Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11
Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11P. H. Vogt1,*, A. Edelmann1, S. Kirsch1, O. Henegariu1, P. Hirschmann1, F. Kiesewetter2, F. M. Köhn3, W. B. Schill3, S. Farah4, C. Ramos4, M. Hartmann5, W. Hartschuh5, D. Meschede6, H. M. Behre7, A. Castel7, E. Nieschlag7, W. Weidner8, H-J. Gröne9, A. Jung3, W. Engel10 and G. Haidl11
1Section Molecular Human Genetics, Institute of Human Genetics, University of Heidelberg, D-69120 Heidelberg, Germany, 2Department of Andrology, University of Erlangen, D-91052 Erlangen, Germany, 3Center Dermatology and Andrology, University of Giessen, D-35385 Giessen, Germany, 4Genetica Humana, Universidade Estadual de Campinas, 13100 Campinas SP, Brasilia, 5Department of Andrology, University of Heidelberg, D-69115 Heidelberg, Germany, 6Institute of Human Genetics, University of Münster, D-48129 Münster, Germany, 7Institute of Reproductive Medicine, University of Münster, D-48147 Münster, Germany, 8Department of Urology, Medical Center of the University of Giessen, D-35385 Giessen, Germany, 9Medical Center Pathology of the University of Marburg, D-35043 Marburg, Germany, 10Institute of Human Genetics, University of Göttingen, D-37073 Göttingen, Germany and 11Department of Andrology, University of Bonn, D-53105 Bonn, Germany
Received March 12, 1996;Revised and Accepted April 12, 1996
In a large collaborative screening project, 370 men with idiopathic azoospermia or severe oligozoospermia were analysed for deletions of 76 DNA loci in Yq11. In 12 individuals, we observed de novo microdeletions involving several DNA loci, while an additional patient had an inherited deletion. They were mapped to three different subregions in Yq11. One subregion coincides to the AZF region defined recently in distal Yq11. The second and third subregion were mapped proximal to it, in proximal and middle Yq11, respectively. The different deletions observed were not overlapping but the extension of the deleted Y DNA in each subregion was similar in each patient analysed. In testis tissue sections, disruption of spermatogenesis was shown to be at the same phase when the microdeletion occurred in the same Yq11 subregion but at a different phase when the microdeletion occurred in a different Yq11 subregion. Therefore, we propose the presence of not one but three spermatogenesis loci in Yq11 and that each locus is active during a different phase of male germ cell development. As the most severe phenotype after deletion of each locus is azoospermia, we designated them as: AZFa, AZFb and AZFc. Their probable phase of function in human spermatogenesis and candidate genes involved will be discussed.
Genes for male germ cell development are present on the Y chromosome in different species groups (1 -3 ). In men, the position of a spermatogenesis locus was mapped in the euchromatic part of the long Y arm (Yq11). It was called `azoospermia factor' (AZF), as the first six men observed with terminal deletions in Yq were azoospermic (4 ). Mature sperm cells were not detectable in their seminal fluid. In all cases, the Y deletions included the large heterochromatin block of the long Y arm (Yq12) and an undefined amount of the adjacent euchromatin (Yq11). Subsequently, the presence of AZF in Yq11 was confirmed by numerous studies at both cytogenetic (5 ) and molecular level (6 -8 ). However, the genetic complexity of AZF could not be revealed by these analyses.
This first became possible by the detection of sterile patients with small interstitial deletions (i.e. microdeletions) in Yq11. In a study with 13 sterile men suffering from idiopathic azoospermia two different microdeletions in Yq11 were observed (9 ). They were mapped to two non overlapping positions in Yq11 interval 6 (10 ). However, further studies of Yq11 microdeletions associated to the phenotype of male sterility, only confirmed the position of an AZF locus in distal Yq11 (11 ,12 ). The most extensive study was performed by Reijo et al. (13 ) on 89 sterile men with idiopathic azoospermia. Deletion analysis of a large series of STS loci detected microdeletions in Yq11 in nine cases. They all overlapped and contained a common interval in distal Yq11, defined then as the AZF region (13 ). In order to clarify whether the genetic complexity of AZF is indeed represented by only one spermatogenesis locus in distal Yq11, we decided to perform a molecular deletion analysis of small interstitial deletions in Yq11 on a large series of patients (370 individuals) including not only idiopathic sterile men with non-obstructive azoospermia, but also men with severe oligozoospermia (<2 million sperm per ml ejaculate). Oligozoospermic individuals with different cytogenetically visible Yq11 anomalies have been repeatedly described in the literature (5 ,14 ,15 ). This investigation was only possible in a large collaborative screening project in which different infertility clinics participated. All sterile individuals were screened for deletions of 76 DNA loci in Yq11. They were mapped to a detailed interval map, subdividing this chromosome region in 25 intervals (D1-D25). A PCR-multiplex procedure was used as a rapid screening protocol (16 ).
