Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Raben, N.
Right arrow Articles by Plotz, P. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Raben, N.
Right arrow Articles by Plotz, P. H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 995-1001
A model of mRNA splicing in adult lysosomal storage disease (glycogenosis type II)
Introduction
Results
Discussion
Materials And Methods
   Minigene constructs
   Cell culture, transfection and RNA isolation
   RT-PCR and Southern analysis
   RNAse protection assay
Acknowledgements
References

A model of mRNA splicing in adult lysosomal storage disease (glycogenosis type II)

A model of mRNA splicing in adult lysosomal storage disease (glycogenosis type II) Nina Raben*, Ralph C. Nichols, Frank Martiniuk1 and Paul H. Plotz

Arthritis and Rheumatism Branch, National Institute of Arthritis, Musculoskeletal, and Skin Diseases, National Institutes of Health, Bethesda, Maryland, USA and 1Department of Medicine Pulmonary Division, New York University Medical Center, New York, USA

Received February 23, 1996; Revised and Accepted April 25, 1996

Glycogenosis type II is a recessively inherited disorder caused by mutations in the acid maltase (GAA) gene. Clinically, three different phenotypes are recognized: infantile, juvenile and adult forms. A majority of compound heterozygous adult-onset patients carry a t-13g mutation in intron 1 associated with splicing out the first coding exon (exon 2). We have studied the mechanism of this mutation in a model system with wild-type and mutant minigenes expressed in a GAA deficient cell line. We have demonstrated that the mutation does not prevent normal splicing; low levels of correctly spliced mRNA are generated with the mutant construct. The data explain why the mutation is restricted to a milder, adult-onset phenotype. We also demonstrate that splicing out of exon 2 occurs with the wild-type construct, and thus represents alternative splicing which takes place in normal cells. Three splice variants (SV1, SV2 and SV3) are made with both the mutant and the wild-type constructs. Furthermore, as shown by RNAse protection assay, these mRNA variants are less abundant with the mutant construct. Thus, a major effect of the mutation appears to be a low splicing efficiency, since the total amount of all the transcripts generated from the mutant construct is reduced compared with the wild type. The removal of ~90% of the intron 1 (2.6 kb) sequence resulted in a dramatic increase in the levels of correctly spliced mRNA, indicating that the intron may contain a powerful transcriptional repressor.

INTRODUCTION

Glycogenosis type II is a recessively inherited lysosomal glycogen storage disease caused by deficiency in acid maltase (GAA, acid [alpha]-glucosidase, EC 3.2.1.20), which catalyzes the hydrolysis of [alpha]-1,4 and [alpha]-1,6 linkages in glycogen, maltose and isomaltose. Clinical phenotypes vary dramatically: the infantile form (first described by Pompe in 1932; 2 ) is characterized by rapid progression and deposition of glycogen in the liver, heart and skeletal muscle leading to death from cardiorespiratory failure before the age of 2 years; the juvenile and adult forms usually manifest as slowly progressive myopathy with respiratory insufficiency (reviewed in refs 3 -5 ). In the adult form, glycogen accumulation is observed in skeletal muscle but not in other tissues, and the levels of glycogen deposition are significantly lower than those in the infantile form. Death usually occurs by respiratory failure. Enzyme activity is deficient, but rarely absent in adult-onset disease.

Since the gene for GAA was first cloned and characterized (6 -10 ), multiple defects have been identified at the DNA level, including missense and nonsense mutations, splicing mutations, base-pair and large deletions, and insertions (reviewed in refs 5 and 11 ; 12 ). A major advance came with the discovery of a mutation shared by a majority of compound heterozygous adult-onset patients from different ethnic backgrounds (1 ). The mutation (t-13g) is located upstream from exon 2, the site of the ATG start codon.

In an adult patient we studied, the -13 mutated allele generated three splice variants (SV1, SV2 and SV3) in which exon 2 was partially or completely removed (13 ). In this patient we have also determined the haplotype on which the mutation arose, and by mapping polymorphic sites we demonstrated that low levels of correctly spliced mRNA are transcribed from the mutated allele. The data suggested that the `leakage' of normal transcript may be a general mechanism that defines the delayed phenotypic expression in patients with the -13 mutation. We have now tested this directly in a model system designed to detect transcripts from wild-type and mutant minigenes, thus eliminating the influence of additional mutations on the -13 mutated allele as well as the effect of mutation(s) present on the second allele. In addition, the model enabled us to study the mechanism of the mutation and to manipulate the system in an attempt to increase the level of correctly spliced mRNA.

