Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (29)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Roepman, R.
Right arrow Articles by Berger, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roepman, R.
Right arrow Articles by Berger, W.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 827-833
Identification of a gene disrupted by a microdeletion in a patient with X-linked retinitis pigmentosa (XLRP)
Introduction
Results
   Deletion detection by YAC representation hybridization (YRH)
   Construction of a cosmid contig and identification of exon sequences
Discussion
Materials And Methods
   Purification and restriction enzyme digestion of YAC DNA
   Generation and cloning of amplicons
   Southern blot analysis
   Cosmid library screening
   Screening of cDNA libraries
   Shotgun cosmid sequencing
   SSCP analysis
Acknowledgements
References
Note Added In Proof

Identification of a gene disrupted by a microdeletion in a patient with X-linked retinitis pigmentosa (XLRP)

Identification of a gene disrupted by a microdeletion in a patient with X-linked retinitis pigmentosa (XLRP) Ronald Roepman1, David Bauer2, Thomas Rosenberg3, Gerard van Duijnhoven1, Esther van de Vosse4, Matthias Platzer2, André Rosenthal2, Hans-Hilger Ropers1,5, Frans P. M. Cremers1 and Wolfgang Berger5,*

1Department of Human Genetics, University Hospital Nijmegen, Nijmegen, The Netherlands, 2Institut für Molekulare Biotechnologie, Genomanalyse, Jena, Germany, 3National Eye Clinic for the Visually Impaired, Hellerup, Denmark, 4Department of Genetics, Leiden University, Leiden, The Netherlands and 5Max-Planck-Institut für Molekulare Genetik, Berlin, Germany

Received February 20, 1996; Revised and Accepted April 9, 1996EMBL accession nos. X94766-X94768

The gene for the most frequent form of X-linked retinitis pigmentosa (XLRP), RP3, has been assigned by genetic and physical mapping to a segment of less than 1000 kbp, which is flanked by the marker DXS1110 and the ornithine transcarbamylase (OTC) gene. In search of microdeletions, we have screened the DNA of 30 unrelated patients with XLRP by employing a representative set of YAC-derived DNA fragments that were generated by restriction enzyme digestion and PCR amplification. In one of these patients, a 6.4 kbp microdeletion was detected which was not present in the DNA of 444 male controls. A cosmid contig spanning the deletion was constructed and used to isolate cDNAs from retina-specific libraries. Exons corresponding to these expressed sequences as well as other putative exons were identified by sequencing more than 30 kbp of the critical region. So far, no point mutations in these putative exon sequences have been identified.

INTRODUCTION

Retinitis pigmentosa (RP) is a clinically heterogeneous group of retinal degenerations characterized by night blindness, progressive constriction of the visual field due to the early loss of peripheral photoreceptor cells, and fundus abnormalities including intraretinal bone corpuscle-like clumps of pigment. In advanced stages central vision is lost and patients become severely impaired.

Genetic analysis has defined more than 10 chromosomal regions that carry genes for RP. Several genes underlying autosomally inherited forms were identified by candidate gene approaches, including the genes coding for rhodopsin (1 ), the [alpha]- and [beta]-subunits of the rod-specific cGMP phosphodiesterase (2 ,3 ), peripherin (4 ), and the rod outer membrane protein (ROM1). Mutations in the genes encoding the two latter polypeptides were recently reported as the first example of a digenic mode of inheritance in a genetic disease (5 ). Most cases of familial RP inherit in an autosomal recessive way. Autosomal dominant and X-linked recessive inheritance are less frequent, accounting for 10 and 6% of the families, respectively. In the UK, X-linked forms have been reported to account for 30% of the cases (6 ), and in Denmark for 17% (7 ).

Clinically, X-linked RP is considered as the most severe form, with an earlier age of onset than autosomal recessive or dominant RP. Linkage studies and heterogeneity testing in families with XLRP revealed at least two different loci, one at Xp21.1-p11.4 (RP3) closely linked to OTC and distal to DXS7, and a second locus (RP2) between DXS7 and DXS255 at Xp11.2-p11.4 (8 ,9 ). Upon fundoscopic examination, carriers of the RP3 type show a characteristic, metallic-sheen tapetal reflex [OMIM#312610 (10 )], whereas carrier females from RP2 families do not [OMIM#312600 (10 )]. Heterogeneity testing has supported the existence of a third X-linked locus (RP6), distal to RP3 (11 ). So far, none of the X-linked genes has been isolated.

Previously, the chromosomal interval carrying the RP3 locus has been defined by molecular characterization of two deletions found in patients with RP and other X-linked disorders, including Duchenne muscular dystrophy (DMD), chronic granulomatous disease (CGD), and McLeod syndrome (12 ,13 ). In this way, the critical interval could be narrowed to less than 1000 kbp (14 ,15 ). Within this region, a 70 kbp deletion has been detected recently (16 ). In order to perform a comprehensive search for microdeletions in XLRP patients, we have developed a technique which was inspired by the representational difference analysis (RDA) protocol (17 ) and resembles the YACadapt method described by Sutcliffe et al. (18 ). The essence of this technique is the generation of a defined, amplifiable subset of restriction fragments which are derived from and represent the insert of a YAC spanning a genomic region of interest. After ligation to suitable linkers, these fragments are amplified by PCR and the mixture of PCR products is used as a probe for hybridization of Southern blots containing restriction enzyme digested genomic DNA. We have employed this technique to study 30 unrelated XLRP patients with PCR-amplified probes from a YAC spanning the RP3 gene region. In one of those patients, a microdeletion was identified. The isolation of cosmid clones from the relevant region and their use as hybridization probes confirmed this result and enabled the construction of a cosmid contig spanning 120 kbp around this deletion. Finally, putatively transcribed sequences could be identified by screening a retinal cDNA library and by sequencing the entire cosmid clone spanning the deletion.