Thirteen patients with a microdeletion in Yq11 were detected. They were mapped to three different subregions in Yq11. One subregion (Yq11, D20-D22) coincides to the position of the AZF region in distal Yq11 as described by Reijo et al. (13 ). The second and third deleted Y regions were mapped proximal to it and mapped to proximal (Yq11, D3-D6) and middle Yq11 (Yq11, D13-D16), respectively.
Testicular histology of these patients suggests disruption of spermatogenesis at the same phase when the microdeletion occurred in the same Yq11 subregion but at a different phase when the microdeletion occurred in a different Yq11 subregion. As the three subregions deleted were clearly separated in Yq11 and their associated phases of spermatogenic disruptions were clearly distinguished, this study suggests that human spermatogenesis depends on not one but at least three discrete Y encoded spermatogenesis loci and that each of these loci acts at a different point in this male-specific developmental process. As the most severe phenotype after deletion of each of the loci is `azoospermia', we designated them as azoospermia factors: AZFa, AZFb and AZFc.
The clinical selection of sterile patients with potential deletions of AZF were started by filling in an extensive questionnaire during clinical examination of each patient in the infertility clinics participating in this study. Each patient was asked and examined for potential gonad anomalies, testis volumes, varicoceles, potential epididymal or prostata abnormalities, levels of the hormones follicle-stimulating hormone (FSH), luteinizing hormone (LH) and testosterone and potential testis tumours. Sperms in their ejaculates were analysed for their motility, number and morphology according to the guidelines of the WHO (37 ). A number of patients had undergone removal of a testicular biopsy and so details of their spermatogenic activity were known.
Criteria for including a patient for AZF deletion screening were fulfilled if they had an inconspicuous family history of fertility, small testis with a soft consistency, raised levels of FSH, but normal levels of LH and testosterone and a sperm number of zero (azoospermia) or below 2 million per ml ejaculate (severe oligozoospermia) with or without additional abnormalities of sperm motility or of head morphology clinically described as OAT (Oligo-Astheno-Terato-Zoospermia) syndrome.
This patient group was then asked for analysis of their chromosomes in order to exclude in our molecular study cytogenetically visible chromosome abnormalities known to be associated with sterility (17 ). About 3% of these patients had a 47,XXY karyotype. Another 3% had balanced autosomal translocations [45,XY,- der(13;14)(q10;q10) or 45,XY,der (14;21)- (q10;q10), respectively]. As these karyotypes are known to be associated with sterility (17 ,18 ), these patients were excluded from our molecular analysis. All other patients selected (370 individuals) had a normal 46,XY karyotype.
For a detailed analysis of microdeletions in Yq11, an extensive interval map in Yq11 was established. By analysis of 76 DNA loci in 26 individuals with different Yq11 anomalies, we were able to subdivide this Y region into 25 intervals (Fig. 1 ). Interval D1 defines the pericentromeric Yq11 subregion marked by DNA locus DYS268. Interval D25, marked by DNA locus DYZ2, defines the interval bordering the heterochromatic chromosome part (Yq12). Our patient panel used for this interval map also includes KLARD marking the AZF region in the interval map of Reijo et al. (13 ). Correspondingly, we map this region between Yq11 interval D20 and D22.
Three hundred and seventy men with azoospermia or severe oligozoospermia and a normal karyotype selected for AZF analysis as described above were screened by PCR and DNA blot analysis for potential deletions of 76 DNA loci in Yq11. As a rapid screening protocol for analysis of most DNA loci, we used a PCR multiplex system composed by five different primer mixes described in detail by Henegariu et al. (16 ). Most primers used were selected from the pool of sY sequences published by Vollrath et al. (19 ). Only primers with reliably positive results on normal fertile men were used throughout our PCR experiments. Each deletion analysed was verified by subsequent single primer PCR experiments and if probes of the deleted DNA loci were available, additionally by DNA blot experiments.
Our screening system detects different microdeletions in Yq11 in 13 patients (Fig. 2 ). They are coded as follows: BRA1, ER43, GI2, GI31, H49, H62, H137, H139, H158, HD23, HD25, MÜ2 and MÜ58. Three patients (H49, HD23 and GI31) showed a microdeletion in proximal Yq11 (deletion pattern: pat-I; Fig. 2 a). All three deletions had the same extension including deletion of all DNA loci mapped from Yq11 interval D3 to interval D6. Three patients (BRA1, GI2 and H139) showed a microdeletion in interval D13-D16 in middle Yq11 (deletion pattern: pat-II; Fig. 2 b). Again, all three patients had the same extension of deleted intervals and included all DNA loci mapped from interval D13 to interval D16. Seven patients (ER43, H62, H137, H158, HD25, Mü2 and Mü58) showed a microdeletion in interval D20-D22 in distal Yq11 (deletion pattern: pat-III; Fig. 2 c). The extension of deleted intervals was again the same in all seven patients including all DNA loci from interval D20 to interval D22.
