Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (87)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Gong, W.
Right arrow Articles by Budarf, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gong, W.
Right arrow Articles by Budarf, M. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 789-801

A transcription map of the DiGeorge and velo-cardio-facial syndrome minimal critical region on 22q11
Introduction
Results
   Isolation of cDNA clones
   Assembly of genes (transcription units)
   Orientation of transcripts in the MDGCR
   CpG islands in the MDGCR
   Comparison between computational and experimental approaches
Discussion
Materials And Methods
   Cosmid contig construction
   cDNA selection
   Southern and Northern hybridization
   RT-PCR
   STS generation
   RACE-PCR
   DNA sequencing
Acknowledgements
References


A transcription map of the DiGeorge and velo-cardio-facial syndrome minimal critical region on 22q11

A transcription map of the DiGeorge and velo-cardio-facial syndrome minimal critical region on 22q11 Weilong Gong1, Beverly S. Emanuel1,2, Joelle Collins1, David H. Kim1, Zhili Wang3, Feng Chen3, Guozhong Zhang3, Bruce Roe3 and Marcia L. Budarf1,2,*

1The Division of Human Genetics and Molecular Biology, The Children's Hospital of Philadelphia, Philadelphia, PA, USA, 2The Department of Pediatrics University of Pennsylvania School of Medicine, Philadelphia, PA, USA and 3Departments of Chemistry and Biochemistry, University of Oklahoma, Norman, OK, USA

Received January 15, 1996; Revised and Accepted March 27, 1996GenBank accession nos. L77559-L77571

The majority of patients with DiGeorge syndrome (DGS) and velo-cardio-facial syndrome (VCFS) have a microdeletion of 22q11. Using translocation breakpoints and fluorescence in situ hybridization analysis (FISH), the minimal DiGeorge critical region (MDGCR) has been narrowed to 250 kb in the vicinity of D22S75 (N25). The construction of a detailed transcription map covering the MDGCR is an essential first step toward the identification of genes important to the etiology of DGS/VCFS, two complex disorders. We have identified a minimum of 11 transcription units encoded in the MDGCR using a combination of methods including cDNA selection, RT-PCR, RACE and genomic sequencing. This approach is somewhat unique and may serve as a model for gene identification. Of the 11 transcripts, one is the previously reported DGCR2/IDD/LAN gene, and three revealed a high level of similarity to mammalian genes: a Mus musculus serine/threonine kinase, a rat tricarboxylate transport protein and a bovine clathrin heavy chain. The remaining transcripts do not demonstrate any significant homology to genes of known function. The identification of these transcription units in the MDGCR will facilitate their further characterization and help elucidate their role in the etiology of DGS/VCFS.

INTRODUCTION

DiGeorge syndrome (DGS) is a developmental anomaly of the derivatives of the 3rd and 4th pharyngeal pouches. It is associated with a spectrum of malformations, including absence or hypoplasia of the thymus and parathyroid glands, cardiovascular anomalies and mild craniofacial dysmorphia. It has been proposed that the primary defect in DGS is the failure of cephalic neural crest cells to migrate properly during early embryonic development (1 ,2 ). Previously, cytogenetic studies of patients with DGS demonstrated that ~20% have chromosomal abnormalities, with the majority of these chromosomal rearrangements involving the loss of the proximal long arm of chromosome 22 (3 ). These results suggested that monosomy for 22q11 may play a significant role in the etiology of DGS. Subsequently, molecular studies have demonstrated the validity of this hypothesis (4 ,5 ) and microdeletions have been detected in 89% of the patients we have studied with DGS (6 ).

Velo-cardio-facial syndrome (VCFS) is a common autosomal dominant disorder characterized by cleft palate, cardiac anomalies, typical facies and learning disabilities. Due to the phenotypic overlap between VCFS and DGS, it was postulated that both diseases might share a common pathogenesis or be etiologically related (7 ). Using the 22q11.2 markers deleted in patients with DGS, it was possible to demonstrate that the majority of VCFS patients are hemizygous for the same region (8 ). Currently, over 85% of the patients we have studied with a clinical diagnosis of VCFS have microdeletions of 22q11.2. These findings indicate that haploinsufficiency of this region is a major factor in the development of this disorder (6 ).

The majority of DGS/VCFS patients have a large deletion which includes a common set of markers in 22q11.2 (4 ,6 ). This `commonly deleted region' has been estimated to be greater than 1.5 Mb based on pulsed-field gel analysis (9 ). However, individual patients can have deletions which extend either proximally, distally or in both directions (4 ). Using translocation breakpoints and fluorescence in situ hybridization analysis (FISH), the region critical to DGS/VCFS has been narrowed to a 250 kb area in the proximal portion of the commonly deleted region (9 ,10 ). This region (Fig. 1 A, B) includes the marker D22S75 which is the most consistently deleted marker in our patient studies (6 ,10 ). Further, the breakpoint region of ADU, the only known balanced translocation patient with the DGS/VCFS phenotype, maps to the proximal portion of this 250 kb region (9 ,11 ). These data suggest that one or more of the genes in this minimal DGS/VCFS critical region (MDGCR) are strong candidates for involvement in the pathogenesis of these diseases.


Figure 1.Integration of cosmid and transcription maps in the 250 kb of MDGCR. (A) A diagram showing the relative order of loci in 22q11.2 within the region commonly deleted in DGS/VCFS patients. (B) Expanded view of the MDGCR showing markers, CpG islands and the balanced (2;22) translocation of ADU. The markers include the randomly isolated marker D22S75 (N25) and gene-based STSs generated by PCR with primers derived from the cDNAs shown in Table 1. CpG islands detected by restriction mapping are indicated by diamonds. (C) Cosmid contig covering the 250 kb genomic region which represents the MDGCR. (D) The cDNAs identified by cosmids were assembled into 16 contigs. The gaps between contigs 5 and 6, and between contigs 14 and 15 are indicated by vertical arrows. These were joined by RT-PCR products generated using primers derived from end sequences of the corresponding contigs. Contig 6 was extended in the 5' direction by a 5'RACE fragment as shown. (E) Transcription map consisting of the 11 transcription units indicated in Table 2. The orientation of the transcripts, when known, is indicated by an arrow (5' -> 3'). The length of the arrow corresponds to the estimated distance that the cDNA spans in the genomic DNA, not the size of the transcript on Northerns. The two stippled lines represent the two strands of DNA. The solid lines between the two strands of DNA indicate the intronless expressed sequences for which the direction of transcription is unknown.

The construction of a detailed transcription map of the MDGCR is an essential step toward the identification of specific genes important to the etiology of DGS/VCFS, particularly in light of the variability of the phenotype associated with this deletion. In the present study, we have used a cosmid contig and a cDNA selection-based approach to isolate transcripts in the MDGCR. Concurrent with the construction of this transcription map, large-scale genomic sequencing of the entire commonly deleted region has been ongoing (Roe et al., in preparation). The availability of the genomic sequence for a portion of the MDGCR assisted in the detailed analysis of these transcripts by permitting the unambiguous positioning of the cDNAs in the contig and in some cases, the determination of the direction of transcription and the identification of intron-exon structure. Further, the use of GRAIL (12 ) and BLAST (13 ) programs has facilitated the assembly of cDNA clones into transcription units. Here we report the identification of a minimum of 11 transcription units in the 250 kb of the MDGCR which can be considered candidates for the major features of DGS/VCFS.

RESULTS

Isolation of cDNA clones

A cosmid contig representing a 250 kb genomic region (MDGCR) containing the marker D22S75 (clone name N25) and the balanced (2;22)(q14;q11.21) translocation breakpoint (ADU) has been constructed (Fig. 1 ). From this contig, seven minimally overlapping cosmids were used to isolate region-specific cDNAs by cDNA selection (Fig. 1 C). To increase the complexity of the starting material, poly(A) RNA from fetal brain, fetal liver and adult skeletal muscle was used to synthesize the cDNA utilized in the cDNA selection. In total, 567 colonies were selected and used as a cDNA reference sublibrary. The sizes of the cDNA inserts were determined using PCR with primers specific for each linker (see Materials and Methods). The average insert size in the cDNA sublibrary was 550 bp (ranging from 350 bp to 1.2 kb).

The next step was to regionally assign the cDNA clones by hybridizing each of the seven cosmids to the nylon filters containing the arrayed cDNAs. This resulted in the identification of 429 cDNAs, including the 57 clones detected by the positive control probes previously mapped to the MDGCR, and five of 34 Alu-positive cDNAs (see Materials and Methods). An additional 50 cDNAs were detected by cDNA walking or with the use of RT-PCR products generated during subsequent steps (see below). Since these latter probes were generated from expressed sequences, they had greater sensitivity than the cosmid probes. In total, 479 cDNAs from the cDNA sublibrary (85%) mapped back to the 250 kb MDGCR. Of the 479 cDNAs, 129 clones were derived from fetal brain, 122 clones from fetal liver and 228 clones from adult skeletal muscle. The remaining 88 clones (15%) either contained repetitive sequences (29/88), small or no insert (23/88), multiple inserts (6/88), or they grew poorly (30/88).

