 1 min, 72oC for 1 min, followed by 30 cycles of 94oC for 30 s, 68oC for 1 min, and 72oC for 1 min, with a final extension of 72oC for 10 min) and PIT3F and PIT3R (96oC for 3 min; 20 cycles of 96oC for 1 min, 67oC for 1 min, 72oC for 1 min, followed by 25 cycles of 96oC for 1 min, 64oC for 1 min, 72oC for 1 min, with a final extension of 72oC for 10 min).

This was followed by PCR with nested primers PIT2F and PIT2R or PIT4F and PIT3R (96oC for 3 min; 40 cycles of 96oC for 1 min, 65oC for 1.5 min, 72oC for 1 min, with a final extension of 72oC for 10 min).

Both strands of PCR products were sequenced on an ABI Prism 377 DNA sequencer using dye-labelled terminators. All primers described below were used as sequencing primers with AmpliTaq® DNA polymerase in accordance with Perkin Elmer protocol P/N 402078.
PIT1F

CGGAGCAGAGCACGACGAAGAC

 

94-116

PIT1R

CCTGTCACTTGGGAGGGTGGAG

 

1088-1109

PIT2F

TGACCGTCAAGTTCAAGTGGTGGGG

 

803-827

PIT2R

CAAAAAGTGCAGAGGGGAAAGGCG

 

1032-1057

PIT3F

GCAGCCACCGAGCCGTGAAGCGAC

 

193-216

PIT3R

CTTGCTTATGGATGAAGTTCTCCAC

 

841-865

PIT4F

CGTTATTACAAATGAGTACATGAAAGAAG

 

504-532

PIT4R

AGGGGTAAGCATTCCAGGCTTTC

 

471-493

PIT1FCGGAGCAGAGCACGACGAAGAC94-116PIT1RCCTGTCACTTGGGAGGGTGGAG1088-1109PIT2FTGACCGTCAAGTTCAAGTGGTGGGG803-827PIT2RCAAAAAGTGCAGAGGGGAAAGGCG1032-1057PIT3FGCAGCCACCGAGCCGTGAAGCGAC193-216PIT3RCTTGCTTATGGATGAAGTTCTCCAC841-865PIT4FCGTTATTACAAATGAGTACATGAAAGAAG504-532PIT4RAGGGGTAAGCATTCCAGGCTTTC471-493

Primers are numbered according to the sequence in GenBank accession number M73704. Primer PIT3F contains a single base mis-match nine bases from its 3' end to reduce the possibility of primer dimer formation.

ACKNOWLEDGEMENTS

This work was supported by grants from the MRC, British Council for Prevention of Blindness and the Department of Health and Social Services, Northern Ireland. We thank Dr Morna Murphy for assistance with sequencing.

REFERENCES

1 Krill, A.E. and Archer,D. (1971) Am. J. Ophthalmol., 72, 562-585. MEDLINE Abstract

2 Sorsby,A. and Crick,R.P. (1953) Br. J. Ophthalmol., 37, 129-139.

3 Ashton,N. (1995) Br. J. Ophthalmol., 37, 140-147.

4 Sandvig,K. (1955) Acta Ophthalmol., 33, 71-78.

5 Sorsby,A. (1939) Br. J. Ophthalmol., 23, 433-444.

6 Hoyng,C.B., Heutink,P., Deutman,A.F. and Oostra,B.A. (1995) Invest. Ophthalmol. Vis. Sci., 36, S 825.

7 Wroblewski,J.J., Wells,J.A.,3rd, Eckstein,A., Fitzke,F., Jubb,C., Keen,T.J.I.C, Bhattacharya,S., Arden,G.B., Jay,M. and Bird,A.C. (1994) Ophthalmol., 101, 12-22.

8 Reig,C., Serra,A., Gean,E., Vidal,M., Arumi,J., Calzada,M.D.D., Antich,J. and Carballo,M. (1995) Ophthal. Paed. Genet., 16, 39.