The sterile phenotype of azoospermia or severe oligozoospermia can be associated with a variety of spermatogenic defects ranging from a complete absence of germ cells (Sertoli-Cell-Only-syndrome, SCO; 22 ) to postmeiotic defects in the maturation process of spermatids. As we wanted to analyse whether the spermatogenic defects induced by the deletion events observed in Yq11 are reflected by disruption at specific developmental stages of the patients' spermatogenesis, their testis histology was analysed in a series of tissue sections obtained by testicular biopsies.
We analysed the testis histology of one patient with a microdeletion in proximal Yq11 (patient GI31), of all three patients with a microdeletion in middle Yq11 (patients BRA1, GI2 and H139) and of five patients with a microdeletion in distal Yq11 (patients ER43, H137, H158, HD25 and MÜ2). The two other patients with a microdeletion in proximal Yq11 (patient H49 and HD23) had very small testis volumes (6-8 ml). Therefore, testicular biopsies were not recommended. Two other patients with a microdeletion in distal Yq11 (patient H62 and MÜ58) denied our request for a testicular biopsy.
Three different pictures of testis histology were observed. A Sertoli cell only syndrome (SCO) was observed in patient GI31 (Fig. 3 ). Only Sertoli cells, but no germ cells were visible in all tubules of these testis tissue sections. Two types of SCOs are described in the literature. They are distinguished by the absence of germ cells in each (type I) or in most (type II) testis tubules (23 ). Moreover, testis volumes of patients with SCO type I are usually small (5-10 ml). In patients with a SCO type II, germ cells are observed in a small number of testis tubules and are developed to different stages. These variabilities of germ cell aspects have been explained as degenerative secondary effects occurring after disruption of the postmeiotic sperm maturation process as the primary event (24 ). The primary event of spermatogenic disruption in patients with SCO type I probably occurrs premeiotically before or during the proliferation phase of spermatogonia. This is also indicated by their small testis volumes. Therefore, in order to analyse the primary disruption phase of spermatogenesis in patient GI31, we had to distinguish both SCO types in his testis histology by a quantitative estimation of testis tubules containing residual germ cells. After analysing more then 100 testis tubules in different tissue sections, we were not able to detect any germ cells in any testis tubule. Therefore, we conclude that patient GI31 most likely has a type I SCO and that disruption of his spermatogenesis had already occurred before puberty at the proliferation phase of spermatogonia. This assumption is supported by the low volume of his testis (10 ml).
Molecular mapping of a series of small interstitial deletion events ocurring in the Y chromosome of 13 men with non-obstructive azoospermia or severe oligozoospermia revealed deletions at three different locations in Yq11. No explanation for the patients' infertility were found in their medical records. Therefore, we assume that the Y deletions observed are also causally related to their infertility. This view is supported by the presence of a spermatogenesis locus in Yq11 mapped by cytogenetic deletion analysis 20 years ago. It was termed AZoospermia Factor (AZF) because the Yq11 deletions analysed were found in sterile men with an azoospermic phenotype (4 ). Molecular deletion analysis has confirmed the presence of an AZF locus in Yq11 (6 -8 ) and has recently mapped it to a small interval in distal Yq11 by analysis of overlapping microdeletions (defined then as AZF region; 13 ). One of the patients analysed in this study, with a complete deletion of the AZF region, was patient KLARD, a sterile individual also included in our study (Fig. 1 ). In our interval map, the deletion of KLARD in Yq11 comprises interval D20-D22. Therefore, we conclude that the defined AZF region overlaps with the Y region between interval D20 and interval D22. Seven patients in our study have a complete deletion of the AZF region in distal Yq11.
However, we also analysed two patient groups with Yq11 microdeletions proximal to this AZF region. Such Y deletions were not detected in the patient collective of Reijo et al. (13 ). Twelve of their 89 azoospermic patients had a deletion in Yq11. All of them include a complete deletion of the AZF region in distal Yq11. Considering the lower frequencies of the occurrence of deletions in proximal and middle Yq11 in our series of patients, compared with their occurrence in distal Yq11, the failure of Reijo et al. to detect these deletions may be explained by the lower number of patients in their screening programme (89 vs. 370 sterile individuals in our study). The microdeletions observed were mapped from interval D3 to interval D6 in proximal Yq11 (in three patients) and from interval D13 to interval D16 in middle Yq11 (in three patients) of our interval map (Fig. 1 ). With the resolution of this map, their molecular extensions in both Y regions must be very similar again indicating a large overlap of the deleted Y-DNA in all individuals of each patient group. All patients had an azoospermic phenotype, but different histological pictures in their testis tissue. Deletion of interval D3-D6 in proximal Yq11 was associated to a SCO type I (patient GI31 in Fig. 3 ) suggesting a prepuberal phase of spermatogenic arrest. Deletion of intervals D13-D16 in middle Yq11 was associated to a premeiotic disruption phase at the spermatocyte stage suggesting a maturation arrest of the germ cells at puberty before or during meiosis (patient GI2 in Fig. 3 ). No postmeiotic germ cells were observed in any testis tubules in these cases. This phase is shown in the testicular histology of all three patients in which this mutation event was detected (patients BRA1, GI2 and H139). Although testis tissue sections could not be analysed in the other patients with a microdeletion in proximal Yq11 (patient H49 and HD23) SCO type I in their testis tubules is most likely, because they also had small testis volumes (Table 1 ), indicating a prepubertal phase of spermatogonic arrest.