RESULTS

Previous data demonstrated that in adult-onset patients with GAA deficiency a t to g mutation located 13 nt upstream from exon 2 of the GAA gene was associated with three aberrantly spliced products with complete or partial removal of exon 2, the site of the ATG codon (13 ). The pattern of these splice variants (SV1, SV2 and SV3) is shown in Figure 1 A. In SV1 a cryptic splice donor site 36 nt downstream from exon 1 is used and exon 2 is spliced out; in SV2 exon 1 is spliced to exon 3, and in SV3 60 nt of the 3' end of exon 2 are retained in the transcript while most of the exon 2 sequence, including the ATG start site is removed. To study the mechanism of the mutation, we analyzed the splicing pattern of wild-type and mutant constructs in a minigene model system. A portion of the GAA gene spanning exon 1 in the 5'UT region to intron 3 (GAA minigene wild type and mutant) was placed into an expression vector and transfected into GAA deficient human fibroblasts. Total fibroblast RNA was analyzed either by RT-PCR or by RNAse protection assay.


Figure 1.Identification of splice variants with mutant and wild-type minigene constructs. (A) Splicing pattern associated with the -13 mutation (13). (B) RT-PCR and Southern analysis of the transcripts generated with the t-13g mutant and wild-type minigene constructs. Southern blots were hybridized with specific probes as follows: the correctly spliced mRNA was detected with probe N (exon 1/exon 2 junction); SV1 was detected with intron 1 probe; SV2 was detected with a probe located at the exon1/exon3 junction; SV3 was detected with a probe located at the junction of exon 1 and the 3' end of exon 2. The sequences of the probes are indicated in the Methods section.

The splicing pattern of the wild-type and mutant pre-mRNAs, was evaluated by RT-PCR. PCR products amplified with primers in exon 1 and exon 3 were hybridized with oligonucleotide probes specific for normal transcript or for one of the splice variants (Fig. 1 B). The oligonucleotides used for PCR amplification and to probe Southern blots are indicated in the Methods section. The mutant minigene construct resulted in generation of all three splice variants and a small amount of normal transcript (Fig. 1 B, right panel). Thus, in this model system, the mutant construct resulted in the same splicing phenotype that had been previously observed in vivo, including the leakage of normally spliced transcript (13 ). The transcripts were not detectable in GAA deficient recipient cells or cells transfected with plasmid alone (not shown).

As shown in Figure 1 B (left panel), normal transcript and all three alternatively spliced variants were also made with the wild-type minigene construct. Thus, the RT-PCR based assay suggests that the -13 mutation is located in a region which normally undergoes alternative splicing. To accurately assess the level of mutant gene expression relative to the wild-type we analyzed total fibroblast RNA by RNAse protection assay. The position of the riboprobes (solid lines), as well as the expected size of the protected fragments, is shown in Figure 2 . The probes were designed specifically to detect the normal transcript (N) and each of the alternatively processed mRNA species (probes I, II and III; see also Methods). The RNAse protection assay performed with probe N (Fig. 3 ) shows that the -13 mutation results in low level of normal transcript, and thus confirms the RT-PCR data. The full pattern of the protected fragments observed with riboprobes I, II or III probes is shown in Figure 4 . A unique band corresponding to each of the splice variants is expected with these probes. The data indicate that normal transcript and all three alternatively spliced products are made by both the wild-type and the mutant constructs. Unexpectedly, in contrast to the PCR data, the RNAse protection assay demonstrated that, in fact, the amount of each splice variant produced with the mutant construct is lower than that observed with the wild-type construct. The total amount of processed mRNA, as detected by RPA, is lower with the mutant construct than with the wild type.


Figure 2.Position of riboprobes and the expected size of protected fragments. (A) Four riboprobes for RNAse protection assay were designed (shown as solid lines ) to detect the normal transcript and each of the splice variants. Riboprobe N was expected to hybridize only with the normal transcript; riboprobes I, II and III were expected to generate unique bands corresponding to SV1, SV2 and SV3 respectively. Splicing pattern of the alternatively spliced transcripts is indicated. EX-exon; IVSI-intron 1; dashed box-60 nt of the 3' end of exon 2. (B) The expected sizes of the protected fragments are shown. Unique bands corresponding to the normal transcript and each of the splice variants are boxed, and bands discussed in the text are shown in bold.


