Human Molecular Genetics

Figure 2. SP-PCR of sperm DNA from individual C1 (55 repeats). Expansions can be seen in lanes 1, 10, 17 and 19 and contractions in lanes 7, 11, 15 and 18.

We analyzed, by SP-PCR, the variation in FMR1 (CGG)_n repeat length in sperm and leukocytes from two normal males, one with a 29 repeat allele and the other with a 55 repeat allele. We observed variations by expansion or contraction mostly in the upper normal range (55 repeats), and rarely in the average normal range (29 repeats). As previously observed (14 -18 ), we presume that the length variation occurred in the 3' most (CGG)_n block in C1. This indicates that germline instability of CGG repeats in the intermediate range depends on the size of the repeat, more particularly on the pure CGG tract length. Due to the fact that short contractions and expansions cannot be distinguished from PCR artifact products, the rates of expansion and contraction reported here are underestimated and more reliable for large variations.

Our data show that, for C1, contraction rates are significantly greater than expansion rates in germline (19*10^-4 versus 7*10^-4; P<10^-2) and in somatic tissues (8*10^-4 versus 1*10^-4; P<10^-2). This is consistent with previous reports for the (CAG)_n arrays within the androgen receptor (AR) and myotonic dystrophy (DM) genes within the germline of high normal range individuals (23 ,24 ). However, the frequencies of change in these genes seem greater than in (CGG)_n. The expansion rate in AR increased disproportionately by >200-fold in cells with full mutations, though contractions increased 15-fold, suggesting that expansion and contraction may be due to distinct molecular mechanisms (25 ). In order to put a figure to expansions and contractions in the (CGG)_n repeat, it would be interesting to analyze germline variation from individuals with intermediate allelic ranges, for example 35 and 45 repeats and with premutations. Interestingly, all the expansions were found in the +4 to +10 repeats range while most of the contractions were in the -10 to -30 range (Table 1 ). This may suggest that expansions and short contractions occurred by the same mechanism but that an additional subset of large contractions emerged from a disruptive mechanism, perhaps hairpin deletion as suggested by in vitro studies (21 ). This hypothesis is corroborated by the fact that this disruptive mechanism also depends on the size of the repeat, since no large contraction was observed in the DNA from C2. Sperm typing of CAG repeats in the AR gene allowed Zhang et al. to reach the same conclusion (24 ,25 ). Large contractions within the germline of premutated individuals may also account for observed regressions in size within fragile X families (26 ,27 ).

Sequence analysis of the repeat arrays in C1 and C2 showed the structures 8A9A36 and 9A9A9, respectively. Individual C1 was shown to carry the founder haplotype DX204-AC155-A as defined by the flanking microsatellites DXS548 and FRAXAC2 (11 ) and FRAXAC1 (16 ). This was found previously to be an `at-risk' haplotype because it is more frequent in fragile X chromosomes (10 ,11 ). Moreover, Hirst et al. (16 ) previously reported the array structure 8A9Ax in two chromosomes with 41 and 45 repeats (x = 22 and 26, respectively) associated with the same FRAXAC1 A allele but two different DXS548 alleles. This might suggest that the 8A9Ax structure arrays share a common ancestor. The different DXS548 alleles may reflect meiotic recombination between FRAXA and DXS548 which are 150 kb away. Because the array structure 8A9Ax is very rare in repeats shorter than 35, it may be associated with a subset of alleles predisposed to further expansion. The size of the CGG repeat in the offspring of C1 was not analyzed.