This view was supported by analysis of the testis histology of patient JOLAR. This patient has been described by us earlier (9 ), but at that time its proximal deletion in Yq11 was explained to be due most likely to a paracentric Yq11 inversion event (10 ). We have included patient JOLAR in the panel of individuals used for creation of our interval map (Fig. 1 ). His microdeletion comprises the same intervals in proximal Yq11 as the microdeletion of patients GI31, H49 and HD23 (Yq11 interval D3-D6; Fig. 1 ). This result does not support our earlier conclusion of a Y chromosomal inversion event but proves the occurrence of microdeletions in the Y chromosome of idiopathic sterile men to be also in proximal Yq11. Therefore, we expect now that the testis histology of patient JOLAR should also be SCO type I. We have now been able to analyse the histology of testis tissue sections of JOLAR quantitatively in more than 100 testis tubules (courtesy of Tim Hargreave, Department of Urology, University of Edinburgh). No germ cells were detected in any of them. Therefore, the histological phenotype of patient JOLAR is considered to be the same as the phenotype of patient GI31, SCO type I. Correspondingly, like patients GI31, H49 and HD23, JOLAR also had low testis volumes (10 ml).
In contrast to the divergence of histological phenotypes observed in testis tissue sections of patients with deletions in distal Yq11, there seems to be no variability in the testis histology of patients with Y deletions in proximal Yq11 or in middle Yq11. We concede that the number of both patient groups is still smaller than the number of patients with deletions in distal Yq11 [seven patients in Reijo et al. (13 ) and five patients in this paper]. Therefore, variability in histological phenotypes could become apparent as more individuals with deletions in proximal and middle Yq11 are described. Nevertheless, the location of the Y deletions associated to both patient groups have distinctly different positions in Yq11 and their extension are the same (by interval mapping) for each patient in both groups. Therefore, we conclude that our study presents distinct evidence of not one but three discrete spermatogenesis loci (at least) in Yq11. As the most severe phenotype after deletion of each loci is `azoospermia', we suggest to designate them as azoospermia factors: AZFa, AZFb and AZFc. The position of AZFc coincides with the position of the AZF region in distal Yq11 as defined by Reijo et al. (13 ). The position of AZFa is mapped in proximal Yq11 (interval D3-D6). The position of AZFb is mapped in middle Yq11 (interval D13-D16).
Assuming a frequency of 10% for occurrence of the phenotype male infertility in human populations, of which 2.7% are azoospermic or severely oligozoospermic for unknown reasons (non-obstructive; 25 ), a mutation rate of 1.1*10-4 for the proposed AZF loci in Yq11 is estimated from the frequency of AZFa,b,c deletions in the idiopathic sterile patient collective of this study. This rate is comparable with the mutation rate of the DMD (Duchenne Muscular Dystrophy) locus (26 ) and STS (STeroid Sulfatase) locus (27 ) (both presenting frequent deletions as major mutation event also) on the X chromosome and about 10 times higher than that usually found in mutation analysis of autosomal genes (28 ).
We confirmed the study of Reijo et al. by also observing divergent histological phenotypes in patients with deletion of AZFc in distal Yq11 (13 ). By extending their study, we noticed that these patients were not only azoospermic, but also severely oligozoospermic (0.1-2 million sperm per ml ejaculate) with or without increased rates of dysmorphic spermheads (Table 1 ). By interval mapping, the molecular extensions of the different Y deletions in distal Yq11 could not be distinguished. Moreover, in one patient (MÜ2) we detect the same deletion in the Y chromosome of his father (MÜ2v). A paternity test by DNA fingerprinting confirmed their family relationship. Again, the extension of the Y deletion of father and sterile son could not be distinguished by interval mapping. Although variable extensions at their border regions cannot yet be excluded, these results indicate a large overlap of the deleted Y DNA in each individual of this patient group including the father of patient MÜ2 (with a complete deletion of the defined AZFc region).
At the moment it is difficult to find a satisfying explanation for the occurrence of azoospermic and oligozoospermic phenotypes associated with the same Y deletion. Together with the divergent histological pictures in the testis tissue sections of this patient group, the observed phenotypes are reminiscent of similar sterile phenotypes caused by degenerative, age-dependent, secondary effects after a reduction of sperm number as the primary effect (SCO type II; 23 ,24 ). As in patients with deletion of the AZFc region in distal Yq11, low amounts of mature sperms can be still present, it is suggested that AZFc gene products are involved in the maturation process of postmeiotic germ cells or sperm. If this holds true, the fertile status of MÜ2v can be explained by a different sperm number of father and son at the procreation time leading to subfertility only in the father but to sterility of the son. Analysing the family history of MÜ2v in more detail we discovered that MÜ2v was indeed 9 years younger than MÜ2 when fathering his son. Unfortunately, we could not prove our hypothesis, because MÜ2v denied evaluation of his present sperm number. We expect that MÜ2v is now azoospermic.