RESULTS

Deletion detection by YAC representation hybridization (YRH)

The principle of the method is the reduction of the complexity of the YAC-insert to a subset of small, amplifiable restriction fragments (YAC representations or `amplicons') and their subsequent hybridization to Southern blots containing genomic DNA of patients. Prior to the generation of these amplicons, the YAC DNA was purified by preparative pulsed field gel electrophoresis and cleaved with a restriction endonuclease. Linkers were ligated to both ends, and the fragments were amplified by employing linker-specific oligonucleotides as primers. The PCR products, usually a `smear' with some distinct bands in the size range of 0.2 to 1.0 kbp (Fig. 1 ), were purified, radiolabeled and used as a probe to screen Southern blots with DNA of patients.


Figure 1. PCR fragments of the HindIII amplicon from a 660 kbp YAC after separation in a 1.5% agarose gel and staining with ethidium bromide.

To study the genomic region containing the RP3 gene, we used a 660 kbp YAC (ICRFy900E0701), which harbours the cyto- chrome b-245 (CYBB) gene and part of the OTC gene. This YAC was also shown by PCR analysis to contain the marker DXS1110. Screening of EcoRI digested genomic DNA from 30 unrelated X-linked RP patients with the HindIII amplicon of the YAC revealed the absence of a 1.5 kbp fragment in one of them (patient 2557, Fig. 2 a). To rule out a restriction site polymorphism, the DNA of this patient was cleaved with the restriction endo- nucleases BamHI, BglII, EcoRV, HindIII, MspI, PstI, PvuII, SstI, TaqI, and XbaI. Aberrant restriction patterns were observed with BglII, PstI, and PvuII (data not shown). As expected, the proportion of the genomic sequence that can be visualized in this way depends on the restriction enzyme employed. Hybridization of the HindIII amplicon of YAC E0701 to EcoRI-digested genomic DNA visualized 6.5% of the sequences encompassed by the YAC, whereas the same amplicon enabled the visualization of 19% of the genomic sequences after SstI digestion.


Figure 2.Autoradiographs of Southern blots containing EcoRI digested genomic DNA from a control and patient 2557 after hybridization with (a) the HindIII amplicon of YAC E0701; (b) clone p20; (c) cosmid LL242D12; and (d) cDNA clone R5.

For further analysis, the amplicon was cleaved with HindIII to remove linker sequences and the resulting fragments were cloned into the HindIII digested pGEM3 vector. Subsequently, individual clones from the amplicon library were used as probes on Southern blots containing patient and control DNA. Among the first 20 clones tested, one clone (p20) was deleted in the patient's DNA (Fig. 2 b) but not in controls. Cloning of the corresponding genomic region was achieved by using clone p20 (a 300 bp HindIII fragment, see Fig. 4 ) as a probe to screen an X-specific cosmid library. Four positive cosmids were obtained and hybridized to EcoRI digested DNA. An aberrant hybridization pattern was observed in the patient when these cosmids were used as probes: four fragments of 8.0, 3.8, 2.1 and 1.5 kbp, respectively, were absent, and one aberrant fragment of 9 kbp was seen (Figs 2 c and 4 ). These data enabled us to determine the size of the deletion as 6.4 kbp.

Construction of a cosmid contig and identification of exon sequences

For the isolation of cosmid contigs from the critical region we have used the HindIII amplicon of the YAC to screen an X chromosome-specific cosmid library. Eighty-five positive cosmids were picked and spotted on a nylon membrane. Cosmid walking was performed by using the YAC end clones, generated by ligation mediated PCR, and cDNAs derived from the CYBB and OTC genes as starting points. Overlapping cosmids were identified which linked (i) the right end clone and CYBB and (ii) the left end clone and OTC. Cosmids detecting the microdeletion in patient 2557 were located between the CYBB and OTC contigs and were employed as a third anchor point for cosmid walking. This intermediate contig has been expanded to a size of at least 300 kbp and overlaps with the contig around the CYBB gene. In order to identify transcribed sequences, we have screened an adult retinal cDNA library and identified six clones, which recognized three X-chromosomal EcoRI fragments on genomic Southern blots (Fig. 2 d). Sequence analysis of the six cDNAs and the corresponding genomic fragments revealed five exons (fragments Z-V, Fig. 4 ). cDNA clone R5 was shown to comprise exons V-Z and detected a 7.5 kbp transcript in heart, brain, placenta, lung liver, muscle, kidney, and pancreas (data not shown). A poly(A)-tail was identified in fragment Z and a polyadenylation signal (AATAAA) was present in the corresponding genomic sequence of the 4.7 kbp EcoRI fragment. Therefore, fragment Z is considered to represent the 3' end of a gene. This fragment also revealed a 94.7 % identity with a human EST (em_est: hsgs01161). No open reading frame was present in the cDNA clone R5 and database searches failed to detect significant homologies with known gene sequences. Hybridization of the cDNA to a Southern blot containing EcoRI digested DNA from two carriers of the patient's family and an affected brother revealed cosegregation of the deletion breakpoint fragment with the disease (Fig. 3 ).