Assembly of genes (transcription units)

Based on clone overlap, the smallest number of cDNA contigs that could be assembled was 16 (Fig. 1 D) from which primers for PCR were generated (Fig. 1 B and Table 1 ). For details of cDNA contig construction see Materials and Methods. To further assemble the contigs into transcription units, results from Northern blot experiments were compared. If clones from adjacent contigs detected the same size transcript(s) and tissue distribution on Northern blots, this was taken as evidence that the clones could be part of the same transcript. In a few cases, searches against nucleotide and/or protein sequence databases demonstrated that non-overlapping clones had similarity to the same entry, suggesting that they could be from the same transcription unit. To verify that non-overlapping clones were part of the same transcript, primers to sequences at the adjacent ends of two neighboring cDNA contigs were synthesized and tested for the ability to generate a specific PCR product from primary cDNA. The RT-PCR product generated from these experiments was isolated and sequenced to confirm the specificity of the reaction. Using this approach, we assembled 11 transcription units (DGS-A to DGS-K) in the MDGCR (Fig. 1 E and Table 2 ). Listed in Table 3 are the number and tissue distribution of the cDNA clones identified for each contig. Not all clones were analyzed for gene assembly because they were duplicates or represented smaller clones of the same region.

Table 1 . STSs from cDNA sequences in the MDGCR Origin
Name

Primers (5'-3')

Size of PCR fragment (bp)

 

Tm

 

 

TH*

FB*

FL*

ASM*

 

 

D22S1566

TGGGCTAATTTTGGTTTTGC

2099

2099

-

2099

60oC

c2E9 (DGS-A)

 

ACAGCCACATAGTCTTGGGG

D22S1575

GAGAAACATACAAATCAGGCCC

162

162

-

162

58oC

c3B3 (DGS-B)

 

ACGTGTTTACTGGAGAGTGTGA

D22S1570

GTCAGGGCTTACCTGCTCAG

283

283

283

283

60oC

c4E7 (Contig 3)

 

TTGCCTGATGTGGGTAACAA

 

D22S1573

GAGCCATGCACAGCAATG

620

620

620

620

59.8oC

c5H5 (LAN)

 

GGCTCGCGTGTGTACATAGA

D22S1578

CTTCTGCTGCAGGATAACTGG

351

-

-

351

60oC

c5G9 (DGS-E)

 

CACTATGGAGAGAGGAGTGCG

D22S1569

CTCCATGCTGTCTTCCATAGTG

163

163

163

163

59.8oC

c3G11 (DGS-F)

 

GTAAGCCAAAACCACAATAGGC

D22S1572

AAGATCTCGTAAGTCTTGATGATGG

101

-

-

101

60oC

c5C4 (DGS-G)

 

AAGAAAACACCTACTGACTTTGTGG

 

D22S1577

CCCTCTGCTATAGGCACTGC

705

705

705

705

60oC

c4E8 (DGS-H)

 

CAGATGCTCAGGTACAGGCA

D22S1568

CTTCTGTGTGCGTGTGGTG

128

128

128

128

60oC

c4H2 (DGS-I)

 

TGGCAAAGAGGGCTTTCTAA

D22S1571

TGATGAAGTGGTGAAGCTGC

170

170

170

170

60oC

c2C3 (CTP)

 

CAGGCTACAGAGCTCGAG

 

 

D22S1576

GATTGCCAAGAGGCTGAGAG

181

181

181

181

600C

c5F7 (CHCL)

 

AGACCAGCTTTAGCCGACAA

 

 

D22S1567

CTGGCTGACTGAACAACTTCC

175

175

175

175

60oC

c2C2 (CHCL)

 

AGCACATTGGAAACCTGGAC

D22S1574

AAGGCACAGAATGGAGGAGA

146

-

-

146

59.8oC

c2A5 (Contig 16)

 

ATAATTCCCATTGCCTGCAG

*TH: total human DNA; FB: fetal brain cDNA; FL: fetal liver cDNA; ASM: adult skeletal muscle cDNA.-indicates that no specific PCR product was generated. PCR reaction conditions for the generation of these STSs are described in Material and Methods.

Table 2 Analysis of transcripts in the 250 kb of the MDGCR
Transcript

Polyadenylation

Size

Tissue specificity of

cDNA contig

Similarity

cDNA accession

 

signal

(kb)

expressed sequence

 

 

number

DGS-A

unknown

-

RT-PCR from skeletal

contig 1

ESTs Z42407, Z38613, R19565, R38591

L77571

 

 

 

muscle and brain

 

H17163, H17948

DGS-B

unknown

1.6

several tissues, especially

contig 2

none known

L77559

 

 

 

high in heart and

 

 

 

skeletal muscle

LAN

AATAAA

4.5

all tissues tested

contig 5

45 ESTs including H41480, H19994, H40233

L77560*

(DGS-C)

 

 

contig 6

H27860, H43590, H39205,H45536, H42939

 

 

 

 

 

H45563, R73309, H40232, H12814, R72407

 

 

 

 

 

 

R54510, H15777, H42934, H42870. H42972

 

 

 

 

 

etc.

DGS-D

AATAAA

1.6, 4.0

all tissues tested

contig 7

EST F04376, Z45514, H55785, H55879

L77561*

DGS-E

unknown

1.35, 1.6

several tissues, but very

contig 8

none known

L77562*

 

 

 

low expression level

 

 

 

in brain, placenta and lung

 

 

2.0

liver only

 

 

 

DGS-F

unknown

1.8

all tissues tested

contig 9

none known

L77563*

 

 

2.6

several tissues, but lower

 

 

 

expression level

 

 

 

DGS-G

AATAAA

1.8

testis

contig 10

mus musculus serine threonine kinase

L77564*

 

 

 

 

 

EST D61510

 

DGS-H

ATTAAA

1.2

skeletal muscle, heart

contig 11

none known

L77565*

DGS-I

ATTAAA

1.7

all tissues tested

contig 12

ESTs Z38497, F05516, R23410,

L77566*

 

 

5.2

skeletal muscle, heart

 

H05365, R44195

CTP

AATAAA

1.8

all tissues, but very

contig 13

Rat tricarboxylate transport protein

L77567**

(DGS-J)

 

 

low expression in

 

16 ESTs: T50580, F08153, R72468, H27262

 

 

 

 

skeletal muscle

 

R55394, H42358, H44309, R72424, R26361,

 

 

 

 

 

F12880, H43127, R72578, R52240, R73208,

 

 

 

 

 

T91416, R70172

 

CLTCL

ATTAAA

5.5

skeletal muscle

contig 14

clathrin heavy chain mRNA

L77568**

(DGS-K)

 

 

 

contig 15

*Corresponding genomic sequence accession number: L77570**Corresponding genomic sequence accession number: L77569

Table 3 . Construction of cDNA contigs in the MDGCR cDNA clones
cDNA

Positive cDNA clones

 

contig

FB*

FL*

ASM*

total

analyzed

contig 1

18

5

0

23

5

contig 2

14

0

0

14

7

contig 3

2

0

20

22

9

contig 4

0

1

0

1

1

contig 5

14

24

24

62

24

contig 6

23

18

34

75

25

contig 7

8

12

0

20

4

contig 8

2

16

6

24

12

contig 9

1

0

0

1

1

contig 10

18

3

16

37

16

contig 11

0

12

19

31

3

contig 12

0

6

33

39

12

contig 13

13

12

23

48

18

contig 14

6

13

38

57

24

contig 15

5

0

5

10

5

contig 16

5

0

10

15

3

Total

129

122

228

479

169

*FB: fetal brain, FL: fetal liver, ASM: adult skeletal muscle

DGS-A lies in the most centromeric region of the MDGCR and was assembled from five cDNA clones which constitute the minimal overlap for contig 1 (C-1 in Fig. 1 D and E). Northern blot hybridization with cDNAs from this contig did not give a positive signal for any of the 16 adult and four fetal tissues tested, but RT-PCR products of the expected size were successfully amplified from fetal brain and skeletal muscle mRNA using primers derived from this contig (D22S1566, Fig. 1 B and Table 1 ). No specific amplification occurred when the reverse transcriptase was omitted from the first step of cDNA synthesis, indicating that the RT-PCR product was not due to genomic DNA contamination. These results suggest that DGS-A is a low abundance transcript. Based on the combined sequence data, DGS-A represents 2.3 kb of expressed sequence containing no introns. The presence of a poly(A) tail in the 3' end of DGS-A indicates its orientation as being centromere to telomere (5' -> 3') (Fig. 1 E). Further, six ESTs (Table 2 ) were detected from the EST database (dbEST) with greater than 97% identity to this transcript. The dbEST ESTs were derived from fetal brain cDNAs. Searching nucleotide and amino acid sequence databases using the BLAST e-mail server at the National Center for Biotechnology Information (NCBI), a match was obtained with the human membrane protein-like protein (HMPL, accession no. U21556). There was 86% identity over 920 bp. However, the significance of this high level of similarity is difficult to assess because there is little information regarding HMPL which is not yet published.

DGS-B was represented by contig 2 (C-2 in Fig. 1 D and E) and on Northern blots identified a 1.6 kb message in several tissues with strongest signal in heart and skeletal muscle (Fig. 2 and Table 2 ). This transcript maps 4.8 kb proximal to the (2;22) balanced translocation breakpoint of a DGS proband, ADU, and has been previously described as DGCR4 (9 ). Similarity searches of nucleotide and protein sequence databases did not find any significant matches. Primers between cDNA contig 1/DGS-A and contig 2/DGS-B failed to amplify a RT-PCR product, suggesting that the two contigs are not derived from a single gene. This result is consistent with the Northern blot analysis of the two contigs.