Candidate genes for expression of AZFb are copies of the RBM gene family. This gene family encodes testis specific RNA binding proteins (12 ). In this paper, we can show that most RBM gene copies located in Yq11 were deleted in the Y chromosome of AZFb patients (Fig. 2 b). However, not all RBM gene copies are expected to be functional and most may be pseudogenes (P. Yen, pers. comm.). Two RBM gene copies were isolated as cDNA clones, RBM1 and RBM2 (12 ). We mapped RBM2 outside the AZFb region to Yq11 interval D18. The functional significance of RBM2 is therefore unclear. With RBM1 specific primer pairs (12 ) this gene copy is mapped inside the AZFb region to Yq11 interval D16 (data not shown). Consequently, the RBM1 gene copy is absent in the Y chromosome of patients BRA1, GI2 and H139 (AZFb patients). Therefore, RBM1 is a candidate gene for expression of AZFb. This view gained support due to the fact that RBM1 is transcribed especially in primary spermatocytes (29 ). However, AZFb mutations in exons of RBM1 were not yet found in azoospermic men. Most copies of the pY6H sequence family are also deleted in AZFb patients (Fig. 1 ). This sequence family was isolated, due to its homology to a fertility gene sequence of Drosophila hydei (30 ) expressed in the primary spermatocyte nucleus (31 ). Therefore, it is attractive to speculate about a functional state of conserved sequence elements of pY6H sequences in human spermatocyte nuclei contributing to the expression of AZFb as well.
Candidate genes for expression of AZFc are DAZ (13 ) and SPGY1 (32 ) isolated as cDNA clones. Both genes encode testis specific RNA binding proteins. Their coding sequences suggest a family relationship (32 ). DAZ contains seven tandem repeats of a 72-nucleotide unit (13 ), SPGY1 contains at least 12 tandem repeats of a 72-nucleotide unit with the same consensus sequence as the DAZ repeat unit. Using DAZ and SPGY1 specific primer pairs both were mapped to the AZFc region and found to be deleted completely in all AZFc patients. Gene-specific DAZ or SPGY1 mutations are, however, not yet known.
It is intriguing to note that obviously there exists a functional and structural similarity between DAZ/SPGY1 and RBM genes. All encode testis specific RNA binding proteins and contain a structure with a single RRM (RNA Recognition Motif) domain and a series of near-perfect tandem repeats (RBM1 contains four tandem repeats of a 111-nucleotide unit; 12 ). However, their coding sequences suggest only a family relationship between DAZ and SPGY1, but exclude it to RBM1.
Candidate genes for expression of AZFa are not yet known. Deletion of this locus was found to be associated to SCO type I and to small testis volumes indicating a prepuberal disruption of spermatogenesis. Therefore, it may be interesting to speculate about a functional homology of AZFa to Spy, a mouse Y spermatogenesis locus, active at the differentiation phase of A spermatogonia (33 ). A candidate gene for Spy isUbe1y (34 ), a Y copy of the ubiquitin-activating enzyme E1 located in the proximal part of the long arm of the mouse X chromosome (Ube1x). However, a homologous UBE1 Y copy on the human Y chromosome could not be identified (unpublished results).
The molecular extension of AZFc in distal Yq11 was estimated to be at least 500 kb (13 ). Our own estimation suggests at least 2 Mb due to different duplication events in this Y region (S. Kirsch et al., in preparation). The molecular extensions of the AZFa and AZFb region were roughly estimated between 1 and 3 Mb (35 ). Therefore, the presence of multiple AZFa and more AZFb and AZFc candidate genes cannot be excluded and the possibility exists that the diversity of the sterile phenotypes observed after deletion of AZFc is also due to the presence of more spermatogenesis genes in distal Yq11.
The possibility exists that further AZF loci exists in Yq11 outside the deleted Y intervals, defining the location of AZFa, AZFb and AZFc in this paper. Such Y mutations may occur in the other sterile individuals collected for our AZF mapping study. Although the number of DNA loci which we analysed in Yq11 was extensive (Fig. 1 ), we cannot yet exclude the presence of small deletions and point mutations in other parts of Yq11.