Figure 3. Autoradiogram of a Southern blot containing EcoRI restricted DNA from a control (left open circle), patient 2557, his mother and daughter as well as one affected brother after hybridization with a subclone of the cDNA probe R5. The 9 kbp fragment represents the deletion breakpoint whereas the 3.8 kbp fragment corresponds to the unaffected X chromosome.

Shotgun cosmid sequencing enabled us to determine 32895 bp of DNA sequence encompassing the 6.4 kbp microdeletion. Exon prediction by GRAIL identified three additional putative exons; one proximal (fragment U) and two distal (fragments A and B) to the retinal cDNA (see Fig. 4 ).

By employing the SSCP technique, mutation screening was carried out in 29 XLRP patients for all putatively transcribed sequences (Table 1 ). Bandshifts in fragments Z, Y, V and U were found both in patients and in controls. Therefore it is most likely that these variants represent polymorphisms rather than disease-related changes.

Recently, another gene has been cloned from the RP3 critical region, designated SRPX or ETX1 (16 ,19 ). In order to locate this gene with respect to the candidate sequences isolated in this study, we have used primers from the 5'- (exon 1) and the 3'- (exon 10) end of the SRPX gene. Both sequences were found to be present on our cosmid contig encompassing the critical region. However, no SRPX sequences were deleted in patient 2557 and exon 1 of this gene was mapped approximately 50 kbp distal to the deletion breakpoint (Fig. 5 ).


Figure 4.EcoRI restriction map of a 40 kbp region surrounding the 6.4 kbp microdeletion in patient 2557 and location of putative exons as identified by cDNA screening (fragments V, W, X, Y and Z) and exon prediction from genomic sequences (fragments U, W, X, A and B). A polyA-tail was present at fragment Z. The amplicon clone p20 hybridizes to the 1.5 kbp EcoRI fragment and was shown to be deleted in patient 2557. The same clone was used to isolate cosmid LL242D12, which encompasses the microdeletion 2557. The sequenced parts of cosmid LL242D12 are given as shaded boxes.

DISCUSSION

The identification of submicroscopic deletions or other small chromosomal rearrangements has been instrumental for the positional cloning of numerous disease genes (20 ). The YRH method used in this study allows the screening for microdeletions of chromosomal regions as large as YAC inserts by employing a representative set of small, amplified restriction fragments as probe in Southern blot hybridization. Although not all of the sequences which are covered by the YAC are visualized with this method, a representation of up to 19% can be achieved with a single hybridization. The resolution of this technique can be enhanced by the use of several restriction endonucleases either for the generation of amplicons or for the digestion of the genomic DNA. In this way, amplicons can be generated that will cover nearly the entire region of interest (17 ). In contrast, the generation of probes by Alu PCR (21 ,23 ) requires the presence of Alu repeat motifs in an amplifiable distance; thus, these probes are much less representative and the resolution of this approach is limited. As shown here, the YRH method allows the generation of a dense array of clones from a genomic region of 660 kbp, and enabled us to detect a 6.4 kbp microdeletion in a patient with XLRP. Eight putative exons could be identified in the vicinity of this deletion, six of which seem to belong to the gene. Two of these were deleted in the patient and his affected brother but not in 444 unrelated controls. Thus, this gene may have a causal role in RP3, the most common X-linked form of retinitis pigmentosa. SSCP screening has revealed several other sequence alterations within these putative exons but none of these were confined to patients with XLRP. The apparent absence of point mutations in the cDNA that spans the 6.4 kbp deletion is not too surprising, since none of the exons which have been identified so far seem to code for protein. On the other hand, mutation detection by SSCP might be hampered by the size of the PCR fragments, which is >200 bp and therefore not optimal for the detection of all sequence alterations (24 ). As judged from the presence of a poly(A) tail in one of the cDNA clones, the exons identified so far may be derived from the 3' untranslated part of the transcript. The 3' untranslated regions of mRNAs are known to contribute to its stability and are responsible for the intracellular transport (25 ). Therefore, the observed deletion of two exons from this region in patient 2557 may result in an unstable or erroneously located mRNA molecule. Alternatively, the disease phenotype may be due to the deletion of sequences important in chromatin structure (e.g., matrix attachment sites) or replication (26 ). Deletion of 5' regulatory sequences of a not yet identified adjacent gene is another possibility. Recently, a novel gene has been identified from the RP3 critical region called SRPX (16 ) or ETX1 (19 ). Exon 1 of SRPX was reported to be deleted in a patient with XLRP (patient MO, ref. 16 ), but the search for clinically relevant point mutations in the coding region of this gene, performed in 79 unrelated patients with XLRP, was unsuccessful (16 ,19 ). This strongly argues against a role of this gene in the etiology of RP3. The MO deletion is much larger than the one described here and includes the entire cosmid C04155 (see Fig. 5 ). Therefore it encompasses all putative exons described in this report including the cDNA that spans the 6.4 kbp deletion in patient 2557. In contrast, this 6.4 kbp deletion is at least 50 kbp proximal to the 5' end of the SRPX gene. In conclusion, we have isolated the 3' end of a gene that is deleted in two patients with XLRP but not in healthy controls. Therefore, we consider it as a strong candidate for the long-sought RP3 gene. Elongation of this cDNA and mutation screening in coding regions of the gene should soon reveal if it is really involved in the etiology of RP3.