Figure 3.Detection of normal transcript generated with mutant and wild-type minigene constructs. A solution hybridization/RNAse protection assay was performed using the antisense riboprobe N that contained 390 bp complementary to the 5' part of exon 2 (the probe also contained ~60 bp of pGEM plasmid sequence). Total RNA (10 [mu]g) from fibroblasts transfected with mutant or wild-type constructs, probe alone (control), or probe without RNAse (Probe) was used in the assay. [beta]-actin riboprobe was used as control for RNA loading. [Phi]x DNA marker is shown in the right lane.


Figure 4.Detection of alternatively splice transcripts generated with mutant and wild-type minigene constructs. RNAse protection assay was performed using antisense riboprobe I, II or III, respectively. The position of the riboprobes and the size of the protected fragments are indicated in Figure 2. Total RNA (10 [mu]g) from fibroblasts transfected with mutant or wild-type constructs, probe alone (control), or probe without RNAse (Probe) was used in the assay. Arrows indicate unique bands corresponding to the normal transcript and each of the splice variants. The autoradiograms II and III represent overnight exposure for lanes `mutant' and `wild-type', and 3 h exposure for lanes `Probe' and `control'. [Phi]x-DNA marker is shown in the left lane.


It should be noted that the -13 mutation does cause the upregulation of the splice variants as they constitute a larger proportion of the total mRNA. However, this does not seem to be of great importance as these alternatively spliced forms are still less abundant than with the wild type. Thus, the RNAse protection assay demonstrated that the mutant construct results in a decreased level of processed mRNA, suggesting that the major effect of the -13 mutation is not a splicing abnormality, but rather a low-RNA phenotype.

Two additional constructs were designed to see if there are any elements within the 2.6 kb sequence of the first intron that may potentially contribute to the effect of the mutation. These constructs, [Delta]-wild-type and [Delta]-mutant, were tested in transfection experiments and the level of expression measured by RT-PCR and by protection assay. As shown in Figure 5 the removal of 90% of intron 1 results in a dramatic increase in the levels of correctly spliced RNA with both the [Delta]-wild-type and the [Delta]-mutant constructs, suggesting that the intron may contain a transcriptional repressor. The removal of a 1.6 kb fragment from the 5' end of intron 1 resulted in the same level of transcriptional activation and placed the putative repressor element within this fragment of intron 1 (not shown). Most importantly, the amount of normal transcript produced by the [Delta]-mutant construct (detected both by PCR and RNAse protection assay) increases significantly, indicating that the mutant phenotype can be corrected by activation of transcription.

DISCUSSION

GAA deficiency is characterized by a remarkable phenotypic variability ranging from a rapidly progressive infantile form with cardiac involvement to a late-onset slowly progressive myopathy. In general the level of residual acid-[alpha]-glucosidase activity correlates well with clinical course (5 ), although in some cases an exceptionally low enzyme activity has been found in adult patients with relatively mild phenotype (14 ,15 ). Recent identification of common genetic defects in patients with different forms of the disease made it possible to evaluate the genotype-phenotype correlation. A genomic deletion of exon 18 or a deletion of a T525 in exon 2 in homozygous form invariably results in a fatal early onset of the disease. On the other hand a combination of either of these defects with the -13 mutation in genetic compound patients is always associated with the delayed phenotypic expression of the disease. The -13 mutation was initially identified in 28 of 41 (70%) adult-onset patients studied (1 ). Recently, 16 additional patients from 11 families with the mutation have been reported (16 ). We identified this mutation in three adult-onset patients (two cases are unpublished). Thus, the mutation was identified in 42 of 55 families (~77%), which makes it the most frequent mutation restricted to GAA deficient adult-onset phenotype (only one compound heterozygous juvenile patient has been reported with this mutation) (17 ).


Figure 5. Detection of the normal transcript generated with [Delta]-mutant and [Delta]-wild-type constructs. In [Delta]-mutant and [Delta]-wild-type constructs ~90% of intron 1 (2.6 kb) sequence was removed; the intron splice sites and adjacent sequences (100 nt at the 5' end and 120 nt at the 3' end) remained intact. Analysis of the normal transcript by RT-PCR (A) and by RNAse protection assay (B). RNAse protection assay was performed using antisense riboprobe I.