Origin and preparation of DNA probes and STS primer pairs were described in detail previously (16 ,19 ,30 ). Primer pairs used in mix I-V of the PCR multiplex experiments (Fig. 2 ) were mix I: sY84, sY134, sY117, sY102, sY151, sY94, sY88; mix II: sY143, sY157, sY81, sY182, sY147; mix III: sY86, sY105, sY82, Y6HP35pr, Y6PHc54pr, sY153, sY97; mix IV: sY14, sY95, sY127, sY109, sY149; mix V: Y6H34pr, FR15IIpr, Y6HP52pr, Y6D14pr. The primers are ordered by decreasing lengths of their published amplification fragments (16 ) reflected in their different gel positions in Figure 2 . Primer pair Y6H34pr (forward: cacgtcatggtcaaattggttgag; reverse: cagaaggaaccctaaacaagacc) has replaced the original Y6BaH34pr sequences because of a more suitable length of the PCR amplification product (574 bp). The selection rules for the combination of these primer pairs in mix I-V were discussed in detail elsewhere (16 ).
Mapping of AZF candidate genes was done with the following primer pairs:
Individuals with Yq11 anomalies used for creation of the interval map were described earlier (10 ), with the exception of H17, H21, H34, H35, H36, H79, H87, B314, B316 and B324. The karyotypes of H17, H21, H34, H87 were 46,X,idic(Yp). H34 was a mosaic case with 80% X0 cells. The karyotypes of H35, H79 were 46,X,Yq-. H35 was a mosaic case with 18% X0 cells. They will be described in detail elsewhere. DNA samples of B314, B316, B324 were kindly provided by D. Gänshirt-Ahlert (University of Münster) and described as case 1 (B316), case 2 (B324) and case 3 (B314) in the literature (36 ).
Blood samples of 370 infertile patients with non-obstructive azoospermia or severe oligozoospermia (<2 million spermatozoa per ml) were collected in different infertility clinics. Their mode of selection is described above. Their karyotypes were proved to be normal (46,XY) and medical records do not indicate any reason for their infertility.
Interval mapping was performed with all probes listed in Figure 1 , not only by PCR-multiplex analysis, but also with DNA blot analysis as described previously (9 ,30 ). In case of a detected deletion by PCR-multiplex analysis, experiments were repeated by single PCR with primer pairs of the deleted STS loci on a second genomic DNA sample of the patient. The same analysis was done with genomic DNA samples of the patient's father and/or brother(s). Deleted DNA loci analysed by blot analysis were confirmed in a similar way. The genomic DNA loci of the RBM (formerly YRRM; 12 ) gene family were coined RBM1/A-I, because they were analysed with the probe RBM1 (pMK5) kindly provided by H. J. Cooke. For technical reasons, only RBM1/A-F was mapped in Figure 1 . Deletion of RBM1/H and RBM1/I could only be analysed in AZFb patients. In contrast to earlier mapping experiments (12 )we mapped RBM1/G not to Yq11 but to the short arm of the human Y like RBM1/B1and RBM1/D, respectively.
Testicular tissues were immediately fixed in Bouin's fixative: 15 ml picric acid (1.2%), 5 ml formaldehyde (37%) and 1 ml acetic acid glacial (100%) for 2 h. Thereafter, samples were incubated in ethanol (80%) for 8 h and dehydrated in an ethanol gradient and xylol. After embedding in paraffin or parablast, tissue sections were cut with a thickness of 4-5 [mu]m. All sections were stained with hematoxylin and eosin (HE) or Mosson's trichrome stain (MTS).
We thank our colleagues G. Barbi, A. C. Chandley, M. A. Ferguson-Smith, D. Gänshirt-Ahlert, R. A. Pfeiffer, G. Scherer and J. Süß for kindly providing us with genomic DNA samples of patients with cytogenetically visible Yq11 anomalies. For donated probes, we are indebted to N. Affara, H. J. Cooke, U. Müller, G. Scherer, C. Tyler-Smith and J. Weissenbach. We also wish to thank all the patients who have based our AZF mapping analysis by their precious blood samples. Mrs A. Wiegenstein is thanked for excellent photographic assistance and T. Mantamaotiotis for critically improving English grammar and expression. We are indebted to Mrs S. Nieschlag and Mrs K. Vogt for formally revising the manuscript. This study was supported by a grant to P. H. V. from the Bundesministerium für Forschung und Technologie (FE 01KY9104).
1 Williamson, J.H. (1976) The genetics of the Y chromosome. In The Genetics and Biology of Drosophila (Ashburner, M. & Novitski, E. eds). Academic Press, London; Vol. 1B, pp. 667-699.
2 Levy, E.R. and Burgoyne, P.S. (1986) The fate of X0 germ cells in the testes of X0/XY and X0/XY/XYY mouse mosaics: evidence for a spermatogenesis gene on the mouse Y chromosome. Cytogenet. Cell Genet.,42, 208-213.MEDLINE Abstract
3 Burgoyne, P.S. (1991) Y chromosome function in mammalian development. Adv. Dev. Biol.,1, 1-29.
4 Tiepolo, L. and Zuffardi, O. (1976) Localization of factors controlling spermatogenesis in the nonfluorescent portion of the human Y chromsome long arm. Hum. Genet., 34, 119-124.MEDLINE Abstract
5 Sandberg, A.A. (1985) Clinical aspects of Y chromosome abnormalities. In Progress and Topics in Cytogenetics, Vol. 6, part B. Alan R. Liss Inc., New York.