Figure 5. Physical map of the RP3 critical region as defined by deletion mapping in patient 2557 and the recently identified deletion MO, which was reported to be 70 kbp in size (16). The two flanking markers CYBB (cytochrome b-245) and OTC (ornithine transcarbamylase) were present on a 660 kbp YAC. Exon 1 of the previously described SRPX gene is located on cosmids LL42F6 and LL104E10, and exon 10 was mapped to cosmid LL244E1. The ICRF cosmid clone C04155 and exon 1 of the SRPX gene were shown to be deleted in patient MO (16). The deletion 2557 is 6.4 kbp in size and approximately 30 kbp proximal to exon 1 of the SRPX gene.

MATERIALS AND METHODS

Purification and restriction enzyme digestion of YAC DNA

DNA from the YAC (ICRFy900E0701) was isolated in 1% LMT (w/v) agarose plugs (40 [mu]l each plug) using standard procedures (27 ). The YAC DNA of 40 plugs was separated from the yeast chromosomes on a preparative 1% low melting agarose gel using pulsed field gel electrophoresis (PFGE) with 0.5* TBE (45 mM Tris-borate-EDTA, pH 8.3) as electrode buffer. The 660 kbp YAC was cut out of the gel and the DNA was purified using gelase (Epicentre Technologies). The DNA (400 ng) was digested using 4 U of either the restriction enzyme HindIII (New England Biolabs), BamHI (BRL) or BglII (BRL) according to the manufacturers instructions, phenol-chloroform extracted, precipitated (NaCl/ethanol) and dissolved in water (10 ng/[mu]l).

Generation and cloning of amplicons

PCR linkers were ligated to 100 ng of restriction fragments in 30 [mu]l of T4 ligase buffer using 400 U of T4 DNA ligase (BRL). Depending on the restriction enzyme, linkers as described by Lisitsyn et al. (17 ) were used: RBgl24 (1.5 [mu]g) and RBgl12 (0.75 [mu]g) to the BglII fragments; RBgl24 (1.5 [mu]g) and RHind12 (0.75 [mu]g) to the HindIII fragments and RBam24 (1.5 [mu]g) and RBam12 (0.75 [mu]g) to the BamHI fragments. PCR amplification of the YAC fragments was performed in a total reaction volume of 100 [mu]l, containing 10 [mu]l of the ligation mixture, and 20 [mu]l 5* PCR buffer (67 mM Tris-HCl, pH 8.8, 4 mM MgCl2, 16 mM (NH4)2SO2, and 320 [mu]M (each) dATP, dGTP, dCTP, dTTP). The tubes were heated to 72oC using a thermocycler (Perkin-Elmer), 5 U Taq polymerase (AmpliTaq, Perkin-Elmer Cetus) were added, the reactions were covered with mineral oil and incubated for 5 min at 72oC to fill in 5' protruding ends of the ligated linkers. Subsequently, 2 [mu]g of the PCR primers were added, and the amplicons were generated during 20 cycles of 1 min 95oC and 3 min at 72oC with a final extension for 10 min at 72oC.The amplified fragments were purified using a Centricon 100 microconcentrator (Amicon), diluted to 100-200 ng/[mu]l and used as a probe on Southern blots.

Table 1 Summary of putatively transcribed sequences from cosmid C2 as identified by cDNA isolation or exon prediction from genomic DNA sequences and database comparison Polymorphic
Fragment

 Mode of

 Size

 Genomic

 SSCP fragments and primers

 

 identification

 (bp)

 EcoRI fragment

 Size (bp)

 Sequence (5' -> 3')
U

 GRAIL

 680

 1.5 kbp

 312

 atctgctggttgttcaggct

 +
 

  

  

  

  

 agcttggcctttccttcttc
 

  

  

  

 212

 cacttccctcaataatgatcag

 -
 

  

  

  

  

 ggctttcatcgacagaagtgat
 

  

  

  

 379

 agtggtctcattcttaagcttc

 -
 

  

  

  

  

 gttcattaccagctagagctc
 

  

  

  

 232

 gagtgcaactgaaatgtcttct

 -
 

  

  

  

  

 tcctgaacatctcctacaatct
V

 cDNA/GRAIL

 >1000

 3.8 kbp

 350

 ctacttgaagtcacagaaagc

 +
 

  

  

  

  

 cagaaacctcagtaggaacc
 

  

  

  

 322

 aggtgcagactctggtctg

 +
 

  

  

  

  

 ccacggacaaaagtgcctat
 

  

  

  

 410

 cttgatttggatgctgatcag

 +
 

  

  

  

  

 agattaaggcttggaaagcag
W

 cDNA/GRAIL

 185

 3.8 kbp

 272

 tcttactcttctctgatggtc

 -
 

  

  

  

  

 ggatctcaggatttaagcatc
X

 cDNA/GRAIL

 61

 2.0 kbp

 235

 tagaacctgcttaaagattcag

 -
 

  

  

  

  

 agcttataattacccaattatgg
Y

 cDNA/GRAIL

 96

 2.0 kbp

 248

 tcactgagagcatcaggtctt

 +
 

  

  

  

  

 gagttaaattatgtggattgcca
Z

 cDNA/EST/

 514

 4.7 kbp

 258

 gttaagtgaatgtttcacttatg

 +
 

 GRAIL

  

  

  

 acaatacacttggtgactgtga
 

  

  

  

 382

 gagtcaggaatcatcagaatatc

 -
 

  

  

  

  

 gtaagattgcaaatattgcctta
A

 GRAIL

 97

 10.0 kbp

 203

 ttctcataccagaagcaggg

 -
 

  

  

  

  

 ggcagatccgtgcggcc
B

 GRAIL

 113

 6.0 kbp

 288

 ctagtttcttattcttacaaggt

 -
 

  

  

  

  

 tggccaacatggcaaaactc

The location of the different fragments is shown in Figure 4.