We have previously studied a genetic compound adult-onset patient (A40) with the -13 mutation, and by mapping multiple polymorphic sites we demonstrated that a small amount of mRNA with correctly spliced exon 2 was transcribed from the -13 mutated allele (13 ). This `leakage' of normal transcript in our patient may have been due to the chromosomal background or a combination of the polymorphic sites on the mutated allele. However, the data reported here using a mutant minigene establish that the mutation does not abolish normal processing of GAA mRNA. Rather, the properly spliced transcript is generated at reduced levels. This may explain the less severe clinical phenotype in patients with the -13 mutation. The data also explain why the mutation has not been identified in a homozygous state; individuals homozygous for the -13 mutation would most likely remain phenotypically normal. Based on the data, one can predict that in patients with the adult-onset phenotype the mutation on the second allele is likely to be of the infantile type. In fact, mutations on the second allele that have been identified (a T525 deletion, exon 18 deletion, and splicing out of exon 10) result in generation of nonfunctional products (1 ,13 ,16 -19 ).

We next asked whether the -13 mutation is associated with the increased accumulation of products with partial or complete removal of exon 2. In our minigene model system, all three splice variants (SV1, SV2 and SV3) are generated from the wild-type minigene, indicating that these forms represent normal alternatively spliced products. This was not totally surprising, as two of the variants (SV2 and SV3) were detected previously in EBV-transformed B cells (1 ). Alternative splice sites utilized by the splice variants conform closely to the consensus sequences for the 5' donor site (SV1: cg/gtaaca; consensus: ag/gtaagt) and the 3' acceptor site (SV3: Py11 ag/exon; consensus: Py10 ag/exon).

The mutant construct generated the same three splice variants as the wild type, indicating that the mutation does not affect splice-site selection. Unexpectedly, RNAse protection data showed that the amount of splice variants generated with the mutant minigene was less than with the wild type. Thus, the reduced levels of normal transcript is not due solely to the excessive accumulation of the alternatively spliced products as we had previously supposed (13 ). Rather, it is a consequence of a decreased amount of spliced RNA. The splice variants seem to constitute a larger proportion of the total mRNA generated with the mutant construct than with the wild type, suggesting that the mutation does cause a relative upregulation of the alternatively spliced forms. However, this upregulation is not critical because these transcripts are still less abundant than with the wild type.

A possible mechanism of reduced gene expression with the mutant genotype may be the reduced efficiency of splicing. The site of the -13 mutation in intron 1 is within the polypyrimidine (Py) tract which has been shown to regulate the recognition of the branch point and the 3' splice site. The sequence and distance between the branch site and 3' splice junction play an important part in selecting the correct AG (20 -23 ). In vitro splicing studies of synthetically modified pre-mRNA derived from human B-globin pre-mRNA have shown that when the Py tract was short, multiple purine substitutions (U to G) resulted in a dramatic decrease of splicing efficiency (22 ). A detailed mutational analysis of an adenovirus 2 intron demonstrated that uracil residues within the tract are functionally more important than cytosine residues, and a single purine substitution can affect splicing, particularly in short tracts (24 ). Substitutions within the tract may alter the binding of several putative trans-acting factors and RNA-binding proteins including hnRNPC, PTB and U2AF (25 -32 ). Changes in the Py tract have been shown to affect the binding affinity of U2AF (32 ). Decreased affinity for one or several of these proteins may be a mechanism by which a T to G substitution within the Py tract of the GAA intron 1 decreases the efficiency of splicing.

Finally, we have demonstrated that the production of normal transcript could be stimulated. A removal of most of the intronic sequence resulted in a dramatic increase of the correctly spliced mRNA both with the mutant and wild-type constructs. The finding is not totally surprising, as transcriptional control regions are typically clustered in flanking regions or introns. An attempt to induce the generation of normal transcript would be an approach to correct the phenotype in adult-onset patients with the -13 mutation. In these patients even a small increase in the amount of normal transcript would be beneficial as homozygosity for this mutation seems to provide enough enzyme activity to remain phenotypically normal.

