Recessively inherited L-DOPA-responsive parkinsonism in infancy caused by a point mutation (L205P) in the tyrosine hydroxylase gene
Recessively inherited L-DOPA-responsive parkinsonism in infancy caused by a point mutation (L205P) in the tyrosine hydroxylase geneBarbara Lüdecke1, Per M. Knappskog2,3, Peter T. Clayton4, Robert A. H. Surtees4, James D. Clelland4, Simon J. R. Heales5, Michael P. Brand5, Klaus Bartholomé1 and Torgeir Flatmark2,*
1University Children's Hospital, 44791 Bochum, Germany, 2Department of Biochemistry and Molecular Biology, University of Bergen, 5009 Bergen, Norway, 3Department of Medical Genetics, University of Bergen, 5021 Bergen, Norway, 4Hospital for Sick Children, Great Ormond Street, Institute of Child Health, London WC1N 1EH, UK and 5Institute of Neurology, London WC1N 3BG, UK
Received March 8, 1996;Revised and Accepted April 18, 1996
Tyrosine hydroxylase (TH) catalyzes the conversion of L-tyrosine to L-dihydroxyphenylalanine (L-DOPA), the rate-limiting step in the biosynthesis of dopamine. This report describes a missense point mutation in the human TH (hTH) gene in a girl presenting parkinsonian symptoms in early infancy and a very low level of the dopamine metabolite homovanillic acid in the CSF. DNA sequencing revealed a T614-to-C transition in exon 5 (L205P). Both parents and the patient's brother are heterozygous for the mutation. Site-directed mutagenesis and expression in different systems revealed that the recombinant mutant enzyme had a low homospecific activity, i.e. ~1.5% of wt-hTH in E.coli and ~16% in a cell-free in vitro transcription-translation system. When transiently expressed in human embryonic kidney (A293) cells a very low specific activity (~ 0.3% of wt-hTH) and immunoreactive hTH (<2%) was obtained. The expression studies are compatible with the severe clinical phenotype of the L205P homozygous patient carrying this recessively inherited mutation. Treatment with L-DOPA resulted in normalisation of the CSF homovanillic acid concentration and a sustained improvement in parkinsonian symptoms.
Tyrosine hydroxylase (TH, EC 1.1.16.2) catalyzes the conversion of L-tyrosine to L-dihydroxyphenylalanine (L-DOPA) in a tetra- hydrobiopterin-dependent monooxygenase reaction, the rate-limiting step in the biosynthesis of dopamine and nor- adrenaline/adrenaline. Recently, we described a point mutation in the highly conserved exon 11 of human TH (hTH-Q381 K) in a family of two siblings suffering from a typical form of progressive L-DOPA-responsive dystonia (DRD), representing the first reported mutation in this gene (1 ,2 ). The patients were characterized by a clinical onset in the first decade with moderate extrapyramidal symptoms and a dramatic positive therapeutic response to low-dose L-DOPA therapy. The clinical course and diurnal fluctuations suggested a decrease in the synthesis of dopamine (DA) in the nigrostriatal dopaminergic neurons and DA release in the basal ganglia, which has actually been observed by a combined histochemical, immunochemical and enzyme activity study in an autopsied case of DRD (3 ) demonstrating similar clinical symptoms of dysfunctional dopaminergic neurons.
In the present study we describe a 3 month old girl whose major neurological symptoms are characteristic of parkinsonism, and in addition symptoms of a dysfunction of specific sympathetic neurons in the peripheral nervous system (ptosis) was observed. The biochemical analyses are compatible with a markedly reduced biosynthesis of dopamine in the CNS due to a deficient function of the tyrosine hydroxylase enzyme system, and the symptoms were dramatically responsive to L-DOPA therapy. The parkinsonian symptoms were found to be associated with a missense point mutation (L205P) in the TH gene. When the mutant enzyme was expressed in three different systems a `residual activity' of ~0.3% was obtained in human embryonic (A293) cells, ~1.5% in E.coli and ~16% in a cell-free invitro transcription-translation system as well as an additional markedly decreased stability when expressed in A293 cells. Thus, all the properties of the recombinant mutant enzyme are compatible with the severe clinical phenotype of the L205P homozygous patient carrying this recessively inherited mutation.