Prior to cloning, linkers were removed from the amplified fragments by digestion with 10 U of the restriction enzyme per 1 [mu]g DNA and subsequently separated from primers by a preparative gel electrophoresis in 1% low melting agarose. DNA was purified using the QiaQuick gel purification kit (Qiagen) and subsequently ligated into phosphatase treated pGEM3 using standard procedures (28 ). The inserts of individual clones were obtained by direct colony PCR with the vector-primers T7 and SP6 (17 ).

Southern blot analysis

Lymphoblastoid cell line GM07947B (BB) was obtained through the NIGMS Human Genetic Mutant Cell Repository (Camden, NJ). DNA from RP patients was isolated from EBV transformed cell lines using standard procedures. Restriction enzyme digestions were performed according to the manufacturers instructions and fragments were separated on a 0.8% (w/v) agarose gel in 40 mM Tris-acetate, 1 mM Na2EDTA, pH 7.5. Alkaline blotting onto GeneScreen Plus membrane (DuPont) was performed for 2-5 h as recommended. When the amplicon was used as a hybridization probe, 150 ng of DNA was labelled and when plasmid or cosmid inserts were used, 5-10 ng of DNA was labelled by random primer extension (29 ,30 ). Hybridization was performed after competing repetitive sequences as described (31 ), except for amplicon probes, which were preassociated in the presence of 1 mg of sheared and denatured total human DNA (Hybridime).

Cosmid library screening

Gridded filters from an X chromosome-specific cosmid library (LL0XNC01, Lawrence Livermore National Library) were screened according to the accompanying instructions by using the clone p20 or the entire HindIII amplicon as a probe. Positive clones were identified and the Lawrist 16 vector arms were removed by cleavage with SfiI (New England Biolabs) and subsequent preparative gel electrophoresis [0.8% (w/v) LMT agarose].

Screening of cDNA libraries

Cosmid LL242D12 was used to screen two cDNA libraries, established from adult retina: an oligo-dT primed library in [lambda]gt10, (courtesy of J. Nathans) and an oligo-dT and randomly primed (5' stretch) library in [lambda]gt10, (Clontech HL 1132a, Lot # 17951). Screening of 500 000 p.f.u. of each library, plated on E.coli LE392, was performed mainly as described previously (32 ). Inserts from purified cDNAs were subcloned into the pGEM3 vector and sequenced by primer walking starting from the T7 and SP6 sites, and using an automatic ABI 370A DNA sequencer and a Taq DyeDeoxy terminator cycle sequencing kit (ABI).

Shotgun cosmid sequencing

The cosmid DNA was prepared and sequenced as previously described (33 ). In brief, after sonication of the DNA, a 0.8-1.4 kbp fraction was subcloned into the SmaI site of M13mp18. Templates were prepared through magnetic bead technology and sequenced using dye-primer chemistry. The raw data were collected using ABI373A automated sequencers and assembled with the XBAP program (34 ). Gaps were closed using custom made primers on M13 templates, PCR products or cosmid DNA in combination with Taq dye terminator chemistry (Perkin Elmer) or internal labeling (Pharmacia). Homology searches against the EMBL database were performed using BLAST (Version 1.4) (35 ) and FASTA (Version 2.0) (36 ). Gene prediction programs GRAIL (37 ) and XPOUND (38 ) were used. Sequence alignments were done by `Global Alignment Program' (39 ).

SSCP analysis

Putatively transcribed sequences were amplified by PCR using the primers (Isogen Bioscience, The Netherlands) indicated in Table 1 . The reactions were carried out in a total volume of 50 [mu]l and the presence of 10 mM Tris-HCl pH 8, 50 mM KCl, 3 mM MgCl2, 0.5 mM each dNTP, 10 ng bovine serum albumine (Biolabs), 125 ng of each primer, 100 ng template DNA and 1.25 U Taq DNA polymerase (Boehringer). If the sample was used for SSCP, the reaction was carried out in 20 [mu]l, containing 0.006 mM dCTP instead of 0.5 mM and 0.2 [mu]l [alpha]-[32P]dCTP (ICN, 3000 Ci/mmol). Amplification was performed for 35 cycles, each 1 min 92oC, 1 min 60oC and 2 min 72oC. SSCP analysis was carried out in non denaturing polyacrylamide gels as described (40 ).

ACKNOWLEDGEMENTS

The authors would like to thank Saskia van der Velde-Visser and Liesbeth Boender-van Rossum for establishing cell lines from XLRP patients, and H. Lehrach as well as H. Roest-Crollius for providing YAC and cosmid clones. The authors are grateful to J. Nathans and A. Ballabio for making available retinal cDNA libraries and E. M. Bleeker-Wagemakers for providing patients material. This work was supported by the Deutsche Forschungsgemeinschaft (G.v.D., Ro 389/16-3) and the Foundation Fighting Blindness, Inc., USA (R.R.). F.P.M.C. is recipient of a fellowship of the Royal Dutch Academy of Arts and Sciences. The chromosome-specific cosmid library LL0XNC01 used in this work was constructed at the Biology and Biotechnology Research Program, Lawrence Livermore National Laboratory, Livermore, CA 945500, under the auspices of the National Laboratory Gene Library Project sponsored by the US Department of Energy.