MATERIALS AND METHODS

Minigene constructs

The GAA minigene system was constructed to include the genomic region spanning exon 1 (5' UT region) through exon 3 and a portion of intron 3. A diagram showing the construction of wild-type and mutant minigenes is shown in Figure 6 .A 3 kb fragment which included exon 1, intron 1 and part of exon 2 was PCR-amplified from a genomic clone to introduce a HindIII restriction site at the 5' end. For the amplification, the primers were located 38 bp upstream from exon 1 (sense: gcgaagcttccgggtcggtggggcggtcggct-HindIII) and in exon 2 (antisense: gcgcagacggccaggagccggtg). The fragment was digested with HindIII/XbaI (a natural XbaI site is located 120 bp upstream from exon 2) and cloned into a mammalian expression vector (pcDNA3) to produce 3 kb GAApcDNA3. A 2 kb genomic fragment which included the rest of the minigene was released from the genomic clone by XbaI digest. This fragment was cloned into XbaI-digested 3 kb GAApcDNA3. The resulting wild-type plasmid was used for transfection experiments and as a template to introduce the t-13g point mutation.


Figure 6.A diagram showing the construction of the wild-type and mutant minigenes (see Methods section). X-XbaI; H-HindIII. Arrow indicates the position of the -13 mutation. The region spanning the 5' natural and cryptic splice sites in intron 1 as well as the mutated SacI fragment were sequenced to ensure that no errors were introduced by PCR.

To generate a mutant construct, the 2 kb XbaI fragment was first cloned into intermediate plasmid pGEM-3Z 15 nt downstream from the SacI site. The resulting plasmid (pGEM2kbGAAXbaI wt) was then digested with SacI to release a 600 bp fragment extending to the natural SacI site in the exon 2 of the GAA gene. The released wild-type SacI fragment was substituted by the mutant (t-13g) fragment generated by the recombinant PCR technique (33 ). The 2 kb mutant XbaI fragment was released from this plasmid and subcloned into 3 kb GAApcDNA3 to produce the mutant construct.

Two other constructs, [Delta]-wild-type and [Delta]-mutant, were designed with 90% of intron 1 removed. The 5' end (100 bp) and the 3' end (120 bp including the natural XbaI restriction site) of intron 1 remained intact. To generate these constructs, the region spanning exon 1 was amplified with HindIII primer (described above) and antisense primer located at positions 74-95 downstream from exon 1 (gcgtctagactcaggggaagagctgggggca-XbaI). The fragment was cloned into pcDNA3; this intermediate plasmid was then digested with XbaI for ligation with either the wild-type or the mutant 2 kb XbaI fragment described above.

Cell culture, transfection and RNA isolation

TR4912 is an SV40-immortalized human fibroblast cell line that has no detectable GAA mRNA or enzymatic activity (34 ). The fibroblasts were transfected with expression constructs (20 [mu]g/100 mm dish) by the calcium phosphate method or in the presence of liposomes (5 [mu]g DNA /100 mm dish). Multiple transfections were performed with different preparations of the constructs and each experiment was done in duplicate or triplicate. The minigene plasmids were transfected with or without a control expression plasmid, which contained the coding sequence of the splicing factor SF2/ASF. The expression plasmid pCG-SF2 was kindly provided by Dr A. R. Krainer. SF2 expression was detected by RT-PCR as described (35 ) with a reverse primer in the coding region and two forward primers derived from the pCG vector (to monitor the efficiency of transfection) and from the 5' UTR of the endogenous SF2 gene (RNA control of the recipient cells; data not shown). Following transfection, RNA was isolated (Total RNA Kit, Qiagen, Chatsworth, CA, USA) and analyzed either by RT-PCR and Southern hybridization or by RNAse protection assay. The same RNA samples were used for RT-PCR and RNAse protection assay.