Figure 2.Multiple tissue Northern blot analysis of cDNAs DGS-B to CLTCL (DGS-K). The same eight tissue sources were used for all but DGS-G. In this case, hybridization signal for heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas were all negative and a second Northern blot was used, demonstrating the results shown. Hybridization to a [beta]-actin probe was used to determine the RNA content of each lane in the Northern blots.

Contig 3 (C-3 in Fig. 1 D) maps 2 kb centromeric to the ADU breakpoint and consists of 786 bp of sequence assembled from a set of overlapping cDNAs derived from the fetal brain and adult skeletal muscle sources. Using primers from contig 3 (D22S1570, Table 1 ), a 283 bp RT-PCR product was generated from adult skeletal muscle and fetal brain mRNAs, but not from fetal liver, indicating that the transcript is either not expressed in liver or is in low abundance. On Northern blot analysis, the cDNAs from contig 3 did not detect any transcripts. PCR products generated from cDNA or genomic DNA give the same sized product suggesting that contig 3 represents expressed sequence without introns. Contig 4 (C-4 in Fig. 1 D) consists of one 445 bp cDNA clone derived from fetal liver mRNA. Similar to contig 3, this cDNA failed to identify mRNAs on Northern blot analysis. However, comparison of PCR products from cDNA and genomic DNA demonstrates that contig 4 consists of two exons separated by a 120 bp intron. This cDNA is 6 kb telomeric to the ADU breakpoint. To date, we have been unable to assemble contigs 3 or 4 with the other cDNA contigs. Additional studies will be required to determine whether these two contigs represent independent genes. Thus, in the most centromeric 20 kb of the MDGCR, we conservatively estimate that there are a minimum of two tightly clustered transcription units (DGS-A and -B).

The next transcription unit was assembled from cDNAs in contigs 5 and 6 (C-5 and C-6 in Fig. 1 D and E). The 24 clones in contig 5 were first identified by hybridization with a novel, partial cDNA, LAN (9 ). For this reason we refer to this gene as LAN rather than DGS-C. The original LAN cDNA was isolated from a human fetal brain cDNA library probed with cosmid 46A9 (Fig. 1 C). LAN has a 2.4 kb insert and recognizes a 4.5 kb transcript expressed in all tissues tested (9 ). cDNA clones from contig 6 also identified a transcript of similar size and tissue distribution to LAN (Fig. 2 ), suggesting that these two contigs might be derived from the same transcript. To determine if this was the case, RT-PCR was performed on fetal brain, fetal liver and adult skeletal muscle mRNA using primers derived from end sequences of contigs 5 and 6. These primers amplified a 820 bp product. Sequence analysis of this RT-PCR fragment indicates that it matches the genomic sequence between contig 5 and 6 and confirms that these two contigs are part of the same gene. A 450 bp 5' rapid amplification of cDNA ends (5' RACE) fragment was generated using a primer designed from contig 6. The sequence of the 5' RACE fragment matched the corresponding genomic sequence and permitted the positioning of the 5' end of LAN in the proximal portion of cosmid 111F11. These studies allowed the assembly of 4458 bp of sequence which represent the complete expressed sequence of LAN. The transcript covers greater than 80 kb of genomic DNA and contains 10 exons. LAN also corresponds to the recently reported DGCR2/IDD gene (14 ,15 ) and identifies numerous ESTs in dbEST (Table 2 ). The database search for homology to known proteins revealed similarities in the predicted N-terminal region with Cys-rich related proteins, such as low-density lipoprotein receptor (LDLR) (p = 5.4e-09), murine AM2 receptor (p = 2.5e-08), [alpha]-2-macroglobulin receptor (p = 3.1e-08) and mouse perlecan (p = 3.3e-08).

DGS-D and -E were assembled from contigs 7 and 8, respectively (C-7 and C-8 in Fig. 1 D and E). Although the cDNAs in these contigs as well as in contig 6/LAN were identified by the same cosmid, 87H3, the cDNAs from contig 6 did not cross hybridize to those from contig 7 or contig 8. Subsequent sequence analysis of these cDNA clones and comparison to the cosmid sequence showed that contig 7 represents a transcript from within the intron between exon 7 and exon 8 of LAN. Similarly, contig 8 lies within the intron between exon 5 and exon 6 of LAN (Fig. 1 D). Northern blot analysis using probes from contigs 7 and 8 demonstrate that they each recognize transcripts of different size and tissue distribution (Fig. 2 and Table 2 ), suggesting that they represent independent genes (DGS-D and -E, respectively). DGS-D/contig 7 consists of 1170 bp of sequence including a polyadenylation signal followed by a poly(A) tail allowing the orientation of this transcript from telomere to centromere (Fig. 1 E), the same direction as LAN. Four EST matches with 94-99% identities were obtained by searching the dbEST database. The 803 bp of sequence which constitutes DGS-E is the same in genomic and cDNA and does not contain a polyadenylation signal. To address the possibility that DGS-E represents amplified genomic DNA resulting from genomic contamination in the initial mRNA, RT-PCR was carried out on fetal brain, fetal liver and skeletal muscle mRNA using the primers described in Table 3 . A single PCR product of the expected size was generated only from the adult skeletal muscle mRNA source. If reverse transcriptase was omitted during the first step of cDNA synthesis, no amplification product was obtained. These data, combined with the Northern blot analysis, suggests that DGS-E is expressed. Database searches using DGS-E sequence did not detect any similarity to previously identified genes or ESTs.

Similar experiments were performed for DGS-F, which is represented by contig 9 (C-9 in Fig. 1 D and E) and contains a single cDNA derived from fetal brain. By sequence analysis, this 657 bp clone is intronless and maps into the first intron of LAN (Fig. 1 D). On Northern blots, two transcripts were identified in all tissues tested (Fig. 2 ). The expression pattern of DGS-F is different from the other transcripts in the region, suggesting that DGS-F is distinct. Using primers designed from the cDNA sequence, RT-PCR was performed and a 163 bp RT-PCR product was obtained from mRNAs of several tissues (D22S1569, Fig. 1 B and Table 1 ). Control reactions lacking reverse transcriptase failed to generate a PCR product, indicating that genomic contamination was not responsible for the results. No significant similarity to known genes or proteins were identified by sequence analysis of DGS-F.

In the central portion of the 250 kb region, we identified four transcription units, DGS-G, -H, -I and -J. The most proximal of these, DGS-G, was assembled from cDNAs in contig 10 (Fig. 1 D and E). Results from Northern blot analysis of DGS-G show a 1.8 kb transcript in testis mRNA only (Fig. 2 ). Sequence from the multiple overlapping cDNA clones was assembled and nucleotide and protein databases were searched with the nucleotide and deduced amino acid sequences of DGS-G using BLASTN and BLASTP. A match was obtained with a Mus musculus serine/threonine kinase (accession no. U01840). The alignment of the deduced amino acid sequences demonstrates 94% identity over 273 amino acids (Fig. 3 A). There is one EST in dbEST for this transcript (Table 2 ).


Figure 3.Comparison of the deduced amino acid sequences. Numbers refer to the positions in the protein sequences. Identical residues are represented by vertical lines. Similarities are indicated by one dot or two dots with two dots representing greater similarity. (A) The top line represents the amino acid (aa) sequence of DGS-G and the lower line represents the amino acid sequence of the mouse serine/threonine kinase (U01840). All 14 of the most highly conserved amino acids are indicated by asterisks (*). The consensus in subdomain VI and VIII (as designated in Hanks et al., 31) are shown within frames. (B) Amino acid sequence alignment of CTP (top) and the rat mitochondrial tricarboxylate transporter (P32089) (bottom). (C) Comparison of amino acid sequences of CLTCL (top) and bovine clathrin heavy chain mRNA (U31357).

DGS-H was assembled from the three cDNAs in contig 11 (C-11 in Fig. 1 D and E). These clones recognize a 1.2 kb message in skeletal muscle and heart (Fig. 2 ). All three cDNAs were sequenced and a 1145 bp intronless cDNA could be assembled from the data. The poly(A) tail, present in the cDNA sequence, indicated the orientation of the transcript is from telomere to centromere (Fig. 1 E). Further, the results from the cDNA selection experiments of DGS-H agree with sequence data obtained from cDNA clones identified from a skeletal muscle and a retinal cDNA library (Clontech and J. Nathans, respectively). No significant homologies were found to any sequences in the nucleotide databases.

DGS-I is represented by a set of overlapping expressed sequences which comprise contig 12 (C-12 in Fig. 1 D and E). Two transcripts were identified on Northern blots probed with cDNAs from this contig. One is 1.7 kb in size expressed in all tissues and the other is 5.2 kb expressed only in heart and skeletal muscle (Fig. 2 ). 5' RACE was performed and a 320 bp product was isolated. Sequence analysis of this PCR product shows 13 bp 5' of the first AUG. Thus, further experiments are necessary to demonstrate whether this represents the bona fide 5' end of DGS-I. Sequence analysis of the 3'-rapid amplification of cDNA ends (3' RACE) product showed a poly(A) tail preceded by a polyadenylation signal, indicating that the direction of transcription for DGS-I is the same as DGS-H (Fig. 1 E). The 1716 bp of assembled DGS-I sequence represent 10 exons spanning approximately 11 kb of genomic sequence. Five EST matches were identified in dbEST (Table 2 ). A database search for homology to known proteins revealed a significant degree of similarity to a C. elegans hypothetical 58.3 kDa protein F42H10.7 (accession no. P34420). There is 50% similarity and 28% identity over 500 amino acids with higher conservation in the N-terminal region (data not shown). These results suggest that DGS-I may be a member of a novel class of proteins whose function is unknown.