As a whole, the intermediate range allele exhibited higher instability within sperm than within leukocytes (1.08*10^-3 versus 3.6*10^-4; P[approx]5*10^-3). Due to the large sample size, this conclusion stays valid for expansions (7*10^-4 versus 1*10^-4; P<10^-2) and is only borderline for contractions (19*10^-4 versus 8*10^-4; P = 9*10^-2). These data suggest that germinal variation may also result from meiosis and that the mechanism of instability is different in germline and soma. This meiotic instability could be estimated by the difference between the mutation rate in sperm and the mutation rate in blood, but such a calculation requires that leukocytes and sperm are derived from approximately the same number of founder cells. Thus, germline instability may partly account for the dynamics of the CGG in the premutation borderline range. Postzygotic instability, suggested to be responsible for most of the transitions from premutations to full mutations (6 ), could be acting together with germline instability in the transition from normal to premutated alleles. The relatively small size of expansions in both germline and blood suggests that several recurrent mutations must have occurred on a chromosome before reaching the premutation array. Such a multistep process would lead to a series of hierarchical reservoirs resulting in genetic drift through a series of hierarchical founder effects. This could explain the reported existence of founder chromosomes (10 -12 ,18 ). However, high normal range alleles in DM (23 ) and AR (24 ) were shown to expand with rates respectively 100-fold and 500-fold greater than C1, even when variations of fewer than four repeats were not recorded. Moreover, one MD allele of 27 repeats had a 5-fold higher rate of expansion than contraction (25 ) and one HD allele of 30 repeats exhibited a rate of expansion higher than its contraction (28 ). Thus, the founder haplotype found in C1 does not necessarily make it a candidate for further expansion, since it contracts at a higher rate than it expands. However, it may predispose to additional changes enhanced by other factors such as cis-acting flanking elements, as previously suggested (13 ,27 ,28 ).

In conclusion, our data suggest that both germline and somatic variation contribute to the dynamics of the (CGG)_n repeat length variation within the high normal-premutation range. In addition, the size changes observed suggest that expansions and contractions might result from distinct mechanisms.

MATERIALS AND METHODS

Sperm and blood samples were obtained from two individuals from the general population. CGG repeat length variation was analyzed by SP-PCR (22 ) using a PCR protocol adapted from Fu et al. (5 ) and Levinson et al. (29 ). Genomic DNA from lymphocytes or sperm was diluted to a concentration of 1.14 ng/[mu]l, corresponding to ~350 haploid genomes/[mu]l. Aliquots of 175 (or 17.5 in a few cases) cells were denatured with 0.5 [mu]l of 0.8 M NaOH, 1 mM EDTA for 5 min at room temperature and neutralized with 0.5 [mu]l of 0.5 M NH₄C₂H₃O₂ pH 5.4. Samples were amplified by PCR in 10 mM Tris-HCl pH 8.3, 50 mM KCl using 2 mM MgCl₂, 500 mM each dATP, dCTP, dTTP and deaza-dGTP, 10% dimethysulfoxide and 1 U of Taq DNA polymerase (Eurobio, France). The reaction mixture was heated to 95^oC for 10 min, and then subjected to five cycles of DNA denaturation (2 min 30 s at 95^oC), annealing (1 min at 65^oC) and extension (2 min 30 s at 72^oC) and 25 cycles of DNA denaturation (1 min 30 s at 95^oC), annealing (1 min at 55^oC) and extension (2 min 30 s at 72^oC). The sense primer used was 5'AGCCCCGCACTTCCACCACCAGCTCCTCCA and the antisense primer was 5'GCTCAGCTCCGTTTCGGTTTCACTTCCGGT.

PCR products were migrated onto a sequencing gel of 4% polyacrylamide, transferred onto a nylon membrane and hybridized with a GCC₇ oligonucleotide probe end-labeled with DNA terminal transferase (Boehringer Mannheim) and digoxygenin-ddUTP. Hybridization was performed at 62^oC in 5* SSC, 0.1% laurylsarcosine, 0.02% SDS and 1% blocking reagent (Boehringer Mannheim). Membranes were washed for 20 min at 62^oC in 2* SSC, 0.1% SDS and detected by chemiluminescence.

The size of the CGG alleles of the two tested individuals was checked by sequence analysis of the repeat arrays and by amplification of 200 ng of somatic DNA co-migrated with a sequencing reaction of bacteriophage M13.