RT-PCR and Southern analysis

Total RNA (2 [mu]g) was transcribed into cDNA by using random primers and AMV reverse transcriptase. The cDNA (equivalent to 0.2 [mu]g total RNA) was amplified with primers located in exon 1 (sense: 5'-cagttgggaaagctgaggttgtcgcc) and exon 3 (antisense: 5'-gggcacctcgtagcgcctgttagct) under the following conditions: 2 min at 55oC and 10 min at 72oC for second strand cDNA synthesis, followed by denaturation at 95oC for 1 min, annealing at 55oC for 1 min and extension at 72oC for 1 min 20 s for 35 cycles. PCR products were resolved on a 1.5% agarose gel and subjected to Southern analysis. The hybridization of Southern blots was carried out at 42oC for 16 h in 5*SSPE, 5*Denhardt's solution, 0.5% SDS, 100 [mu]g salmon sperm DNA and 50% formamide. The membrane was washed twice with 0.2*SSC, 0.1% SDS at room temperature followed by two washes at 37oC for 30 min and two washes at 65oC for 30 min. Oligonucleotide probes for Southern hybridization were designed to detect the normal transcript and each of the splice variants. For the normal transcript the probe was located at the exon 1/exon 2 junction (gaggcacggagcgggcctgtaggagctgtcca); for SV1-in the intron 1 (bp 5-30 gacacctgacgtctgccccgcgcct); for SV2-at the exon 1/exon 3 junction (gaggcacggagcggatcaaagatc); and for SV3-at the junction of exon 1 and the 3' part of exon 2 which is retained in this splice variant (gaggcacggagcggcccgtaccaccccca).

RNAse protection assay

DNA fragments for riboprobes were generated by recombinant PCR (11 ) and cloned into pGEM-3Z vector. The DNA fragments contained the following sequences: for the normal transcript-390 bp of the 5' part of exon 2 (probe N); for SV1-exon 1, 36 nt of intron 1 (retained in the transcript), exon 2 and exon 3 (probe I); for SV2-exon 1 and exon 3 (probe II); for SV3-exon 1 and 60 bp of the 3' end of exon 2 (probe III). Riboprobes were synthesized and labeled using 32P-CTP and T7 polymerase (Ambion, Inc., Austin, TX, USA). RPA was performed with 10 [mu]g of DNAse-treated RNA and gel-purified labeled riboprobe (12*104 c.p.m. ) using a Hyb-Speed RPA kit (Ambion). The protected fragments were resolved on a 6% denaturing polyacrylamide sequencing gel. The gels were exposed to film for 16 h at -80oC.

ACKNOWLEDGMENTS

We gratefully acknowledge Dr Joseph Zaretsky for helping with the minigene constructs and for helpful discussions.

REFERENCES

1 Huie, M.L., Chen, A.S., Tsujino, S., Shanske, S., DiMauro, S., Engel, A.G., Hirshhorn, R. (1994) Aberrant splicing in adult onset glycogen storage disease type II (GSDII): molecular identification of an IVS1 (-13T to G mutation in a majority of patients and a novel IVS10 (+1GT to CT) mutation. Hum. Mol. Genet. 3, 2231-2236. MEDLINE Abstract

2 Pompe, J.C. (1932) Over idiopatsche hypertrophie van het hart. Ned. Tijdschr. Geenskd. 76, 304-311.

3 Engel, A.G., Hirshhorn, R. (1994) Acid maltase deficiency. In Engel, A.G., Franzini-Armstrong, C., eds. Myology. Basic and Clinical. New York, McGraw-Hill, pp. 1533-1553.

4 McKusick, V.A. (1994) Glycogen storage disease II. In Mendelian Inheritance in Man, 11th edn. Baltimore, MD, Johns Hopkins University Press, pp 1861-1864.

5 Reuser, A.J.J., Kroos, M.A., Hermans, M.M.P., Bijvoet, A.G.A., Verbeet, M.P., Van Diggelen, O.P., Kleijer, W.J., Van der Ploeg, A.T. (1995) Glycogenosis type II (acid maltase deficiency). Muscle Nerve Suppl. 3, S61-68.

6 Hoefsloot, L.H., Hoogeveen-Westerveld, M., Kroos, M.A., van Beeumen, J., Reuser, A.J., Oostra, B.A. (1988) Primary structure and processing of lysosomal alpha-glucosidase; homology with the intestinal sucrase-isomaltase complex. EMBO J. 7, 1697-1704. MEDLINE Abstract

7 Hoefsloot, L.H., Hoogeveen-Westerveld, M., Reuser, A.J.J., Oostra, B.A. (1990) Characterization of the human lysosomal alpha-glucosidase gene. Biochem. J. 272, 493-497. MEDLINE Abstract

8 Martiniuk, F., Mehler, M., Pellicer, A., Tzall, S., La Badie, G., Hobart, C., Ellenbogen, A., et al. (1986) Isolation of a cDNA for human acid alpha-glucosidase and detection of genetic heterogeneity for mRNA in three alpha-glucosidase-deficient patients. Proc. Natl Acad. Sci. USA 83, 9641-9644. MEDLINE Abstract