REFERENCES

1 Dryja,T.P., McGee,T.L., Reichel,E., Hahn,L.B., Cowley,G.S., Yandell,D.W., Sandberg,M.A. and Berson,E.L. (1990) A point mutation of the rhodopsin gene in one form of retinitis pigmentosa. Nature, 343, 364-366. MEDLINE Abstract

2 Huang,S.H., Pittler,S.J., Huang,X.H., Oliveira,L., Berson,E.L. and Dryja,T.P. (1995) Autosomal recessive retinitis pigmentosa caused by mutations in the a subunit of rod cGMP phosphodiesterase. Nature Genet., 11, 468-471. MEDLINE Abstract

3 McLaughlin,M.E., Sandberg,M.A., Berson,E.L. and Dryja,T.P. (1993) Recessive mutations in the gene encoding the b-subunit of rod phosphodiesterase in patients with retinitis pigmentosa. Nature Genet., 4, 130-134. MEDLINE Abstract

4 Farrar,G.J., Kenna,P., Jordan,S.A., Kumar-Singh,R., Humphries,M.M., Sharp,E.M., Sheils,D.M. and Humphries,P. (1991) A three-base-pair deletion in the peripherin-rds gene in one form of retinitis pigmentosa. Nature, 354, 478-480. MEDLINE Abstract

5 Kajiwara,K., Berson,E.L. and Dryja,T.P. (1994) Digenic retinitis pigmentosa due to mutations at the unlinked peripherin/rds and ROM1 loci. Science, 264, 1604-1608. MEDLINE Abstract

6 Jay,M. (1982) On the heredity of retinitis pigmentosa. Br. J. Ophthalmol., 66, 405-416. MEDLINE Abstract

7 Haim,M. (1993) Retinitis pigmentosa: problems associated with genetic classification. Clin. Genet., 44, 62-70. MEDLINE Abstract

8 Chen,J.D., Halliday,F., Keith,G., Sheffield,L., Dickinson,P., Gray,R., Constable,I. and Denton,M. (1989) Linkage heterogeneity between X-linked retinitis pigmentosa and a map of 10 RFLP loci. Am. J. Hum. Genet., 45, 401-411. MEDLINE Abstract

9 Teague,P.W., Aldred,M.A., Jay,M., Dempster,M., Harrison,C., Carothers,A.D., Hardwick,L.J., Evans,H.J., Strain,L., Brock,D.J.H., Bundey,S., Jay,B., Bird,A.C., Bhattacharya,S.S. and Wright,A.F. (1994) Heterogeneity analysis in 40 X-linked retinitis pigmentosa families. Am. J. Hum. Genet., 55, 105-111. MEDLINE Abstract

10 The Human Genome Database Project,J.H.,Baltimore. (1995) Online Mendelian Inheritance in Man, OMIM (TM). World Wide Web & ltURL:http://gdbwww. gdb. org/omim/docs/omimtop. html>1995

11 Ott,J., Bhattacharya,S., Chen,J.D., Denton,M.J., Donald,J., Dubay,C., Farrar,G.J., Fishman,G.A., Frey,D., Gal,A., Humphries,P., Jay,B., Jay,M., Litt,M., Mächler,M., Musarella,M., Neugebauer,M., Nussbaum,R.L., Terwilliger,J.D., Weleber,R.G., Wirth,B., Wong,F., Worton,R.G. and Wright,A.F. (1990) Localizing multiple X chromosome linked retinitis pigmentosa loci using multilocus homogeneity tests. Proc. Natl Acad. Sci. USA, 87, 701-704. MEDLINE Abstract

12 Francke,U., Ochs,H.D., de Martinville,B., Giacalone,J., Lindgren,V., Disteche,C., Pagon,R.A., Hofker,M.H., van Ommen,G.J.B., Pearson,P.L. and Wedgwood,R.J. (1985) Minor Xp21 chromosome deletion in a male associated with expression of Duchenne muscular dystrophy, chronic granulomatous disease, retinitis pigmentosa and McLeod syndrome. Am. J. Hum. Genet., 37, 250-267. MEDLINE Abstract

13 de Saint-Basile,G., Bohler,M.C., Fischer,A., Cartron,J., Dufier,J.L., Griscelli,C. and Orkin,S.H. (1988) Xp21 DNA microdeletion in a patient with chronic granulomatous disease, retinitis pigmentosa, and McLeod phenotype. Hum. Genet., 80, 85-89. MEDLINE Abstract

14 Roux,A.-F., Rommens,J., McDowell,C., Anson-Cartwright,L., Bell,S., Schappert,K., Fishman,G.A. and Musarella,M. (1994) Identification of a gene from Xp21 with similarity to the tctex-1 gene of the murine t complex. Hum. Mol. Genet., 3, 257-263. MEDLINE Abstract

15 Willard,H.F., Cremers,F., Mandel,J.L., Monaco,A.P., Nelson,D.L. and Schlessinger,D. (1994) Report of the fifth international workshop on human X chromosome mapping 1994. Cytogenet. Cell Genet., 67, 295-358. MEDLINE Abstract