The patient was the second child of healthy, unrelated Greek parents. The pregnancy was uncomplicated but the mother noted that fetal movements were weaker than those of her first child. She was born at term (birth weight 2.8 kg) by Caesarean section performed because of fetal distress. At the age of 3 months, her main symptoms were brief jerky movements affecting usually the upper limbs but occasionally the lower limbs. An EEG was reported as showing a `non-specific generalised dysrhythmia', CT and MRI scans were normal as was the routine biochemistry. The infant went on to develop generalised rigidity with very little spontaneous movement and continuing involuntary jerky movements. There was no diurnal variability in the symptoms. At the age of 6 months examination revealed an expressionless face, ptosis and drooling. The infant could fix her eyes and follow slowly through 30o. Tongue movements were tremulous. She lay in a frog-like position and had severe head lag and trunkal hypotonia. Tone in the limbs was variable and of cogwheel type. There was a constant tremor most marked in the upper limbs. There were occasional myoclonic jerks. There were no antigravity movements in any limb and deep tendon reflexes were reduced. There were persistent asymmetric tonic neck and Moro reflexes. Ocular instillation of 2.5% (w/v) phenylephrine led to a dramatic improvement in the infant's ptosis.
Analyses of the cerebrospinal fluid (CSF) revealed a very low level of the dopamine metabolite homovanillic acid, HVA (2.8 SD below the mean for age-matched controls). Reduced dopamine synthesis leading to a low CSF concentration of HVA can occur as a result of disordered pterin synthesis or recycling or as a result of aromatic aminoacid decarboxylase (AADC) deficiency or, in theory, it could result from isolated deficiency of tyrosine hydroxylase. Disorders of pterin synthesis lead to a reduction in the total blood biopterin concentration, and disordered recycling is associated with reduced activity of dihydro- pteridine reductase in blood. Both types of pterin disorder may lead to alterations in the CSF concentrations of neopterin, dihydrobiopterin and tetrahydrobiopterin. Pterin disorders also lead to impaired activity of phenylalanine hydroxylase and hence to hyperphenylalaninemia. Pterin disorders and aromatic aminoacid decarboxylase deficiency lead to reduced synthesis of serotonin and its metabolite, 5-hydroxyindolacetic acid (5-HIAA). AADC deficiency leads to the accumulation of L-DOPA and its metabolites, 3-methoxytyrosine and vanillacetic acid and also to accumulation of 5-hydroxytryptophan. As indicated in Table 2 , none of these additional abnormalities was present in our patient (all results fell within the normal range for age-matched controls). The results were therefore not suggestive of a pterin disorder or of AADC deficiency but could be explained by isolated tyrosine hydroxylase deficiency.
Treatment with L-DOPA/carbidopa (4:1, w/w) was commenced. A moderate dose of L-DOPA (2 mg/kg body weight given 5 times daily) resulted in normalisation of the CSF HVA concentration (Table 1 ) and a marked and sustained improvement in the hypokinesia and other parkinsonian symptoms. At the age of 3 years she has mild motor delay (with minimal gait ataxia) and mild speech delay.
. Oligonucleotides used for amplification of genomic DNA and PCR-based mutagenesis
Primer
Application
Positiona
Sequence (5'-3')
5A1
Genomic
CTGCCCTCAGGGCTTCTCGGA
5A2
Sequencing
CGGAGTCTGGGTCCCGAGCGC
5B
Genomic
AGGTCTCACCAGGTGGCAATC
A205P
Mutagenesis
601-618
CAGCGCAGGCCGAT
B
Mutagenesis
933-952
CTGCCCATTCCTCATGTAGA
ACGCGTGGCGGATATACTGG
C
Mutagenesis
310-328
GAGACGTTTGAAGCCAAAA
D
Mutagenesis
Primer Bb
CTGCCCATTCCTCATGTAGA
aThe numbers given refer to the cDNA positions (4). bPrimer D is identical to the 20 first nucleotides of primer B. We have used Met instead of Val in codon 81. Both codons are reported at equal frequencies among normal individuals (24).