Preparation of sequencing templates and sequence analysis of the repeat arrays was performed with Pfu polymerase (Stratagene) as previously described (16 ). Significances of the instability rates were statistically tested by using a 2*2 [chi]² test.

ACKNOWLEDGEMENTS

This work was supported by a grant from the Fondation pour la Recherche Médicale. M.H. is funded by the Wellcome Trust.

REFERENCES

2 Oberlé, I., Rousseau, F., Heitz, D., Kretz, C., Devys, D., Hanauer, A., Boué, J., Bertheas, M.F. and Mandel, J.L. (1991) Instability of a 550 bp DNA segment and abnormal methylation in fragile X syndrome. Science, 252, 1097-1102. MEDLINE Abstract

3 Kremer, E.J., Pritchard, M., Lynch, M., Yu, S., Holman, K., Baker, E., Warren, S.T.,Schlessinger, S., Sutherland, G.R. and Richards, R.I. (1991) Mapping of DNA instability at the fragile X to a trinucleotide repeat sequence p(CGG)_n. Science, 252, 1711-1714. MEDLINE Abstract

4 Verkerk, A.J.M.H, Pieretti, M., Sutcliffe, J.S., Fu, Y.H., Kuhl, D.P.A., Pizzuti, A., Reiner, O., Richards, S., Victoria, M.F., Zhang, F., Eussen, B.E., van Ommen, G.B., Blonden, L.A.J., Riggins, G.J., Chastain, J.L., Kunst, C.B., Galjaard, H., Caskey, C.T., Nelson, D.L., Oostra, B.A. and Warren, S.T. (1991) Identification of a gene (FMR1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell, 65, 905-914.

5 Fu, Y.H., Kuhl, D.P.A., Pizzuti, A., Pieretti, M., Sutcliffe, J.S., Richards, S., Verkerk, A.M.J.H., Holden, J.J.A., Fenwick, R.G., Warren, S.T., Oostra, B.A., Nelson, D.L. and Caskey, C.T. (1991) Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox. Cell, 67, 1047-1058. MEDLINE Abstract

6 Reyniers, E., Vits, L., De Boulle, K., Van Roy, B., Van Velzen, D., de Graaff, E., Verkerk, A.J.M.H., Jorens, H.Z.J., Darby, J.K., Oostra, B. and Willems, P.J. (1993) The full mutation in the FMR1 gene of male fragile X patients is absent in their sperm. Nature Genet., 4, 143-146. MEDLINE Abstract

7 Arinami, T., Asano, M., Kobayashi, K., Yanagi, H. and Hamaguchi, H. (1993) Data on the CGG repeat at the fragile X site in the non-retarded Japanese population and family suggest the presence of a subgroup of normal alleles predisposing to mutate. Hum Genet., 92, 431-436. MEDLINE Abstract

8 Jacobs, P.A., Bullman, H., Macpherson, J., Youings, S., Rooney, V., Watson, A. and Dennis, N.R. (1993) Population studies of the fragile X: a molecular approach. J. Med. Genet., 30, 454-459. MEDLINE Abstract

9 Montagnon, M., Bogyo, A., Deluchat, C., Jokic, M., Chateau, C., Taillandier, A., Thomas, F., Simon-Bouy, B, Boué, J., Serre, J.L., Boué, A. and Mornet, E. (1994) Transition from normal to premutated alleles in fragile X syndrome results from a multistep process. Eur. J. Hum. Genet., 2, 125-131. MEDLINE Abstract

10 Richards, R.I., Holman, K., Friend, K., Kremer, E., Hillen, D., Staples, A., Brown, W.T., Goonewardena, P., Tarleton, J., Schwartz, C. and Sutherland, G.R. (1992) Fragile X syndrome; evidence of founder chromosomes. Nature Genet., 1, 257-260. MEDLINE Abstract