16 Meindl,A., Carvalho,M.R.S., Herrmann,K., Lorenz,B., Achatz,H., Apfelstedt-Sylla,E., Wittwer,B., Ross,M. and Meitinger,T. (1995) A gene (SRPX) encoding a sushi-repeat-containing protein is deleted in patients with X-linked retinitis pigmentosa. Hum. Mol. Genet., 4, 2339-2346. MEDLINE Abstract

17 Lisitsyn,N., Wigler,M. (1993) Cloning the differences between two complex genomes. Science, 259, 946-951. MEDLINE Abstract

18 Sutcliffe,J.S., Zhang,F., Caskey,C.T., Nelson,D.L. and Warren,S.T. (1992) PCR amplification and analysis of yeast artificial chromosomes. Genomics, 13, 1303-1306. MEDLINE Abstract

19 Dry,K.L., Aldred,M.A., Edgar,A.J., Brown,J., Manson,F.D.C., Ho,M.-F., Prosser,J., Hardwick,L.J., Lennon,A.A., Thomson,K., van Keuren,M., Kurnit,D.M., Bird,A.C., Jay,M., Monaco,A.P. and Wright,A.F. (1995) Identification of a novel gene, ETX1, from Xp21.1, a candidate gene for X-linked retinitis pigmentosa (RP3). Hum. Mol. Genet., 4, 2347-2353. MEDLINE Abstract

20 Collins,F.S. (1995) Positional cloning moves from perditional to traditional. Nature Genet., 9, 347-350. MEDLINE Abstract

21 Cotter,F.E., Hampton,G.M., Nasipuri,S., Bodmer,W.F. and Young,B.D. (1990) Rapid isolation of human chromosome-specific DNA probes from a somatic cell hybrid. Genomics, 7, 257-263. MEDLINE Abstract

22 Ledbetter,S.A., Nelson,D.L., Warren,S.T. and Ledbetter,D.H. (1990) Rapid isolation of DNA probes within specific chromosome regions by interspersed repetitive sequence polymerase chain reaction. Genomics, 6, 475-481. MEDLINE Abstract

23 Nelson,D.L., Ledbetter,S.A., Corbo,L., Victoria,M.F., Ramirez-Solis,R., Webster,T.D., Ledbetter,D.H. and Caskey,C.T. (1989) Alu polymerase chain reaction: a method for rapid isolation of human-specific sequences from complex DNA sources. Proc. Natl Acad. Sci. USA, 86, 6686-6690. MEDLINE Abstract

24 Sheffield,V.C., Beck,J.S., Kwitek,A.E., Sandstrom,D.W. and Stone,E.M. (1993) The sensitivity of single-strand conformation polymorphism analysis for the detection of single base substitutions. Genomics, 16, 325-332. MEDLINE Abstract

25 Jackson,R.J. (1993) Cytoplasmic regulation of mRNA function: the importance of the 3' untranslated region. Cell, 74, 9-14. MEDLINE Abstract

26 Karpen,G.H. (1994) Position effect variegation and the new biology of heterochromatin. Curr. Opin. Genet. & Dev., 4, 281-291. MEDLINE Abstract

27 Green,E.D., Olson,M.V. (1990) Systematic screening of yeast artificial-chromosome libraries by use of the polymerase chain reaction. Proc. Natl Acad. Sci. USA, 87, 1213-1217. MEDLINE Abstract

28 Sambrook J, Fritsch EF, Maniatis T. ; Nolan C, editor. Molecular cloning. A laboratory manual. 2nd ed. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1989.

29 Feinberg,A.P., Vogelstein,B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem., 132, 6-13. MEDLINE Abstract

30 Feinberg,A.P., Vogelstein,B. (1984) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Addendun. Anal. Biochem., 137, 266-267. MEDLINE Abstract

31 Blonden,L.A., den Dunnen,J.T., van Paassen,H.M., Wapenaar,M.C., Grootscholten,P.M., Ginjaar,H.B., Bakker,E., Pearson,P.L. and van Ommen,G.J. (1989) High resolution deletion breakpoint mapping in the DMD gene by whole cosmid hybridization. Nucleic Acids Res., 17, 5611-21: MEDLINE Abstract

32 Berger,W., Meindl,A., van de Pol,T.J.R., Cremers,F.P.M., Ropers,H.H., Dörner,C., Monaco,A., Bergen,A.A.B., Lebo,R., Warburg,M., Zergollern,L., Lorenz,B., Gal,A., Bleeker-Wagemakers,E.M. and Meitinger,T. (1992) Isolation of a candidate gene for Norrie disease by positional cloning. Nature Genet., 1, 199-203. MEDLINE Abstract

33 Craxton,M. (1993) Cosmid sequencing. Methods Mol. Biol., 23, 149-167. MEDLINE Abstract

34 Dear,S., Staden,R. (1991) A sequence assembly and editing program for efficient management of large projects. Nucleic Acids Res., 19, 3907-3911. MEDLINE Abstract

35 Altschul,S.F., Gish,W., Miller,W., Myers,E.W. and Lipman,D.J. (1990) Basic local alignment search tool. J. Mol. Biol., 215, 403-410. MEDLINE Abstract