The fourth gene in this area is represented by contig 13 (C-13 in Fig. 1 D and E). Using clones from either the 5' or 3' regions of this contig as probes on Northern blots, a 1.8 kb transcript was recognized in all tissues with a very low level of expression in skeletal muscle (Fig. 2 and Table 2 ). Sequence analysis (BLASTN and BLASTP) showed that this transcript has a high level of homology with a rat tricarboxylate transport protein mRNA, showing 98% similarity over 311 amino acids (Fig. 3 B). Based on the high degree of similarity this gene has been referred to as CTP for citrate transport protein rather than DGS-J. Searching of dbEST using CTP identified 16 ESTs (with 95-100% identities) derived from multiple tissues (fetal brain, fetal liver, placenta, breast, ovary, and spleen) (Table 2 ), indicating that this gene is abundantly expressed. Similar results were obtained using a computational approach for gene identification (Goldmuntz et al., in press). Although this transcript has low expression in skeletal muscle, four cDNA clones were isolated from the skeletal muscle mRNA and by sequence analysis alternative splicing in the 3' untranslated region was found in two of the four cDNAs. As a result of alternative splicing, the skeletal muscle transcript contains 10 exons instead of the nine exons in the cDNA clone identified from a fetal brain library.

In the distal portion of the MDGCR we identified a single transcription unit, DGS-K, which extends over 50 kb of genomic DNA. This transcript was assembled from cDNA contigs 14 and 15, and an RT-PCR product between the two contigs (Fig. 1 D and E). Contig 14 contains cDNAs which are positive for the probe N25-wa which was isolated from a fetal brain cDNA library using cosmid 79H12 as probe. N25-wa has a 3.4 kb insert which includes a poly(A) tail (16 ). Based on the hybridization and sequence data, contigs 14 and 15 are not overlapping but recognize a similar transcript on Northern blots. The transcript is 5.5 kb in length and in adult tissue is expressed only in skeletal muscle (Fig. 2 and Table 2 ). However, a very low level of the same size transcript can be detected on Northern blots of fetal kidney and liver. BLASTN searches against GenBank showed that both contigs had similarity to clathrin heavy chain, providing additional evidence that the two contigs could be linked. To connect contigs 14 and 15, primers from the adjacent ends of each were selected which amplified a 1.3 kb fragment from fetal brain, fetal liver and adult skeletal muscle mRNA. Comparison between the sequence of the PCR product and the corresponding genomic DNA confirmed that this RT-PCR fragment joins contigs 14 and 15 and identifies seven additional exons. Further, using this 1.3 kb PCR fragment as a hybridization probe, we detected 11 additional clones in the cDNA sublibrary. These cDNAs were not initially detected by hybridization of cosmid 59C10 to the arrayed cDNAs. Only 3 kb of contiguous sequence could be assembled from contigs 14, 15 and these cDNA clones, indicating that ~2.5 kb of the 5' region is unrepresented. Analysis using the deduced amino acids derived from the assembled sequence demonstrates 92% similarity and 85% identity with bovine clathrin heavy chain mRNA. The alignment over 871 amino acids is shown in Figure 3 C. Since human clathrin heavy chain has previously been assigned to 17q (17 ), we have referred to the transcript on 22q11.2 as clathrin heavy chain-like (CLTCL).

Contig 16 maps to the most telomeric end of the MDGCR (C-16 in Fig. 2 C). Several cDNAs from the contig were utilized as a hybridization probe against multiple tissue Northern blots and all failed to detect a transcript. However, a 146 bp PCR product was amplified from adult skeletal muscle mRNA with primers derived from this contig (D22S1574, Table 1 ). In order to determine whether the cDNA clones from contig 16 are derived from the CLTCL gene, RT-PCR was carried out using primers designed from end sequences of contigs 15 and 16. A 500 bp fragment was generated from adult skeletal muscle mRNA. However, sequence analysis of the ends of the PCR product showed only low identity (>50%) to the corresponding cDNAs (from contigs 15 and 16), indicating that the PCR product was not derived from the MDGCR. Thus, although the cDNAs from contig 16 map to the MDGCR, they are not derived from CLTCL. A data base search of the sequences from contig 16 revealed no significant homologies to any known genes or proteins. Additional data is needed to determine if the cDNAs from contig 16 represent a novel transcription unit.

Orientation of transcripts in the MDGCR

The differences in size and tissue distribution of the transcripts we have identified suggest that a minimum of 11 transcription units are encoded in the MDGCR. Several methods are available to identify the sense strand of a gene. These include: (i) searching for a poly(A) tail or polyadenylation signal in the cDNA sequence; (ii) analysis of consensus sequences at splice junctions; (iii) comparison of the new cDNAs to the orientation of known genes with which they share a high degree of homology; and (iv) isolation of 5'- or 3'- end sequence of a given cDNA clone using the RACE methods. We have used a combination of these methods in our analysis. Furthermore, all of these approaches were assisted by comparison of the cDNA sequence to the corresponding genomic sequence.

Prior to these experiments, two partial cDNAs from the MDGCR, Lan and N25-wa (CLTCL) had been completely sequenced. The sequence data from both cDNAs demonstrate a poly(A) tail and indicate that these genes are arranged from telomere to centromere. The poly(A) tail present in the sequence of DGS-A indicates its orientation is from centromere to telomere. The sequence of the remaining cDNAs failed to show either a polyadenylation signal or a poly(A) tail, necessitating additional analysis.

The consensus splice site (c/a)ag*gt(a/g)agt.......ncag*g(t/a) (18 ) found in the sequences of LAN, DGS-I, CTP and CLTCL indicates that the direction of transcription of these genes is from telomere to centromere. The partial sequences of DGS-B, -E, -F, -G and -H are devoid of introns, indicating that they could be intronless genes or 3' or 5' untranslated sequences. For these transcripts, 3' RACE was performed using primers derived from the cDNA contigs. The sequence of the 3' RACE fragments for DGS-G and -H showed a poly(A) signal and a poly(A) tail, indicating that the two genes are transcribed in opposite orientation as shown in Figure 1 E. In addition, 3' RACE fragments of DGS-D, -I and CTP were also generated, which confirmed the orientation which had been predicted by the presence of consensus splice sites.

CpG islands in the MDGCR

The identification of a minimum of 11 transcription units in the 250 kb MDGCR indicates that this region has a high density of genes with an average of one every 20-25 kb. CpG islands have been used as markers for genes because of their association with the 5' end of all housekeeping genes and an estimated 40% of transcripts which are tissue specific (19 ,20 ). Further, as might be expected, it has been noted that regions rich in genes have a high density of CpG islands (22 ). Results from restriction mapping of cosmids in the MDGCR using rare cutting restriction enzymes frequently found in CpG islands (BssHII, NotI and SacII) demonstrates that the MDGCR has an abundance of these sites. The mapping data show that there are a minimum of five NotI sites, 10 BssHII sites and >20 SacII sites. Three regions have five or more of these restriction sites within 1 kb, indicating potential CpG islands (shown as diamonds in Fig. 1 B). The most telomeric of these islands corresponds to the 5' region of CTP. Results of Northern analysis of CTP demonstrates that it is widely expressed. Further, several ESTs have been identified for CTP, consistent with a `housekeeping' function (Fig. 2 and Table 2 ). Transcripts have not yet been identified for the two more proximal CpG islands, making them attractive targets for further characterization. Given its abundant and widespread expression, it is somewhat surprising that restriction mapping failed to detect a CpG island in association with the LAN gene. GRAIL (12 ) analysis of this region predicts a CpG island in the 5' region of LAN. The greater sensitivity of GRAIL in this case was due to the fact that although the 5' region of LAN is CpG-rich it contains relatively few sites for rare cutting restriction enzymes.

Comparison between computational and experimental approaches

It is possible to compare the success of GRAIL (12 ) to cDNA selection in the identification of open reading frames (ORF). GRAIL2 analysis of 160 kb of genomic sequence from the MDGCR (accession nos L77569 and L77570) predicts 11 excellent ORFs in the `forward strand' (defined as the centromere -> telomere strand in the 5' -> 3' direction). Experimentally, we were able to confirm only one of these or ~10%. This apparent lack of consensus between the two approaches may be explained by a coding strand bias because on the reverse strand (i.e. telomere -> centromere) 43 `excellent' ORFs were predicted and we were able to verify 38 of these (88%). The best correspondence between GRAIL and our experimental data was for genes with multiple exons. In these instances, GRAIL correctly identified approximately 90% of the exons. In many cases, both the splice donor and splice acceptor sites were accurately identified and in the majority at least one of these was correct. For intronless genes and in areas where there are multiple small transcripts GRAIL was less successful. GRAIL 1a, which does not use splice donor and acceptor information in predicting ORFs, gave somewhat different results from GRAIL2, but it was no more accurate at predicting intronless genes in this region.

Lastly, BLASTN searches of GenBank dbEST demonstrated that six of the 11 transcription units identified ESTs. The number of ESTs for the six transcripts ranged from one to more than 45. Two of the six transcripts appear to be intronless (DGS-A and -G) and thus the ESTs did not provide any information with respect to intron/exon boundaries. Interestingly, the gene with the most ESTs, LAN, has a large 3' UTR (2.5 kb) and none of the ESTs extend past this region. DGS-I and CTP have much smaller 3' UTRs and approximately two thirds of the ESTs extend into coding regions, including several 5' exons.