11 Oudet, C., Mornet, E., Serre, J.L., Thomas, F., Lentes-Zengerling, S., Kretz, C., Deluchat, C., Tejada, I., Boué, J., Boué, A. and Mandel, J.L. (1993) Linkage disequilibrium between the fragile X mutation and two closely linked CA repeats suggests that fragile X chromosomes are derived from a small number of founder chromosomes. Am. J.Hum. Genet., 52, 297-304. MEDLINE Abstract

12 Oudet C., von Koskull, H., Nordstrom, A.M., Peippo, M. and Mandel, J.L. (1993) Striking founder effect for the fragile X syndrome in Finland. Eur. J. Hum. Genet., 1, 181-189. MEDLINE Abstract

13 Kolehmainen, K. (1994) Population genetics of fragile X: a multiple allele model with variable risk of CGG repeat expansion. Am. J. Med. Genet., 51, 428-435. MEDLINE Abstract

14 Kunst, C.B. and Warren, S.T. (1994) Cryptic and polar variation of the fragile X repeat could result in predisposing normal alleles. Cell, 77, 853-861. MEDLINE Abstract

15 Eichler, E.E., Holden, J.A., Popovich, B.W., Reiss, A.L., Snow, K., Thibodeau, S.N., Richards, C.S., Ward, P.A. and Nelson, D.L. (1994) Length of uninterrupted CGG repeats determines instability in the FMR1 gene. Nature Genet., 8, 88-94. MEDLINE Abstract

16 Hirst, M.C., Grewal, P.K. and Davies, K. (1994) Precursor arrays for triplet repeat expansion at the fragile X locus. Hum. Mol. Genet., 3, 1553-1560. MEDLINE Abstract

17 Snow, K., Tester, D.J., Kruckeberg, K.E., Schaid, D.J. and Thibodeau, S.N. (1994) Sequence analysis of the fragile X trinucleotide repeat: implications for the origin of the fragile X mutation. Hum. Mol. Genet., 3, 1543-1551. MEDLINE Abstract

18 Zhong, N., Weihong, Y., Dobkin, C. and Brown, W.T. (1995) Fragile X gene instability: anchoring AGGs and linked microsatellites. Am. J. Hum. Genet., 57, 351-361. MEDLINE Abstract

19 Fry, M. and Loeb, L.A. (1994) The fragile X syndrome d(CGG)_n nucleotide repeats form a stable tetrahelical structure. Proc. Natl Acad. Sci. USA, 91, 4950-4954. MEDLINE Abstract

20 Gacy, A.M., Goeliner, G., Juranic, N., Macura, S. and McMurray, C.T. (1995) Trinucleotide repeats that expand in human disease form hairpin structures in vitro. Cell, 81, 533-540. MEDLINE Abstract

21 Usdin, K. and Woodford, K.J. (1995) CGG repeats associated with DNA instability and chromosome fragility form structures that block DNA synthesis in vitro. Nucleic Acids Res., 23, 4202-4209. MEDLINE Abstract

22 Jeffreys, A.J., Tamaki, K., MacLeod, A., Monckton, D.G., Neil, D.L. and Armour, J.A.L. (1994) Complex gene conversion events in germline mutation at human minisatellites. Nature Genet., 6, 136-145. MEDLINE Abstract

23 Monckton, D.J., Wong, L.J.C., Ashizawa, T. and Caskey, C.T. (1995) Somatic mosaicism, germline expansions, germline reversions and intergenerational reductions in myotonic dystrophy males: small pool PCR analyses. Hum. Mol. Genet., 4, 1-8.