36 Pearson,W.R., Lipman,D.J. (1988) Improved tools for biological sequence comparison. Proc. Natl Acad. Sci. USA, 85, 2444-2448. MEDLINE Abstract

37 Uberbacher,E.C., Mural,R.J. (1991) Locating protein-coding regions in human DNA sequences by a multiple sensor-neural network approach. Proc. Natl Acad. Sci. USA, 88, 11261-11265. MEDLINE Abstract

38 Thomas,A., Skolnick,M.H. (1994) A probabilistic model for detecting coding regions in DNA sequences. IMA J. Math. Appl. Med. Biol., 11, 149-60:

39 Huang,X. (1994) On global sequence alignment. Comput. Appl. Biosci., 10, 227-235. MEDLINE Abstract

40 Berger,W., van de Pol,D., Warburg,M., Gal,A., Bleeker-Wagemakers,L., de Silva,H., Meindl,A., Meitinger,T., Cremers,F. and Ropers,H.H. (1992) Mutations in the candidate gene for Norrie disease. Hum. Mol. Genet., 1, 461-465.&form=6&uid=93338435&Dopt=r">MEDLINE Abstract

NOTE ADDED IN PROOF

In a directly flanking cosmid (ICRFB0972), we have recently identified novel exons by shotgun cosmid sequencing and screening of the retina cDNA library. These exons correspond to the 5' and middle part of the gene described here. Sequence comparison revealed homology to the human RCC1 gene [Ohtsubo et al. (1987) Genes Dev. 1, 585-593] and SSCP analysis in our patients detected several bandshifts and at least one non-conservative (Pro -> Ser) amino acid substitution which were not observed in 80 control males.

*To whom correspondence should be addressed

This page is maintained by OUP admin. Last updated Thu Oct 31 15:24:35 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Arch OphthalmolHome page
S. Walia, G. A. Fishman, A. Swaroop, K. E. H. Branham, M. Lindeman, M. Othman, and R. G. Weleber
Discordant Phenotypes in Fraternal Twins Having an Identical Mutation in Exon ORF15 of the RPGR Gene
Arch Ophthalmol, March 1, 2008; 126(3): 379 - 384.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
L. S. Sullivan, S. J. Bowne, D. G. Birch, D. Hughbanks-Wheaton, J. R. Heckenlively, R. A. Lewis, C. A. Garcia, R. S. Ruiz, S. H. Blanton, H. Northrup, et al.
Prevalence of disease-causing mutations in families with autosomal dominant retinitis pigmentosa: a screen of known genes in 200 families.
Invest. Ophthalmol. Vis. Sci., July 1, 2006; 47(7): 3052 - 3064.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
A Melamud, G-Q Shen, D Chung, Q Xi, E Simpson, L Li, N S Peachey, H Zegarra, S A Hagstrom, Q K Wang, et al.
Mapping a new genetic locus for X linked retinitis pigmentosa to Xq28.
J. Med. Genet., June 1, 2006; 43(6): e27 - e27.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
P. A. Ferreira
Insights into X-linked retinitis pigmentosa type 3, allied diseases and underlying pathomechanisms
Hum. Mol. Genet., October 15, 2005; 14(suppl_2): R259 - R267.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
X. Lu and P. A. Ferreira
Identification of Novel Murine- and Human-Specific RPGRIP1 Splice Variants with Distinct Expression Profiles and Subcellular Localization
Invest. Ophthalmol. Vis. Sci., June 1, 2005; 46(6): 1882 - 1890.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
A Iannaccone, D K Breuer, X F Wang, S F Kuo, E M Normando, E Filippova, A Baldi, S Hiriyanna, C B MacDonald, F Baldi, et al.
Clinical and immunohistochemical evidence for an X linked retinitis pigmentosa syndrome with recurrent infections and hearing loss in association with an RPGR mutation
J. Med. Genet., November 1, 2003; 40(11): e118 - 118.
[Full Text] [PDF]

Home page
 Hum Mol GenetHome page
P. Castagnet, T. Mavlyutov, Y. Cai, F. Zhong, and P. Ferreira
RPGRIP1s with distinct neuronal localization and biochemical properties associate selectively with RanBP2 in amacrine neurons
Hum. Mol. Genet., August 1, 2003; 12(15): 1847 - 1863.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
I Zito, S M Downes, R J Patel, M E Cheetham, N D Ebenezer, S A Jenkins, S S Bhattacharya, A R Webster, G E Holder, A C Bird, et al.
RPGR mutation associated with retinitis pigmentosa, impaired hearing, and sinorespiratory infections
J. Med. Genet., August 1, 2003; 40(8): 609 - 615.
[Full Text]

Home page
 Hum Mol GenetHome page
U. Schwahn, N. Paland, S. Techritz, S. Lenzner, and W. Berger
Mutations in the X-linked RP2 gene cause intracellular misrouting and loss of the protein
Hum. Mol. Genet., May 1, 2001; 10(11): 1177 - 1183.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
R. Roepman, N. Bernoud-Hubac, D. E. Schick, A. Maugeri, W. Berger, H.-H. Ropers, F. P.M. Cremers, and P. A. Ferreira
The retinitis pigmentosa GTPase regulator (RPGR) interacts with novel transport-like proteins in the outer segments of rod photoreceptors
Hum. Mol. Genet., September 1, 2000; 9(14): 2095 - 2105.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (29)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Roepman, R.
Right arrow Articles by Berger, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roepman, R.
Right arrow Articles by Berger, W.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?