6 Ferguson-Smith, M.A., Affara, N.A. and Magenis, R.E. (1987) Ordering of Y specific sequences by deletion mapping and analysis of X-Y interchange males and females. Development,101 (Suppl.), 41-50.MEDLINE Abstract
7 Andersson, M., Page, D.C., Pettay, D., Subrt, I., Turleau, C., Grouchy, J. and de la Chapelle, A. (1988) Y;autosome translocations and mosaicism in the aetiology of 45,X maleness: assignment of fertility factor to distal Yq11. Hum. Genet., 79, 2-7.MEDLINE Abstract
8 Bardoni, B., Zuffardi, O., Guioli, S., Ballabio, A., Simi, P., Cavalli, P., Grimoldi, M.G., Fraccaro, M. and Camarino, G. (1991) A deletion map of the human Yq11 region: implications for the evolution of the Y chromosome and tentative mapping of a locus involved in spermatogenesis. Genomics, 11, 443-451.MEDLINE Abstract
9 Vogt, P., Chandley, A.C., Hargreave, T.B., Keil, R., Ma, K. and Sharkey, A. (1992) Microdeletions in interval 6 of the Y chromosome of males with idiopathic sterility point to disruption of AZF, a human spermatogenesis gene. Hum. Genet., 89, 491-496.MEDLINE Abstract
10 Ma, K., Sharkey, A., Kirsch, S., Vogt, P., Keil, R., Hargreave, T.B., McBeath, S. and Chandley, A.C. (1992) Towards the molecular localisation of the AZF locus: mapping of microdeletions in azoospermic men within 14 subintervals of interval 6 of the human Y chromosome. Hum. Mol. Genet.,1, 29-33.MEDLINE Abstract
11 Nagafuchi, S., Namiki, M., Nakahori, Y., Kondoh, N., Okuyama, A. and Nakagome, Y. (1993) A minute deletion of the Y chromosome in men with azoospermia. J. Urol., 150, 1155-1157.MEDLINE Abstract
12 Ma, K., Inglis, J.D., Sharkey, A., Bickmore, W.A., Hill, R.E., Prosser, E.J., Speed, R.M., Thomson, E.J., Jobling, M., Taylor, K., Wolfe, J., Cooke, H.J., Hargreave, T.B. and Chandley, A.C. (1993) A Y chromosome gene family with RNA-binding protein homology: Candidates for the azoospermia factor AZF controlling human spermatogenesis. Cell,75, 1287-1295.MEDLINE Abstract
13 Reijo, R., Lee, T-Y., Salo, P., Alagappan, R., Brown, L.G., Rosenberg, M., Rozen, S., Jaffe, T., Straus, D., Hovatta, O., de la Chapelle, A., Silber, S. and Page., D. (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nature Genet., 10, 383-393.MEDLINE Abstract
14 Daniel, A. (1985) Y isochromosomes and rings. In: Progress and topics in cytogenetics, Vol. 6, part B: Clinical aspects of Y chromosome abnormalities (Sandberg A.A. ed.). Alan R. Liss, Inc., New York; pp. 105-135.
15 Vogt, P. (1992) Y chromosome function in spermatogenesis (review). In: Spermatogenesis-Fertilization-Contraception. Molecular, cellular and endocrine events in male reproduction (Nieschlag, E. and Habenicht, U.F., eds). Springer Verlag, New York; Vol. 4, 226-257.
16 Henegariu, O., Hirschmann, P., Kilian, K., Kirsch, S., Lengauer, C., Maiwald, R., Mielke, K. and Vogt, P. (1994) Rapid screening of the Y chromosome in idiopathic sterile men, diagnostic for deletions in AZF, a genetic Y factor expressed during spermatogenesis. Andrologia, 26, 97-106.MEDLINE Abstract
17 Chandley, A., Edmond, P., Christie, S., Gowans, L., Fletcher, J., Frackiewicz, A. & Newton, M. (1975). Cytogenetics and infertility in man. Results of a five year survey of men attending a subfertility clinic. I. Karyotype and seminal analysis. Ann. Hum. Genet.,39, 231-254.MEDLINE Abstract
18 Zuffardi, O. and Tiepolo, L. (1982) Frequencies and types of chromosome abnormalities associated with human male infertility. In: Genetic control of gamete production and function (Crosignani, P.G. & Rubin, B.L., eds). Academic Press, London, pp. 261-273.