24 Zhang, L., Leeflang, P., Yu, J. and Arnheim, N. (1994) Studying human mutations by sperm typing: instability of CAG trinucleotide repeats in the human androgen receptor gene. Nature Genet., 7, 531-535. MEDLINE Abstract

25 Zhang L., Fischbeck, K.H., and Arnheim, N. (1995) CAG repeat length variation in sperm from a patient with Kennedy's disease. Hum. Mol. Genet., 4, 303-305. MEDLINE Abstract

26 Chiurazzi, P., Kosak, L. and Neri, G. (1994) Unstable triplets and their mutational mechanisms: size reduction of the CGG repeats vs germline mosaicism in the fragile X syndrome. Am. J. Med. Genet., 51, 517-521. MEDLINE Abstract

27 Mornet, E., Chateau, C., Taillandier, A., Simon-Bouy, B. and Serre, J.L. (1996) Recurrent and unexpected segregation of the FMR1 CGG repeat in a family with fragile X syndrome. Hum. Genet., 97, 512-515. MEDLINE Abstract

28 Goldberg, Y.P., McMurray, C.T., Zeisler, J., Almqvist, E., Sillence, D., Richards, F., Marquis Gacy, A., Buchanan, J., Telenius, H. and Hayden, M.R. (1995) Increased instability of intermediate alleles in families with sporadic Huntington disease compared to similar sized intermediate alleles in the general population. Hum. Mol. Genet., 4, 1911-1918. MEDLINE Abstract

29 Levinson, G., Maddalena, A., Palmer, F.T., Harton, G.L., Bick, D.P., Howard-Peebles N., Black, S.H. and Schulman, J.D. (1994) Improved sizing of fragile X CGG repeats by nested polymerase chain reaction. Am. J. Hum. Genet., 51, 527-534.

*To whom correspondence should be addressed

CiteULike

Connotea

Del.icio.us

This article has been cited by other articles:

				B. T. Farrell and R. S. Lahue CAG{middle dot}CTG repeat instability in cultured human astrocytes Nucleic Acids Res., September 11, 2006; 34(16): 4495 - 4505. [Abstract] [Full Text] [PDF]

				R. Pelletier, B. T. Farrell, J. J. Miret, and R. S. Lahue Mechanistic features of CAG*CTG repeat contractions in cultured cells revealed by a novel genetic assay Nucleic Acids Res., September 30, 2005; 33(17): 5667 - 5676. [Abstract] [Full Text] [PDF]

				L. M. Pollard, R. Sharma, M. Gomez, S. Shah, M. B. Delatycki, L. Pianese, A. Monticelli, B. J.B. Keats, and S. I. Bidichandani Replication-mediated instability of the GAA triplet repeat mutation in Friedreich ataxia Nucleic Acids Res., November 8, 2004; 32(19): 5962 - 5971. [Abstract] [Full Text] [PDF]

				R. Sharma, S. Bhatti, M. Gomez, R. M. Clark, C. Murray, T. Ashizawa, and S. I. Bidichandani The GAA triplet-repeat sequence in Friedreich ataxia shows a high level of somatic instability in vivo, with a significant predilection for large contractions Hum. Mol. Genet., September 1, 2002; 11(18): 2175 - 2187. [Abstract] [Full Text] [PDF]

				A. L. Bacon, M. G. Dunlop, and S. M. Farrington Hypermutability at a poly(A/T) tract in the human germline Nucleic Acids Res., November 1, 2001; 29(21): 4405 - 4413. [Abstract] [Full Text] [PDF]

				M. L. Rolfsmeier, M. J. Dixon, L. Pessoa-Brandão, R. Pelletier, J. J. Miret, and R. S. Lahue Cis-Elements Governing Trinucleotide Repeat Instability in Saccharomyces cerevisiae Genetics, April 1, 2001; 157(4): 1569 - 1579. [Abstract] [Full Text]

				D. C. Crawford, B. Wilson, and S. L. Sherman Factors involved in the initial mutation of the fragile X CGG repeat as determined by sperm small pool PCR Hum. Mol. Genet., November 1, 2000; 9(19): 2909 - 2918. [Abstract] [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (17) Request Permissions Google Scholar Articles by Mornet, E. Articles by Serre, J. L. Search for Related Content PubMed PubMed Citation Articles by Mornet, E. Articles by Serre, J. L. Social Bookmarking          What's this?