The hTH gene has 13 exons (4 ). Exons 3, 4, 5, 6, 7, 9, 10, 11 and 12 were PCR amplified from genomic DNA and the primers used for exon 5 are given in Table 2 . Sequencing of the 630 bp PCR product revealed a T614-to-C transition causing an amino acid substitution of leucine in codon 205 with proline (Fig. 1 ) positioned in a putative [alpha]-helical region based on the amino acid sequence and the algorithm for prediction of secondary structure (5 ) (see Discussion). The sequencing of the other exons did not reveal any other mutations.
In the present report we describe a recessively inherited point mutation in the hTH gene in a girl presenting, in addition to severe parkinsonian symptoms in early infancy, symptoms of a dysfunction of specific sympathetic neurons in peripheral nervous system (ptosis). Thus, in contrast to the typical forms of DRD (6 ) both dopaminergic and noradrenergic neurons seem to be affected in this patient. The biochemical analyses of the cerebrospinal fluid are compatible with a markedly reduced synthesis of DA in the CNS (very low level of the DA metabolite homovanillic acid) due to a deficient function of the tyrosine hydroxylase enzyme system. The biosynthetic pathway of tetrahydrobiopterin (including the GTP-cyclohydrolase activity) and the dihydropteridine reductase activity were normal based on a normal or slightly elevated level of tetrahydrobiopterin as well as an increased ratio of reduced/oxidized cofactor in the cerebrospinal fluid (Table 1 ). The severe symptoms are compatible with the enzymatic phenotype of the L205P mutant form of hTH when expressed in three different systems. The recombinant mutant enzyme revealed a `residual activity' of 0.3 to 16% of the wild-type hTH1 in three complementary expression systems in addition to a decreased stability on transient expression in A293 cells. The differences observed in homospecific activity are of the same order of magnitude as recently observed in our expression studies on mutant forms of the structurally and functionally related enzyme phenylalanine hydroxylase (7 ,8 ). The differences between the expression systems can in both cases be explained by a variable degree of proteolysis of mutant enzymes in E. coli (9 ) and A293 cells (7 ,8 ), whereas the enzyme produced in the coupled in vitro system avoids this problem. Thus, the very low activity of the L205P mutant enzyme in A293 cells is mainly explained by an increased cytosolic degradation of hTH as revealed by the low recovery of immunoreactive enzyme. A reduced stability and catalytic activity of the L205P mutant enzyme was expected since proline is generally considered to be a helix-breaking residue in soluble proteins. Substitution of a leucine residue in an [alpha]-helical region by a proline, as in the present mutation, is expected to drastically change the structure and catalytic function of the enzyme (10 ).
The expression of L205P mutant hTH resulted in a heterogeneous product both in E. coli (Fig. 2 ) and by the in vitro transcription-translation system (Fig. 3 b) on SDS/PAGE. The difference in apparent molecular mass of 2-3 kDa in the in vitro system, also observed for the wild-type enzyme, can be explained by the presence of a second initiation site, i.e. at codon 30 (AUG), which has been reported for another enzyme expressed in the same system (11 ). Initiation at this site would result in the formation of a truncated gene product in which a 2578 Da peptide is deleted from the N-terminus. This heterogeneity was not observed for the wild-type hTH expressed in A293 cells (Fig. 2 , lane 5).
As in the patients with DRD (2 ,6 ) all the symptoms of our patient were dramatically responsive to daily L-DOPA therapy. A moderate dose of L-DOPA (2 mg/kg body weight given 5 times daily) resulted in an optimal and sustained clinical response. The CSF homovanillic acid concentration rose from the very low pretreatment level to within the normal range (Table 1 ).
The two mutations in hTH discovered so far represent quite different clinical and metabolic phenotypes. However, the severity of the disease correlates well with the measured residual TH activity, causing juvenile DRD in the Q381K mutation (2 ) and early childhood parkinsonism in the L205P mutation (present study). This difference is similar to that observed for mutations in the gene encoding phenylalanine hydroxylase causing persistent hyperphenylalaninemias, but with a marked heterogeneity of metabolic and clinical phenotypes (12 ). The severe phenotype of our L205P mutation is close to a null mutation, since the child barely survived the perinatal period. Thus, a null mutation in the TH locus has been shown to be lethal at the late embryonic stage in mice (13 ).
The analytical techniques used for the investigation of suspected inborn errors of neurotransmitter, amine and pterin metabolism have been described previously (14 -17 ).