DISCUSSION

In a positional cloning approach, identification of expressed sequences from a genomic region containing a disease locus is a major step toward isolation of the disease gene(s). The construction of a detailed transcription map is particularly important for DGS/VCFS because, at present, it is not known whether the major features of these complex syndromes are due to the loss of function of a single or multiple genes. Although the majority of patients have large deletions of 22q11.2, a small number of patients have the phenotypic features of DGS/VCFS but have no detectable deletion. It has not been possible to demonstrate linkage to 22q11.2 or any other chromosomal region for these non-deleted patients because the cases are usually sporadic or from small nuclear families. There is one DGS patient, ADU, who has a balanced (2;22)(q14.1;q11.2) translocation (11 ) which suggests that a single disrupted gene may be responsible for the phenotype. We have reported the cloning of this translocation breakpoint and the identification of transcripts in the surrounding region (9 ). However, at this time we have been unable to detect mutations in any of these putative transcripts in non-deleted DGS/VCFS patients, leaving open the possibility that the ADU translocation may have a positional effect on genes proximal or distal to the breakpoint.

The DGCR, the region of 22q11 deleted in the majority of patients with DGS or VCFS, is greater than 1.5 Mb. Using a limited number of patients with smaller deletions, it has been possible to narrow the region critical to the phenotype to the proximal 250 kb of the DGCR, the MDGCR (10 ). We have established a detailed transcription map covering the MDGCR. Although several genes have been previously described which map within the larger (>1.5 Mb), commonly deleted region associated with DGS/VCFS, including TUPLE1, COMT and ZNF74 (for review see 9 ), only three previously reported genes have been mapped to the region we define as the MDGCR.

The first transcript to be described was N25-wa, which was isolated by screening a cDNA library with NotI linking clone N25 (16 ). This corresponds to CLTCL (DGS-K) which demonstrates high homology to clathrin heavy chain (Fig. 3 C). Clathrin heavy chain is one of the major structural components of coated pits and coated vesicles, and is ubiquitously expressed. The coated pits/vesicles are involved in intracellular vesicular transport and in uptake of membrane-bound ligands and extracellular fluid. The primary structure of clathrin heavy chain is highly conserved with significant identity of amino acids among rat, bovine and human clathrin (23 ). In 1991 Dodge et al. reported the isolation and mapping of a partial cDNA for the human clathrin heavy chain to 17q11-qter (17 ). Thus, the transcript we have identified in the MDGCR appears to represent a second distinct locus. The expression of CLTCL is limited to adult skeletal muscle and it demonstrates lower homology to other mammalian clathrin heavy chains, supporting the hypothesis that CLTCL represents a different but related gene. The role of the coated pits in receptor-mediated endocytosis suggests a possible mechanism for involvement of CLTCL in DGS/VCFS by perturbation of receptor signaling during neural crest cell migration. Further, it has been reported that Drosophila embryos, homozygous or hemizygous for clathrin heavy chain mutations, fail to hatch at the first larval stage (24 ). Nonetheless, it is somewhat puzzling that in contrast to this apparent second locus in humans, there appears to be only a single locus for clathrin heavy chain in other species, such as rat, Drosophila and yeast (23 -25 ). Further, as yet, we have been unable to detect a homolog for CLTCL in the mouse (Galili et al., unpublished). This will make it more difficult to assess the function of the CLTCL gene in humans and its role in DGS/VCFS.

The second gene to be isolated and mapped to the MDGCR is the DGCR2/IDD/LAN gene (9 ,14 ,15 ). The 3' end of this gene is approximately 10 kb telomeric to the ADU breakpoint. From the deduced amino acid sequence the LAN protein is predicted to be an integral membrane protein. The N-terminus contains Cys-rich repeats and has similarity to the low-density lipoprotein receptor and other proteins containing this motif, including basement membrane proteins such as perlecans. LAN is widely expressed in adult and fetal tissues (Fig. 2 , refs 9 ,14 ,15 ). Because the LAN gene product could be involved in cell-cell or cell matrix interactions via ligand binding, and thus potentially play a role in neural crest cell migration, it can be considered an attractive candidate for DGS/VCFS. However, to date, mutations in this gene have not been identified in non-deleted DGS/VCFS patients. Lastly, we reported a partial cDNA (ac2b1) corresponding to DGS-B which appears to recognize the same sized transcript on Northern blot analysis as two GRAIL predicted exons in its vicinity, nex2.2 and nex3 (9 ). Since DGS-B does not have any homology to known genes, its potential as a DGS/VCFS candidate gene is based on its close proximity to the ADU breakpoint region.

Of the remaining eight transcription units in this report, only two, CTP (DGS-J) and DGS-G, demonstrated a high level of similarity to known genes. CTP had 98% similarity (Fig. 3 B) to a rat mitochondrial tricarboxylate transporter also referred to as citrate transport protein. CTP is a mitochondrial inner membrane protein predicted to have six hydrophobic membrane-spanning [alpha]-helices with five connecting hydrophilic segments (26 ). Its function is to exchange a tricarboxylate along with a proton for another tricarboxylate/H+, or a dicarboxylate, or phosphoenol- pyruvate across the inner mitochondrial membrane. This electroneutral exchange supplies NAD+ and NADPH for glycolysis and lipid biosynthesis, as well as a carbon source for the triacylglycerol and sterol biosynthetic pathways. Although no direct genetic studies are available, rats experimentally made insulopenic showed a decreased level of CTP activity, indicating that CTP levels are regulated in part by insulin (27 -29 ). Reduced levels of CTP due to haploinsufficiency may play a modifying role in DGS/VCFS by affecting glucose metabolism. Further, epidemiological studies have shown that infants of diabetic mothers are at an increased risk for conotruncal heart defects (30 ), suggesting that perturbations of glucose metabolism affect this developmental field.

The last transcription unit to demonstrate significant homology to any known gene is DGS-G which shows 94% similarity to a mouse serine/threonine kinase, TSK-1 (Fig. 3 A). Similar to DGS-G, TSK-1 is a 1.6 kb transcript expressed exclusively in the testis (31 ). Unfortunately, neither the function of TSK-1 in the testis nor the expression pattern in the mouse embryo are known (31 ). Comparison of the kinase domain of DGS-G to other kinases indicates that DGS-G has all 14 of the most highly conserved amino acids and has the consensus in subdomains VI and VIII predicted for Ser/Thr kinases (Fig. 3 A; 32 ). Based on sequence homology of the catalytic domain, DGS-G belongs to the SNF1 subfamily of Ser/Thr kinases. Three other members of this family are 5'-AMP-activated protein kinase, par-1 and msk. These kinases are involved in lipid metabolism (33 ,34 ), in establishing polarity in early C. elegans embryos (35 ) and in early expression in the myocardial cells of the developing mouse heart (36 ), respectively. Although, in the embryo, msk has very restricted expression in the developing heart, it is abundantly, though not exclusively, expressed in adult testis (36 ). Thus, the expression of DGS-G in adult testis does not preclude its playing a role in embryonic development. Further examples include, Hoxa-4 and int-1 which are expressed in the central nervous system of developing embryos, but demonstrate adult expression exclusively in testis (37 -39 ). Given the central role of protein kinases in coordinating the eukaryotic cell's response to external and internal signals, DGS-G is an appealing candidate for DGS/VCFS.

The remaining six transcription units do not show significant homology to genes with known function and therefore cannot be assessed for likely involvement in DGS/VCFS based on their predicted role. Northern blot analysis demonstrated that one of the transcripts (CLTCL) was expressed exclusively in skeletal muscle, four transcripts were more highly expressed in this tissue, and one was expressed only in skeletal muscle and heart. Further, all genes except for DGS-G and CLTCL seem to be abundant in the heart by Northern analysis. This tissue-specific expression pattern in heart and skeletal muscle may be an indication that these genes are important in cardiac development.

In summary, the 11 transcription units described in this manuscript are all candidates for the abnormalities associated with DGS/VCFS because they fall within the MDGCR and are deleted in the majority of patients with DGS/VCFS. Additional studies of the small number of non-deleted DGS/VCFS patients, aimed at the identification of small rearrangements or point mutations in these genes, are underway. These studies will be necessary to determine how these genes contribute to the various phenotypic abnormalities associated with these disorders.