9 Silvestri,G., Lotery,A.J., Collins,A.D., Ennis,K. and Hughes,A.E. (1995) Vis. Res., 35, 1141.

10 Dickeson,S.K., Helmkamp,G.M.,Jr. and Yarbrough,L.R. (1994) Gene, 142, 301-305. MEDLINE Abstract

11 Gerken,S.C., Albertsen,H., Elsner,T., Ballard,L., Holik,P., Lawrence,E., Moore,M., Zhao,X. and White,R. (1995) Am. J. Hum. Genet., 56, 484-499. MEDLINE Abstract

12 CHCL maps. (ftp.chcl.org).

13 Gyapay,G., Morisette,J., Vignal,A., Dib,C., Fizames,C., Millasseau,P., Marc,S., Bernardi,G., Lathrop,M. and Weissenbach,J. (1994) Nature Genet., 7, 246-339. MEDLINE Abstract

14 Farrar,G., Kenna,P., Jordan,S., Kumar-Singh,R., Humphries,M., Sharp,E., Shiels,D. and Humphries,P. (1991) Nature, 354, 478-480. MEDLINE Abstract

15 Wells,J., Wroblewski,J., Keen,T., Inglehearn,C., Jubb,C., Eckstein,E., Jay,J., Arden,G., Bhattacharya,S., Fritzke,F. and Bird,A. (1993) Nature Genet., 3, 213-218. MEDLINE Abstract

16 Nichols,B., Sheffield,V., Vadenburgh,K., Drack,A., Kimura,A. and Stone,E. (1993) Nature Genet., 3, 202-207. MEDLINE Abstract

17 Kajiwara,K., Sanberg,M., Berson,E. and Dryja,T. (1994) Nature Genet., 3, 208-212.

18 Weleber,R., Carr,R., Murphey,W., Sheffield,V. and Stone,E. (1993) Arch. Ophthalmol., 111, 1531-1542. MEDLINE Abstract

19 Greenberg,J., Goliath,R., Beighton,P. and Ramesar,R. (1994) Hum. Mol. Genet., 3, 915-918. MEDLINE Abstract

20 Kojis,T.L., Heinzmann,C., Heckenlively,J.R., Flodman,P., Ngo,J.T., Spence,M.A., Sparkes,R.S. and Bateman,J.B. (1995) Am. J. Hum. Genet., 57, A216.

21 Camuzat,A., Dollfus,H., Rozet,J.M., Gerber,S., Bonneau,D., Bonnemaison,M., Briard,M., Dufier,J.L., Ghazi,I., Leowski,C., Weissenbach,J., Frezal,J., Munnich,A. and Kaplan,J. (1995) Hum. Mol. Genet., 4, 1447-1452. MEDLINE Abstract

22 Small,K.W., Mullen,L., Syrquin,M., Gehrs,K. and Inana,G. (1995) Am. J. Hum. Genet., 57, A203.

23 Fitzgibbon,J., Pilz,A., Gayther,S., Appukuttan,B., Dulai,K.S., Delhanty,J.D.A., Helmkamp,J., Yarbrough,L.R. and Hunt,D.M. (1994) Cytogenet. Cell Genet., 67, 205-207. MEDLINE Abstract

24 Vihtelic,T.S., Goebl,M., Milligan,S., O'Tousa,J.E. and Hyde,D.R. (1993) J. Cell Biol., 122, 1013-1022. MEDLINE Abstract

25 Babel,M.J. (1958) Soc. Franc. Ophthalmol., 70, 389-398.

26 Howard,G.M. and Wolf,E. (1964) Trans. Am. Acad. Opthalmol. Otolaryng., 68, 647-660.

27 Oliveira, L., Miniou, P., Viegas-Pequignot, E., Rozet, J., Dollfus, H. and Pittler, S. J. (1994) Genomics, 22, 478-481. MEDLINE Abstract

28 Calabrese, G., Sallese, M., Stornaiuolo, A., Stuppia, L., Palka, G. and De Blasi, A. (1994) Genomics, 23, 286-288. MEDLINE Abstract

29 Fuchs, S., Nakazawa, M., Maw, M., Tamai, M., Oguchi, Y. and Gal, A. (1995) Nature Genet., 10, 360-362. MEDLINE Abstract

30 Tombran-Tink,J., Pawar,H., Swaroop,A., Rodriguez,I., Chader,G.J. (1994) Genomics, 19, 266-272.

31 Tombran-Tink,J., Shivaram,S.M., Chader,G.J., Johnson,L.V., Bok,D. (1995) J. Neurosci., 15, 4992-5003. MEDLINE Abstract

32 Wiechmann, A. F., Akots, G., Hammarback, J. A., Pettenati, M. J., Rao, P. N. and Bowden, D. W. (1994) Invest. Ophthalmol.Vis. Sci., 35, 325-331.