Exons 3, 4, 6, 7, 9, 10, 11 and 12 of the hTH gene were PCR amplified from genomic DNA. Three hundred ng of each pair of primers was added to 1 [mu]g DNA and 2.5 U Taq polymerase (Perkin Elmer) in a total volume of 100 [mu]l containing 200 [mu]M dNTPs, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 and 0.001% (w/v) gelatine. The reaction parameters were 94oC for 6 min, then 95oC for 50 s, 69oC for 45 s and 72oC for 3.45 min for 33 cycles, followed by a 13 min extension at 73oC. Exon 5 was amplified using the 5A1 and 5B primers (Table 2 ). The 630 bp PCR product was sequenced by the dideoxy chain termination method of Sanger with the oligonucleotide 5 A2 (Table 2 ), using the T7 DNA polymerase (Sequenase, USB).
The L205P mutation was introduced into the wild-type hTH1 cDNA by PCR-based site specific mutagenesis as described (2 ,18 ,19 ). The primers are given in Table 2 . The target sequence for the mutagenesis was BstEII/MluI restriction fragment of the hTH1 cDNA. Positive clones, identified by the loss of a AluI restriction site, were sequenced (Taq DyeDeoxy Terminator Cycling Sequencing Kit 373A automatic DNA sequencer, Applied Biosystems) to verify the introduction of the L205P mutation and to exclude other mutations due to Taq DNA polymerase (Boehringer Mannheim) misincorporation.
The wild-type and mutant (L205P) hTH1 were expressed in E.coli using the pET3a-hTH1 expression vector (20 ) and purified essentially as described (2 ).
Coupled in vitro transcription-translation of wild-type and mutant (L205P) hTH1 were carried out essentially as described (2 ) using the pET3a-hTH1 vector (20 ) and the TnT-T7 reticulocyte lysate system (Promega).
For transient eukaryotic expression of hTH1 the strong eukaryotic CMV promoter (21 ) was cloned into the pET3a-hTH1 vector (20 ). The BamHI/BglII fragment of the pcDNA3 vector (Invitrogen), containing the CMV promotor region, was cloned into the BglII site of the pET3a-hTH1 vector. The human kidney cell line A293 (22 ) was transfected with wild-type and mutant vector DNA using lipofectamine (GIBCO-BRL) as described by the manufacturer. Cells were harvested after 40 h and kept at -80oC until used. The cells were lysed by sonication in a 20 mM Tris-HCl buffer (pH 7.4) containing 0.2 mM PMSF and centrifuged (15 000 * g, 15 min). The supernatant was used for assay of enzyme activity and immunoblotting.
hTH expressed in human embryonic kidney (A293) cells were immunoisolated using Dynabeads M-280 (Dynal A.S.) coated sequentially with sheep anti-rabbit IgG and affinity-purified rabbit anti-hTH 1, essentially as described by the manufacturer. SDS/PAGE at 180 V (2 h) in a 10 % (w/v) polyacrylamide gel and immunoblotting was performed using affinity-purified rabbit-anti hTH1 (1.6 [mu]g/ml). The enhanced chemiluminescence (ECL) system from Amersham was used for the immunodetection. The immunoreactivity was quantitated by densiometric scanning of the autoradiograms (Ultroscan XL laser densiometer from Pharmacia). Different exposure times (10 s to 5 min) and different protein concentrations were used to obtain the most linear concentration range of the densitometric peak integrals.
Total RNA was purified from A293 cells and E.coli cells expressing wild-type and mutant hTH using the RNEasy kit (Qiagen). Approximately 8 [mu]g of total RNA was transferred to a Hybond N membrane (Amersham) by a Schleicher & Schüll slot-blot apparatus and crosslinked to the membrane by UV-light. Random priming (Megaprime kit, Amersham) labelled probes were used sequentially after stripping the filters in 0.1% (w/v) SDS/2 mM EDTA for 15 min at 95oC. Slot blot analyses were first performed with the hTH cDNA probe, then stripped and rehybridized with the GAP cDNA probe. Hybridization, washing and stripping of the filter was carried out as described (7 ). Probes were purified cDNA fragments from the pET3a-hTH1 clone. The GAP cDNA clone (23 ) was used as an internal control (constitutively expressed protein). For quantitation of hybridizing RNA, the filter was exposed to a B-scanner (Packard Instant Imager) for 1-4 h.