MATERIALS AND METHODS

Cosmid contig construction

The probe N25 (D22S75) was used to initiate the cosmid contig in the MDGCR. The chromosome 22 specific library, LL22N03, constructed at the Biomedical Sciences Division, Lawrence Livermore National Laboratory was the source of all cosmids represented in this contig. High density filters were prepared from the arrayed cosmid library and screened by colony hybridization. Primary positive clones were verified by Southern blot analysis of HindIII digested cosmid DNA. Cosmids positive by Southern blot analysis were further analyzed by using single and double restriction digestion with BssHII, MluI, NotI, NruI, SacII, SalI and SfiI, followed by pulsed-field gel electrophoresis. A restriction map was constructed after each cosmid walk and a terminal fragment, suitable for further walking was identified. The cosmid library is estimated to be approximately 7 * coverage of chromosome 22 and on average we identified seven cosmids per walk. A total of nine cosmid walks were performed. Based on the hybridization and restriction mapping data, a 250 kb cosmid contig encompassing D22S75 and the ADU breakpoint was constructed. The cosmids shown in Figure 1 C represent the minimal tiling path used for cDNA selection.

cDNA selection

cDNA selection (40 ,41 ) was performed using a modified protocol (42 ). cDNAs were synthesized from poly(A) mRNA prepared from fetal brain (FB), fetal liver (FL) and adult skeletal muscle (ASM) (Clontech). Reverse transcription was performed separately for each tissue using 2.5 [mu]g of mRNA, 150 ng of random hexamers (GIBCO BRL) and 500 U reverse transcriptase (GIBCO BRL) in a 50 [mu]l reaction. cDNA from each source was tagged using linkers which could be distinguished because they differed at the last 5-6 bp. The sequence of the primers is as follows:

FB:5'-CTCTAGAACTAGTGGATCCATACG-3' FL:5'-CTCTAGAACTAGTGGATCACTGG-3' ASM:5'-CTCTAGAACTAGTGGATCTACCTG-3'

These `tissue specific' linkers were ligated to the blunt-ended cDNAs. Each ligation reaction was passed through a Chroma spin-1000 (Clontech) to remove small cDNA molecules (<420 bp) from the samples and then dissolved in 50 [mu]l H20. Five [mu]l from each of the cDNA samples was PCR amplified separately using the primers specific for each source in a 100 [mu]l reaction containing 10 mM Tris-HCl, pH 8.3, 2.5 mM MgCl2, 50 mM KCl, 0.25 mM each of dNTPs, 0.5 mM primer and 2.5 U Taq polymerase. The PCR reaction was performed with a 2 min step denaturation at 94oC and then subjected to 30 cycles of denaturation (45 s at 94oC), annealing (45 s at 65oC) and extension (5 min at 72oC), and final extension was 7 min at 72oC using a 9600 thermal cycler (Perkin-Elmer).

Purified DNA (100 ng each) from seven cosmids covering the MDGCR was pooled and biotinylated using a nick translation kit (BRL). The human repeats present in genomic DNA were suppressed by prehybridization with human Cot-1 DNA (500 [mu]g/[mu]l) and total human placental DNA (500 [mu]g/[mu]l) for 1-3 h, and then hybridized to the amplified cDNAs in solution. The cosmid/cDNA complexes were captured on streptavidin-coated magnetic beads (Dynal), which were pretreated with 10 [mu]g of human Cot-1 DNA (BRL) for 1 h at room temperature. The specific cDNAs were separated from the beads by heating for 10 min at 75oC and PCR amplified. After a second round of selection, the eluted cDNAs were PCR amplified with the primers described above with the addition of a 12-nucleotide (CUA)4 sequence to the 5'-end. The PCR products were treated with uracil DNA glycosylase, cloned into vector pAMP 10 (BRL) and transformed into DH5[alpha] cells. Single colonies were plated on LB agar and then picked into wells of 96 well microtiter dishes. Gridded arrays on nylon membranes (Hybond+, Amersham) were prepared using a biomek 1000 robot (Beckman).

To assess the specificity of the cDNA sublibrary, two previously isolated cDNA clones and one RT-PCR product which we had previously mapped in the MDGCR were used as positive controls. These probes identified ten percent of the cDNA sublibrary (57/567 clones), indicating that the library was greatly enriched for cDNAs originating from the MDGCR. To avoid analysis of cDNAs selected by cross-hybridization to non-specific sequences, the sublibrary filters were hybridized to Alu (Blur 8) and pAMP10 probes. Of the 567 cDNAs, 34 cDNA clones gave strong hybridizing signals to the Alu probe, suggesting they contain sequences homologous to this highly repetitive element. Five of the Alu-containing clones mapped back to the MDGCR. Three of these are derived from the 3' untranslated region of LAN and the other two appear to be hnRNA from the LAN gene. Hybridization with the pAMP10 vector identified an additional 23 clones with a strong signal after a short exposure time. After PCR-amplification and restriction analysis with SpeI, these clones were found to have small or no inserts and they were excluded from further analysis. An additional 36 clones were eliminated from further characterization because they either contained multiple inserts or gave weak signals to all hybridization probes used, suggesting that these clones did not grow well.

To estimate the enrichment achieved by our cDNA selection, we compared the abundance of the partial cDNA N25-wa in the sublibrary to results from screening a conventional cDNA library. Seventeen skeletal muscle derived cDNAs were identified from the cDNA sublibrary. In contrast, only three positive clones were identified when N25-wa was used to probe a skeletal muscle cDNA library consisting of 106 recombinant clones. This indicates that the cDNAs in the sublibrary were enriched by a factor of 104.

Southern and Northern hybridization

Probes including cosmid inserts, cDNAs and PCR products were labeled with [alpha]-32P dCTP by using the random priming method (43 ). Human repetitive sequences were blocked by prehybridization with sheared human placental DNA (250 mg/ml) and human Cot-1 DNA (125 mg/ml). The prehybridization was carried out in 0.5 M Na2P04, pH 7.3, 7% SDS, 1 mM EDTA, pH 8 at 65oC for 3-4 h and hybridization was performed under the same conditions for 16-24 h. The filters were washed twice with 0.2* SSC, 0.1% SDS at 65oC for 15-25 min after Southern hybridization or twice with 0.1* SSC, 0.1% SDS at 65oC for 15-25 min after Northern hybridization. They were then exposed to Kodak X-OMAT film for several hours to several days at -70oC with an intensifying screen.

RT-PCR

cDNA was synthesized in a 50 [mu]l reaction using 100 ng of poly(A) RNA extracted from various tissues. The RNA was heated with random and oligo(dT) primers for 5 min at 65oC and cooled to room temperature for 10 min. Reverse transcription was performed at 37oC for 1 h after adding 5 [mu]l 10 * RT buffer (Stratagene), 20 U RNase inhibitor (Stratagene), 2 [mu]l of 0.1 M dNTPs and 50 U MMLV reverse transcriptase. The cDNA mixture was then heated for 5 min at 90oC. For PCR amplification, 2 [mu]l of cDNA was used per 50 [mu]l reaction.

STS generation

Primer pairs for PCR were generated for the cDNA contigs (Fig. 1 B and Table 1 ). Sequence data from an ABI automated sequencer was analyzed (Staden package; 21 ) and STSs were chosen using PRIMER version 0.5 (M.J. Daly, S. Lincoln and E.S. Lander, Whitehead Institute, Cambridge, MA, 1991). Using the following conditions, a unique PCR fragment was obtained for each primer pair. PCR was performed in 20 [mu]l reactions using approximately 50 ng genomic DNA or 5 ng cDNA synthesized from poly(A) RNA in 1 * PCR buffer: 10 mM Tris-HCl, pH 8.3, 1.0-1.5 mM MgCl2, 50 mM KCl, 1 [mu]M primers (final concentration) and 0.5 U Taq polymerase (Perkin Elmer Cetus or Boehringer-Mannheim). PCR conditions were: a 5 min denaturation step at 95oC followed by 30 cycles of denaturation at 95oC for 15 s, annealing at a temperature determined for each STS for 15 s, and extension at 72oC for 1 min 22 s, and lastly a 7 min extension at 72oC. Primer sequences are summarized in Table 1 .

Consistent with GDB nomenclature, we have called these PCR products sequence tagged sites (STSs) rather than expressed sequence tags (ESTs). In general, the term EST has been used to refer to partial sequence obtained from randomly isolated cDNAs. In contrast, the cDNA sequences which were used for STS generation in this study have been precisely mapped, amplify the same size fragment in cDNA as genomic DNA, and have been completely sequenced. These STSs were used in the construction of the cDNA contigs and serve as landmarks for the transcripts.

RACE-PCR

Marathon-ReadyTM human fetal and skeletal muscle cDNAs (Clontech) were used in PCR using an anchor primer provided by the manufacturer and a gene-specific primer. PCR was performed in 50 [mu]l reactions using 1* PCR buffer (Clontech): 40 mM Tricine-KOH, 15 mM KOAc, 3.5 mM Mg(OAc)2, 75 mg/ml bovine serum albumin and 0.25 U KlenTaq-1 DNA polymerase (Clontech). PCR conditions were: a 1 min denaturation step at 94oC followed by 30 cycles of [denaturation at 94oC for 30 s, annealing and extension at 68oC for 3 min] and lastly a 3 min extension at 68oC. The majority of PCR reactions were performed on Perkin Elmer 9600 thermal cyclers. PCR products were analyzed by gel electrophoresis using 1.5% agarose.

DNA sequencing

Double-stranded plasmid DNA was prepared and purified using the Wizard Mini Preps DNA Purification System (Promega) and sequenced from both ends on an ABI 370A sequencer using the universal forward and reverse M13 fluorescent primers. PCR products were purified using the SpinBind DNA purification kit from agarose(FMC) and directly sequenced using the primers specific for PCR amplification.

ACKNOWLEDGMENTS

The authors wish to thank Dr Elizabeth Goldmuntz for providing probes, Dr Vahe Bedian at the University of Pennsylvania Sequencing Facility for the sequencing of PCR products and cDNAs and Drs Charles Bailey and Susan Holmes for critical reading of the manuscript. We would also like to acknowledge the invaluable assistance of Charles Bailey in the computational analysis. The chromosome-specific cosmid library LL22NC03 used in this study was constructed at the Biomedical Sciences Division, Lawrence Livermore National Laboratory, Livermore, CA 94550 under the auspices of the National Laboratory Gene Library Project sponsored by the U.S. Department of Energy. The authors would especially like to thank Dr Pieter de Jong and Jeffrey Garnes for providing this cosmid library. These studies were supported in part by CA39926 (B.S.E.), HG00425 (B.S.E., M.L.B), HL51533 (M.L.B, B.R., B.S.E.), DC02027 (M.L.B, B.S.E., B.R.) and HG00313 (B.R.) from the National Institutes of Health.