19 Vollrath, D., Foote, S., Hilton, A., Brown, L.G., Beer-Romero, P., Bogan, J.S. and Page, D.C. (1992) The human Y chromosome: A 43-interval map based on naturally occurring deletions. Science,258, 52-59.MEDLINE Abstract
20 Torroni, A., Semino, O., Scozzari, R., Sirugo, G., Spedini G., Abbas, N., Fellous, M. and Santachiara Benerecetti, A.S. (1990) Y chromosome DNA polymorphisms in human populations. Ann. Hum. Genet., 54, 287-296.MEDLINE Abstract
21 Nakahori, Y., Kobayashi, K., Komaki, R., Matsushita, I. and Nakagome, Y. (1994) A locus of the candidate gene family for azoospermia factor (YRRM2) is polymorphic with a null allele in Japanese males. Hum. Mol. Genet.,3, 1709.MEDLINE Abstract
22 del Castillo, E.B., Trabucco, A. and de la Balze, F.A. (1947) Syndrome produced by absence of the germinal epithelium without impairment of the Sertoli or Leydig cells. J. Clin. Endocrinol. Metab., 7, 493.
23 Terada, T. and Hatakeyama, S. (1991) Morphological evidence for two types of idiopathic `Sertoli-cell-only' syndrome. Int. J. Androl.,14, 117-126.MEDLINE Abstract
24 Roosen-Runge, E.C. (1977) Degeneration of germ cells. Polymorphism of spermatozoa. Genetic control. In: The Process of Spermatogenesis. Series: Developmental and Cell Biology (Abercrombie M., Newth D.R. and Torrey J.G. eds). Cambridge University Press, Vol. 5, 145-153.
25 Hargreave, T.B. (1990) Introduction in: The Management of Male Infertility (T.B. Hargreave, T.E. Soon, eds); P.G. Publishing, Singapore, pp. 2-21.
26 Forrest, S. M., Cross, G.S., Flint, T., Speer, A., Robson, K.J.H. and Davies, K.E. (1988) Further studies of gene deletions that cause Duchenne and Becker muscular dystrophies. Genomics,2, 109-114.MEDLINE Abstract
27 Yen, P.H., Allen, E., Marsh, B., Mohandas, T., Wang, N., Taggart, R.T. and Shapiro, L.J. (1987) Cloning and expression of steroid sulfatase cDNA and the frequent occurrence of deletions in STS deficiency: implications for X-Y interchange. Cell,49, 443-454.MEDLINE Abstract
28 Vogel, F. and Motulsky, A.G. (1986) Mutation. In: Human Genetics. Springer-Verlag, Berlin, pp. 334-432.
29 Chandley, A.C. and Cooke, H.J. (1994) Human male fertility-Y-linked genes and spermatogenesis. Hum. Mol. Genet., 3, 1449-1452.MEDLINE Abstract
30 Vogt, P., Keil, R., Köhler, M., Lengauer, C., Lewe, D. and Lewe, G. (1991) Selection of DNA sequences from interval 6 of the human Y chromosome with homology to a Y chromosomal fertility gene sequence of Drosophila hydei. Hum. Genet., 86, 341-349.MEDLINE Abstract
31 Hennig, W., Brand, R.C., Hackstein, J., Huijser, P., Kirchhoff, C., Kremer, H., Lankenau, D.H. and Vogt, P. (1987) Structure and function of Y chromosomal genes in Drosophila. In: Chromosomes Today (Stahl, A., Luciani, J.M. and Vagner-Capodano, A.M., eds), Vol. 9, 48-58.
32 Maiwald, R., Seebacher, T., Edelmann, A., Hirschmann, P., Köhler, M.R., Kirsch, S. and Vogt, P. (1996) A human Y-chromosomal gene mapping to distal Yq11 is expressed in spermatogenesis. In: Report of the Second International Workshop on Y Chromosome mapping, Asimolar 1995 (Lau et al., eds). Cytogenet. Cell Genet., in press.
33 Sutcliffe, M.J. and Bourgoyne, P.S. (1989) Analysis of the testes of H-Y negative X0Sxrb mice suggests that the spermatogenesis gene (Spy) acts during the differentiation of the A spermatogonia. Development,107, 373-380.MEDLINE Abstract
34 Mitchell, M.J., Woods, D.R., Tucker, P.M., Opp, J.S. and Bishop, C.E. (1991) Homology of a candidate spermatogenic gene from the mouse Y chromosome to the ubiquitin-activating enzyme E1. Nature,354, 483-486.MEDLINE Abstract
35 Keil, R., Kirsch, S. and Vogt, P.H. (1996) A physical map in middleYq11 over 2.5 Megabases. In: Report of the Second International Workshop on Y Chromosome Mapping, Asimolar 1995 (Lau et al. eds). Cytogenet. Cell Genet., in press.
36 Gänshirt-Ahlert, D., Pawlowitzki, I.H. and Gal, A. (1987) Three cases of 45,X/46,XYnf mosaicism. Hum. Genet., 76, 153-156.MEDLINE Abstract
37 WHO Laboratory Manual for the Examination of Human Semen and S-Cervical Mucus Interaction, 3rd edn. Cambridge University Press, Cambridge 1992.
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Thu Oct 31 15:25:15 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