TH activity was assayed at 25oC with 500 [mu]M tetrahydrobiopterin and 35 [mu]M L-tyrosine at pH 7.0 (2 ). The amount of product was linear with time and amount of enzyme added at the selected assay conditions.
We thank Randi M. Svebak for expert technical assistance. This work was supported by grants from the Deutsche Forschungsgemeinschaft, grant Ba 385/121 (K.B. and B.L.) and from the Research Council of Norway, Rebergs legat, the Novo Nordisk Foundation, the Nansen Fund, the Norwegian Council on Cardiovascular Diseases, the European Commission (T.F.). We are also grateful to the following organisations for financial support: The Wellcome Trust (R.A.H.S.), Leukaemia Research Fund (J.C.), Brain Research Trust (M.P.B.) and the Worshipful Company of Pewterers (S.J.R.H.). We are indebted to Dr R. Leeming and Dr K. Hall for assays of whole blood biopterin and dihydropteridine reductase activity.
1 Lüdecke, B., Dworniczak, B. and Bartholomé, K. (1995) A point mutation in the tyrosine hydroxylase gene associated with Segawa's syndrome. Hum. Genet., 93, 123-125. MEDLINE Abstract
2 Knappskog, P.M., Flatmark, T., Mallet, J., Lüdecke, B. and Bartholomé, K. (1995) Recessively inherited L-DOPA-responsive dystonia caused by a point mutation (Q381K) in the tyrosine hydroxylase gene. Hum. Mol. Genet., 4,1209-1212. MEDLINE Abstract
3 Rajput, A.H., Gibb, E.R. and Zhong, X.H. (1994) Dopa-responsive dystonia: Pathological and biochemical observation in a case. Annal. Neurol., 35,396-402. MEDLINE Abstract
4 Grima, B., Lamouroux, A., Boni, C., Julien, J.-F., Javoy-Agid, F. and Mallet, J. (1987) A single human gene encoding multiple tyrosine hydroxylases with different predicted functional characteristics. Nature, 326,707-711. MEDLINE Abstract
5 Kyte, J. and Doolittle, R.F. (1982) A simple method for displaying the hydropathic character of a protein. J.Mol. Biol., 157,105-132.
6 Segawa, M. and Nomura, Y. (1993) Hereditary progressive dystonia with marked diurnal fluctuations. Pathophysiological importance of the age of onset. Advan. Neurol., 60,568-576.MEDLINE Abstract
7 Eiken, H.G., Knappskog, P.M., Apold, J. and Flatmark, T. (1996) PKU mutation G46S is associated with increased aggregation and degradation of the phenylalanine hydroxylase enzyme. Hum. Mutat. 4, 228-238.
8 Knappskog, P.M., Eiken, H.G., Martínez, A., Bruland, O., Apold, J. and Flatmark, T. (1996) PKU mutation (D143G) associated with an apparent high residual enzyme activity: Expression of a kinetic variant form of phenylalanine hydroxylase in three different systems. Hum. Mutat. in press.MEDLINE Abstract
9 Martínez, A., Knappskog, P.M., Olafsdottir, S., Døskeland, A.P., Eiken, H.G., Svebak, R.M., Bozzini, M.L., Apold, J. and Flatmark, T. (1995) Expression of recombinant human phenylalanine hydroxylase as fusion protein in E. coli circumvents proteolytic degradation by host cell proteases. Isolation and characterization of the wild-type enzyme. Biochem. J. 306,589-597.MEDLINE Abstract
10 Dahlman-Wright, K., Baumann, H., McEwan, I.J., Almlof, T., Wright, A.P., Gustafsson, J.A. and Hard, T. (1995) Structural characterization of a minimal functional transactivation domain from the human glucocorticoid receptor. Proc. Natl. Acad. Sci. USA 92, 1699-1703.MEDLINE Abstract
11 Rootwelt, H., Berger, R., Gray, G., Kelly, D.A., Coskun, T. and Kvittingen, E.A. (1994) Novel splice, missense, and nonsense mutations in the fumarylacetoacetase gene causing tyrosinemia type 1. Am. J. Hum. Genet., 55,653-658.MEDLINE Abstract
12 Okano, Y., Eisensmith, R.C., Güttler, F., Lichter-Konecki, U., Konecki, D.S., Trefz, F.K., Dasovich, M., Wang, T., Henriksen, K., Lou, H. and Woo, S.L.C. (1991) Molecular basis of phenotypic heterogeneity in phenylketonuria. N. Engl. J. Med. 324, 1232-1238.