REFERENCES

1 Kirby, M.L. and Bockman, D.E. (1984) Neural crest and normal development: A new perspective. Anat. Rec. 209, 1-6. MEDLINE Abstract

2 Lammer, E.J. and Opitz, J.M. (1986) The DiGeorge anomaly as a developmental field defect. Am. J. Med. Genet. 29, 113-127.

3 Greenberg, F., Elder, F., Haffner, P., Northup, H., and Ledbetter, D. (1988) Cytogenetic findings in a prospective series of patients with DiGeorge anomaly. Am. J. Hum. Genet. 43, 605-611. MEDLINE Abstract

4 Driscoll, D.A., Budarf, M.L. and Emanuel, B.S. (1992a) A genetic etiology for DiGeorge syndrome: consistent deletions and microdeletions of 22q11. Am. J. Hum. Genet. 50, 924-933. MEDLINE Abstract

5 Carey A.H., Kelly, D., Halford, S., Wadey, R., Wilson, D., Goodship. J., Burn, J., Paul, T., Sharkey, A., Dumanki, J. et al. (1992) Molecular genetic study of the frequency of monosome 22q11 in DiGeorge syndrome. Am. J. Hum. Genet. 51, 964-970. MEDLINE Abstract

6 Driscoll, D.A., Salvin, J., Sellinger, B., Budarf, M.L., McDonald-McGinn, D.M., Zackai, E.H., Emanuel, B.S. (1993) Prevalence of 22q11 microdeletions in DiGeorge and velocardiofacial syndromes: implications for genetic counseling and prenatal diagnosis. J. Med. Genet., 30, 813-817. MEDLINE Abstract

7 Stevens C.A., Carey J.C., Shigeoka A.O. (1990) DiGeorge anomaly and Velo-Cardio-Facial syndrome. Pediatrics 85, 526-30. MEDLINE Abstract

8 Driscoll, D.A., Spinner, N.B., Budarf, M.L., McDonald-McGinn, D.M., Zackai, E.H., Goldberg, R.B., Shprintzen, R.J., Saal, H.M., Zonana, J., Jones, M.C., Mascarello, J.T., Emanuel, B.S.(1992b) Deletions and microdeletions of 22q11.2 in velo-cardio-facial syndrome. Am. J. Med. Genet. 44, 261-268. MEDLINE Abstract

9 Budarf, M.L., Collins, J., Gong, W., Roe, B., Wang, Z., Sellinger, B.,Michaud, D., Driscoll, D. and Emanuel, B.S. (1995) Cloning a balanced translocation associated with DiGeorge syndrome and identification of a disrupted candidate gene. Nature Genet. 10, 269-288. MEDLINE Abstract

10 Li, M., Budarf, M.L., Sellinger, B., Jaquez, M., Matalon, R., Ball, S., Pagon, R.A., Rosengren, S.S., Emanuel, B.S., Driscoll, D.A. (1994) Narrowing the DiGeorge region (DGCR) using DGS-VCFS associated translocation breakpoints. Am. J. Hum. Genet. 55, A10.

11 Augusseau, S., Jouk, S., Jalbert, P. and Prieur, M. (1986) DiGeorge syndrome and 22q11 rearrangements. Hum. Genet. 74, 206. MEDLINE Abstract

12 Uberbacher, E.C. and Mural, R.L. (1991) Locating protein-coding regions in human DNA sequences by a multiple sensor-neural network approach. Proc. Natl Acad. Sci. USA 88, 11261-11265. MEDLINE Abstract

13 Altshul, S.F., Gish, W., Miller, W., Myer, E.W. and Lipman, D.J. (1990) Basic local alignment search tool. J. Mol. Biol. 215, 403-410.

14 Demczuk, S., Aledo, R.; Zucman. J., Delattre, O., Desmaze, C., Dauphinot, L., Jalbert, P., Rouleau, G.A., Thomas, G. and Aurias, A. (1995) Cloning of a balanced translocation breakpoint in the DiGeorge syndrome critical region and isolation of a novel potential adhesion receptor gene in its vicinity. Hum. Mol. Genet., 4, 551-558. MEDLINE Abstract

15 Wadey, R., Daw, S., Taylor, C., Atif, U., Kamath, S., Halford, S., O'Donnell, H., Wilson, D., Goodship, J., Burn, J. and Scambler, P. (1995) Isolation of a gene encoding an integral membrane protein from the vicinity of a balanced translocation breakpoint associated with DiGeorge syndrome. Hum. Mol. Genet. 4, 1027-1033. MEDLINE Abstract

16 Emanuel, B.S., Driscoll, D., Goldmuntz, E., Baldwin, S., Biegel, J., Zackai, E.H., McDonald-McGinn, D., Sellinger, B., Gorman, N., Williams, S., and Budarf, M.L. (1993) Molecular and phenotypic analysis of the chromosome 22 microdeletion syndromes. In: Phenotypic Mapping of Down Syndrome and Other Aneuploid Conditions, ed. Epstein, C.J., Wiley Liss, NY, 207-224.

17 Dodge, G.R., Kovalszky, I., McBride, O.W., Yi, H.F., Chu, M-L., Saitta, B., Stokes, D.G., and Iozzo, R.V. (1991) Human clathrin heavy chain (CLTC): partial molecular cloning, expression, and mapping of the gene to human chromosome 17q11-qter. Genomics 11, 174-178. MEDLINE Abstract

18 Padgett, R.A., Grabowski, P.J., Konarska, M.M., Seiler, S. and Sharp, P.A. (1986) Splicing of messenger RNA precursors. Annu. Rev. Biochem. 55, 1119-1150. MEDLINE Abstract

19 Bird, A.P. (1987) CpG islands as gene markers in the vertebrate nucleus. Trends Genet. 3, 324-347.

20 Larsen, F., Gundersen, G., Lopez, R., and Prydz, H. (1992) CpG islands as gene markers in the human genome. Genomics 13, 1095-1107. MEDLINE Abstract

21 Dear. S., Staden, R.(1991) A sequence assembly and editing programe for efficient management of large projects. Nucleic Acids Res. 19, 3907-3911. MEDLINE Abstract

22 Craig,J .M. and Bickmore,W.A. (1994) The distribution ofCpG islands in mammalian chromosomes. Nature Genet. 7, 376-382. MEDLINE Abstract

23 Kirchhausen, T., Harrison, S.C., Chow, E.P., Mattaliano, R.J., Ramachandran, K.L., Smart, J. and Brosius, J. (1987) Clathrin heavy chain: molecular cloning and complete primary structure. Proc. Natl Acad. Sci. USA 84, 8805-8809. MEDLINE Abstract

24 Bazinet, C., Katzen, A.L., Morgan, M., Mahowald, A.P., Lemmon, S.K. (1993) The Drosophila clathrin heavy chain gene: clathrin function is essential in a multicellular organism. Genetics 134, 1119-1134. MEDLINE Abstract

25 Payne, G.S. and Schekman, R. (1985) A test of clathrin function in protein secretion and cell growth. Science 230, 1009-1014. MEDLINE Abstract

26 Kaplan, R.S., Mayor, J.A. and Wood, D.O. (1993a) The mitochondrial tricaboxylate transport protein. J. Biol. Chem. 268, 13682-13690. MEDLINE Abstract

27 Kaplan, R.S., Oliveira, D.L. and Wilson, G.L. (1990) Streptozotocin-induced alterations in the levels of functional mitochondrial anion transport proteins. Arch. Biochem. Biophys. 280, 181-191. MEDLINE Abstract

28 Kaplan, R.S., Mayor, J.A., Blackwell, R., Maughon, R.H. and Wilson, G.L. (1991) The effect of insulin supplementation on diabetes-induced alterations in the extractable levels of functional mitochondrial anion transport proteins. Arch. Biochem. Biophys. 287, 305-311. MEDLINE Abstract

29 Kaplan, R.S., Mayor, J.A., Blackwell, R., Wilson, G.L. and Schaffer, S.W. (1991) Functional levels of mitochondrial anion transport proteins in non-insulin-dependent diabetes mellitus. Mol. Cell Biol. 107, 79-86.

30 Ferencz, C. (1990) A case-control study of cardiovascular malformation in liveborn infants: the morphogenetic relevance of epidemiologic findings. In: Development Cardiology: Morphogenesis and Function (Clark EB and Takao A, eds.) Futura Publishing Company, Inc., Mount Kisco, NY pp. 523-539.