33 Lotery, A. J., Collins, A. D. and Silvestri, G. (1995) Invest. Ophthalmol. Vis. Sci., 36, S854.

34 Krill,A.E. (1977) In Krill's Hereditary retinal and choroidal diseases, Harper and Row, Publishers, Inc. Vol.II: pp. 939-961.

35 Nakamura,Y., Ballard,L., Lalouel,J.M., Lathrop,G.M., Leppert,M., O'Connell,P. and White,R. (1988) Nucleic Acids Res., 16, 5707. MEDLINE Abstract

36 Lathrop,G.M. and Lalouel,J.M. (1984) Am. J. Hum. Genet., 36, 460-465. MEDLINE Abstract

37 Cottingham,R.W., Idury,R.M. and Schaffer,A.A. (1993) Am. J. Hum. Genet., 252-263. MEDLINE Abstract


*To whom correspondence should be addressed


This page is maintained by OUP admin. Last updated Thu Oct 31 15:23:49 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Med. Genet.Home page
Z Yang, G Kitsos, Z Tong, M Payne, S Gorezis, K Psilas, M Grigoriadou, Y Zhao, S Kamaya, G Aperis, et al.
A novel locus on 19q13 associated with autosomal-dominant macular dystrophy in a large Greek family
J. Med. Genet., December 1, 2006; 43(12): e57 - e57.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
M Michaelides, D M Hunt, and A T Moore
The genetics of inherited macular dystrophies
J. Med. Genet., September 1, 2003; 40(9): 641 - 650.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
R. Z. Renno, A. I. Youssri, N. Michaud, E. S. Gragoudas, and J. W. Miller
Expression of Pigment Epithelium-Derived Factor in Experimental Choroidal Neovascularization
Invest. Ophthalmol. Vis. Sci., May 1, 2002; 43(5): 1574 - 1580.
[Abstract] [Full Text] [PDF]


Home page
Br J OphthalmolHome page
B J. Klevering, M. van Driel, A. J M van Hogerwou, D. J R van de Pol, A. F Deutman, A. J L G Pinckers, F. P M Cremers, and C. B Hoyng
Central areolar choroidal dystrophy associated with dominantly inherited drusen
Br J Ophthalmol, January 1, 2002; 86(1): 91 - 96.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
A. M Payne, A. G Morris, S. M Downes, S. Johnson, A. C Bird, A. T Moore, S. S Bhattacharya, and D. M Hunt
Clustering and frequency of mutations in the retinal guanylate cyclase (GUCY2D) gene in patients with dominant cone-rod dystrophies
J. Med. Genet., September 1, 2001; 38(9): 611 - 614.
[Full Text] [PDF]


Home page
IOVSHome page
J. B. Bateman, D. D. Geyer, P. Flodman, M. Johannes, J. Sikela, N. Walter, A. T. Moreira, K. Clancy, and M. A. Spence
A New {beta}A1-Crystallin Splice Junction Mutation in Autosomal Dominant Cataract
Invest. Ophthalmol. Vis. Sci., October 1, 2000; 41(11): 3278 - 3285.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
E. Alberdi, M. S. Aymerich, and S. P. Becerra
Binding of Pigment Epithelium-derived Factor (PEDF) to Retinoblastoma Cells and Cerebellar Granule Neurons. EVIDENCE FOR A PEDF RECEPTOR
J. Biol. Chem., October 29, 1999; 274(44): 31605 - 31612.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (24)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lotery, A. J.
Right arrow Articles by Hughes, A. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lotery, A. J.
Right arrow Articles by Hughes, A. E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?