13 Kobayashi, K., Morita, S., Sawada, H., Mizuguchi, T., Yamada, K., Nagatsu, I., Hata, T., Watanabe, Y., Fujita, K. and Nagatsu, T. (1995) Targeted disruption of the tyrosine hydroxylase locus results in severe catechoamine depletion and perinatal lethality in mice. J. Biol. Chem.270, 27235-27243. Kobayashi, K., Morita, S., Sawada, H., Mizuguchi, T., Yamada, K., Nagatsu, I., Hata, T., Watanabe, Y., Fujita, K. and Nagatsu, T. (1995) Targeted disruption of the tyrosine hydroxylase locus results in severe catechoamine depletion and perinatal lethality in mice. J. Biol. Chem.270, 27235-27243. MEDLINE Abstract
14 Hyland, K., Smith, l., Howells, D.W., Clayton, P.T. and Leonard, J.V. (1985) The determination of pterins, biogenic amine metabolites and aromatic amino acids in cerebrospinal fluid using isocratic reverse phase liquid chromatography with in series dual cell coulometric and fluorescence detection. Use in the study of inborn errors of dihydrpteridine reductase and 5,10-methylene tetrahydrofolate reductase. In Wachter, H., Curtius, H.-Ch. and Pfleiderer, W. (eds.) Biochemical and Clinical Aspects of Pteridines., 4, 85-99.
15 Hyland, K., Surtees, R.A.H., Rodeck, C. and Clayton, P.T. (1992) Aromatic L-amino acid decarbocylase deficiency: Clinical features, diagnosis, and treatment of a new inborn error of neurotransmitter amine synsthesis. Neurology, 42, 1980-1988. MEDLINE Abstract
16 Hyland, K. and Clayton, P.T. (1992) Aromatic L-amino acid decarboxylase deficiency: diagnostic methodology. Clin. Chem., 38, 2405-2410. MEDLINE Abstract
17 Hyland, K., Surtees, R.A., Heales, S.J., Bowron, A., Howells, D.W. and Smith, .S.O. (1993) Cerebrospinal fluid concentrations of pterins and metabolites of serotonin and dopamine in a pediatric reference population. Pediatr. Res. 34, 1014. MEDLINE Abstract
18 Nelson, R.M. and Long, G.L. (1989) A general method of site-specific mutagenesis using a modification of the Thermus aquaticus polymerase chain reaction. Anal. Biochem., 180, 147-151. MEDLINE Abstract
19 Knappskog, P.M., Eiken, H.G., Martínez, A., Olafsdottir, S., Haavik, J., Flatmark, T. and Apold, J. (1993) Expression of wild type and mutant forms of human phenylalanine hydroxylase. Adv. Exp. Med. Biol.,338, 59-62.
20 Le Bourdelles, B., Horellou, P., Le Caer, J.-P., Denefle, P., Latta, M., Haavik, J., Guibert, B., Mayaux, J.-F. and Mallet, J. (1991) Phosphorylation of human recombinant tyrosine hydroxylase isoform 1 and 2. An additional phosphorylated residue in TH2 isoform, generated through alternative splicing. J.Biol. Chem., 266,17124-17130.
21 Boshart, M., Weber, F., Jahn, G., Dorsch-Hasler, K., Fleckenstein, B. and Schaffner, W. (1985) A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell, 41, 521-530. MEDLINE Abstract
22 Graham, F.L., Smiley, J., Russel, W.C. and Nairn, R. (1977) Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J.Gen. Virol., 36, 59-72.
23 Tso, J.Y., Sun, X.H., Kao, T.H., Reece, K.S. and Wu, R. (1985) Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogranse cDNAs: Genomic complexity and molecular evolution of the gene. Nucleic Acids Res., 13,2485-2502. MEDLINE Abstract
24 Lüdecke, B. and Bartholomé, K. (1995) Frequent sequence variant in the human tyrosine hydroxylase gene. Hum. Genet.,95, 716.
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Thu Oct 31 15:25:15 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