31 Bielke, W., Blaschke, R.J., Miescher, G.C., Zurcher, G., Andres, A.-C., and Ziemiecki, A. (1994) Characterization of a novel murine tests-specific serine/threonine kinase. Gene 139, 235-239. MEDLINE Abstract

32 Hanks, S.K., Quinn, A.M., and Hunter, T. (1988) The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 241, 42-51. MEDLINE Abstract

33 Stapleton, D., Gao, G., Michell, B.J., Widmer, J., Mitchelhill, K., Teh, T., House, C.M., Witters, L.A. and Kemp, B.E. (1994) Mammalian 5'-AMP-activated protein kinase non-catalytic subunits are homologs of proteins that interact with yeast Snf1 protein kinase. J. Biol. Chem. 269, 29343-29346. MEDLINE Abstract

34 Woods, A., Munday, M.R., Scott, J., Yang, X., Carlson, M. and Carling, D. (1994) Yeast SNF1 is functionally related to mammalian AMP-activated protein kinase and regulates acetyl-CoA carboxylase in vivo. J. Biol. Chem. 269, 19509-19515. MEDLINE Abstract

35 Guo, S. and Kemphues, K.J. (1995) par-1, a gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed. Cell 81, 611-620. MEDLINE Abstract

36 Ruiz, J.C., Conlon, F.L., Robertson, E.J. (1994) Identification of novel protein kinases expressed in the myocardium of the developing mouse heart. Mechan. Develop. 48, 153-164. MEDLINE Abstract

37 Rubin, M.R., Toth, L.E., Patel, M.D., D'Eustachio, P. and Nguyen-Huu, M.C. (1986) A mouse homeo box gene is expressed in spermatocytes and embryos. Science 233, 663-667. MEDLINE Abstract

38 Wolgemuth, D.J., Viviano, C.M., Gizang-Ginsberg, E., Frohman, M.A., Joyner, A.L. and Martin, G.R. (1987) Differential expression of the mouse homeobox-containing gene Hox-1.4 during male germ cell differentiation and embryonic development. Proc. Natl Acad. Sci. USA 84, 5813-5817. MEDLINE Abstract

39 Shackleford, G.M. and Varmus, H.E. (1987) Expression of the proto-oncogene int-1 is restricted to postmeiotic male germ cells and the neural tube of mid-gestational embryos. Cell 50, 89-95. MEDLINE Abstract

40 Lovett, M., Kere, J. and Hinton, D. (1991) Direct selection: A method for the isolation of cDNAs encoded by large genomic regions. Proc. Natl Acad. Sci. USA 88, 9628-9632. MEDLINE Abstract

41 Parimoo, S., Patanjali, S.R., Shukla, H., Chaplin, D.D. and Weissman, S.M. (1991) cDNA selection: Efficient PCR approach for the selection of cDNAs encoded in large chromosomal DNA fragments. Proc. Natl Acad. Sci. USA, 88, 9623-9627. MEDLINE Abstract

42 Korn, B., Sedlacek, Z., Manca, A., Kioschis, P., Lehrach, H. and Poustka A. (1992) A strategy for the selection of transcribed sequences in the Xq28 region. Hum. Mol. Genet. 1, 235-242. MEDLINE Abstract

43 Feinberg, A.P. and Vogelstein, B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem, 132, 6-13. MEDLINE Abstract


*To whom correspondence should be addressed


This page is maintained by OUP admin. Last updated Thu Oct 31 15:24:35 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Cell Sci.Home page
F. E. Hood and S. J. Royle
Functional equivalence of the clathrin heavy chains CHC17 and CHC22 in endocytosis and mitosis
J. Cell Sci., July 1, 2009; 122(13): 2185 - 2190.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. E. Wakeham, L. Abi-Rached, M. C. Towler, J. D. Wilbur, P. Parham, and F. M. Brodsky
Clathrin heavy and light chain isoforms originated by independent mechanisms of gene duplication during chordate evolution
PNAS, May 17, 2005; 102(20): 7209 - 7214.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
Z. Hao, K. N. Jha, Y.-H. Kim, S. Vemuganti, V.A. Westbrook, O. Chertihin, K. Markgraf, C. J. Flickinger, M. Coppola, J. C. Herr, et al.
Expression analysis of the human testis-specific serine/threonine kinase (TSSK) homologues. A TSSK member is present in the equatorial segment of human sperm
Mol. Hum. Reprod., June 1, 2004; 10(6): 433 - 444.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. M. Maynard, G. T. Haskell, A. Z. Peters, L. Sikich, J. A. Lieberman, and A.-S. LaMantia
A comprehensive analysis of 22q11 gene expression in the developing and adult brain
PNAS, November 25, 2003; 100(24): 14433 - 14438.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
P. Kapranov, S. E. Cawley, J. Drenkow, S. Bekiranov, R. L. Strausberg, S. P. A. Fodor, and T. R. Gingeras
Large-Scale Transcriptional Activity in Chromosomes 21 and 22
Science, May 3, 2002; 296(5569): 916 - 919.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
T. H. Shaikh, H. Kurahashi, S. C. Saitta, A. M. O'Hare, P. Hu, B. A. Roe, D. A. Driscoll, D. M. McDonald-McGinn, E. H. Zackai, M. L. Budarf, et al.
Chromosome 22-specific low copy repeats and the 22q11.2 deletion syndrome: genomic organization and deletion endpoint analysis
Hum. Mol. Genet., March 1, 2000; 9(4): 489 - 501.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
H. Yamagishi, V. Garg, R. Matsuoka, T. Thomas, and D. Srivastava
A Molecular Pathway Revealing a Genetic Basis for Human Cardiac and Craniofacial Defects
Science, February 19, 1999; 283(5405): 1158 - 1161.
[Abstract] [Full Text]


Home page
Circ. Res.Home page
M. J. Farrell, H. Stadt, K. T. Wallis, P. Scambler, R. L. Hixon, R. Wolfe, L. Leatherbury, and M. L. Kirby
HIRA, a DiGeorge Syndrome Candidate Gene, Is Required for Cardiac Outflow Tract Septation
Circ. Res., February 5, 1999; 84(2): 127 - 135.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H.S. Baldwin and M. Artman
Recent advances in cardiovascular development: promise for the future
Cardiovasc Res, December 1, 1998; 40(3): 456 - 468.
[Full Text] [PDF]


Home page
Genome ResHome page
J. M. McKie, R. B. Wadey, H. F. Sutherland, C. L. Taylor, and P. J. Scambler
Direct Selection of Conserved cDNAs from the DiGeorge Critical Region: Isolation of a Novel CDC45-Like Gene
Genome Res., August 1, 1998; 8(8): 834 - 841.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
P. Saha, K. C. Thome, R. Yamaguchi, Z.-h. Hou, S. Weremowicz, and A. Dutta
The Human Homolog of Saccharomyces cerevisiae CDC45
J. Biol. Chem., July 17, 1998; 273(29): 18205 - 18209.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
L. C. Bailey Jr., D. B. Searls, and G. C. Overton
Analysis of EST-Driven Gene Annotation in Human Genomic Sequence
Genome Res., April 1, 1998; 8(4): 362 - 376.
[Abstract] [Full Text]


Home page
Genome ResHome page
L. C. Bailey Jr., S. Fischer, J. Schug, J. Crabtree, M. Gibson, and G. C. Overton
GAIA: Framework Annotation of Genomic Sequence
Genome Res., March 1, 1998; 8(3): 234 - 250.
[Abstract] [Full Text]


Home page
DevelopmentHome page
T Thomas, H Kurihara, H Yamagishi, Y Kurihara, Y Yazaki, E. Olson, and D Srivastava
A signaling cascade involving endothelin-1, dHAND and msx1 regulates development of neural-crest-derived branchial arch mesenchyme
Development, January 8, 1998; 125(16): 3005 - 3014.
[Abstract] [PDF]


Home page
JCBHome page
P. Kueng, Z. Nikolova, V. Djonov, A. Hemphill, V. Rohrbach, D. Boehlen, G. Zuercher, A.-C. Andres, and A. Ziemiecki
A Novel Family of Serine/Threonine Kinases Participating in Spermiogenesis
J. Cell Biol., December 29, 1997; 139(7): 1851 - 1859.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
J. M. Puck
Primary Immunodeficiency Diseases
JAMA, December 10, 1997; 278(22): 1835 - 1841.
[Abstract] [PDF]


Home page
JCBHome page
M. H. Butler, C. David, G.-C. Ochoa, Z. Freyberg, L. Daniell, D. Grabs, O. Cremona, and P. D. Camilli
Amphiphysin II (SH3P9; BIN1), a Member of the Amphiphysin/Rvs Family, Is Concentrated in the Cortical Cytomatrix of Axon Initial Segments and Nodes of Ranvier in Brain and around T Tubules in Skeletal Muscle
J. Cell Biol., June 16, 1997; 137(6): 1355 - 1367.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
E. Goldmuntz and B. S. Emanuel
Genetic Disorders of Cardiac Morphogenesis : The DiGeorge and Velocardiofacial Syndromes
Circ. Res., April 19, 1997; 80(4): 437 - 443.
[Full Text]


Home page
Genome ResHome page
N Galili, H S Baldwin, J Lund, R Reeves, W Gong, Z Wang, B A Roe, B S Emanuel, S Nayak, C Mickanin, et al.
A region of mouse chromosome 16 is syntenic to the DiGeorge, velocardiofacial syndrome minimal critical region.
Genome Res., January 1, 1997; 7(1): 17 - 26.
[Abstract] [PDF]


Home page
Genome ResHome page
M Ohira, N Seki, T Nagase, E Suzuki, N Nomura, O Ohara, M Hattori, Y Sakaki, T Eki, Y Murakami, et al.
Gene identification in 1.6-Mb region of the Down syndrome region on chromosome 21.
Genome Res., January 1, 1997; 7(1): 47 - 58.
[Abstract] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
M. Karayiorgou, J.A. Gogos, B.L. Galke, J.A. Jeffery, G. Nestadt, P.S. Wolyniec, S.E. Antonarakis, H.H. Kazazian, D.E. Housman, D.A. Driscoll, et al.
Genotype and Phenotype Analysis at the 22q11 Schizophrenia Susceptibility Locus
Cold Spring Harb Symp Quant Biol, January 1, 1996; 61(0): 835 - 843.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (87)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Gong, W.
Right arrow Articles by Budarf, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gong, W.
Right arrow Articles by Budarf, M. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?