9 Martiniuk, F., Mehler, M., Tzall, S., Meredith, G., Hirschhorn, R. (1990) Sequence of the cDNA and 5' flanking region for human acid alpha-glucosidase, detection of an intron in the 5' untranslated leader sequence, definition of 18-bp polymorphisms, and differences with previous cDNA and amino acid sequences. DNA Cell Biol. 9, 85-94. MEDLINE Abstract

10 Martiniuk, F., Bodkin, M., Tzall, S., Hirschhorn, R. (1991) Isolation and partial characterization of the structural gene for human acid alpha glucosidase. DNA Cell Biol. 10, 283-292. MEDLINE Abstract

11 Raben, N., Nichols, R.C., Boerkoel, C., Plotz, P. (1995) Genetic defects in patients with glycogenosis type II (acid maltase deficiency). Muscle Nerve Suppl. 3, S70-74.

12 Lin, C.Y., Shieh, J.J. (1995) Identification of a de novo point mutation resulting in infantile form of Pompe's disease. Biochem. Biophys. Res. Commun. 208, 886-893. MEDLINE Abstract

13 Boerkoel, C., Exelbert, R., Nicastri, C., Nichols, R.C., Miller, F.W., Plotz, P.H., Raben, N. (1995) Leaky splicing mutation in the acid maltase gene is associated with delayed onset of glycogenosis type II. Am. J. Hum. Genet. 56, 887-897. MEDLINE Abstract

14 Hermans, M.M., De Graaff, E., Kroos, M.A., Wisselaar, H.A., Willemsen, R., Oostra, B.A., Reuser, A.J.J. (1993) The conservative substitution Asp-645 -> Glu in lysosomal alpha-glucosidase affects transport and phosphorylation of the enzyme in an adult patient with glycogen-storage disease type II. Biochem. J. 289, 687-693. MEDLINE Abstract

15 Hermans, M.M., Kroos, M.A., De Graaff, E., Oostra, B.A., Reuser, A.J.J. (1993) Two mutations affecting the transport and maturation of lysosomal alpha-glucosidase in an adult case of glycogen storage disease type II. Hum. Mutat. 2, 268-273. MEDLINE Abstract

16 Wokke, J.H.J., Ausems, M., van den Boogaard, M.J.H., Ippel, E.F., van Diggelen, O., Kroos, M.A., Boer, M., Jennekens, F.G.I., Reuser, A.J.J., Ploos van Amstel, H.K. (1995) Genotype-phenotype correlation in adult-onset acid maltase deficiency. Ann. Neurol. 38, 450-454.

17 Kroos, M.A., van der Kraan, M., van Diggelen, O.P., Kleijer, W.J., Reuser, A.J.J., van den Boogaard, M.J.H., Ausems, M.G.E.M., Ploos van Amstel, H.K., Poenaru, L., Nicolino, M., Wevers, R. (1995) Glycogen storage disease type II: frequency of three common mutant alleles and their associated clinical phenotypes studied in 121 patients. J. Med. Genet. 32, 836-837. MEDLINE Abstract

18 Hermans, M.M.P., De Graaff, E., Kroos, M.A., Mohkamsing, S., Eussen, B.J., Joosse, M., Willemsen, R., Kleijer, W.J., Oostra, B.A., Reuser, A.J.J. (1994) The effect of a single base pair deletion (T525) and a C1634T missense mutation (pro545leu) on the expression of lysosomal alpha-glucosidase in patients with glycogen storage disease type II. Hum. Mol. Genet. 3, 2213-2218.

19 Huie, M.L., Chen, A.S., Sklower Brooks, S., Grix, A., Hirschhorn, R. (1994) A de novo 13 nt deletion, a newly identified C647W missense mutation and a deletion of exon 18 in infantile onset glycogen storage disease type II (GSDII). Hum. Mol. Genet. 3, 1081-1087. MEDLINE Abstract

20 Dirksen, W.P., Sun, Q., Pottman, F.M. (1995) Multiple splicing signals control alternative intron retention of bovine growth hormone pre-mRNA. J. Biol. Chem. 270, 5346-5352. MEDLINE Abstract

21 Mullen, M.P., Smith, C.W.J., Patton, J.G., Nadal-Ginard, B. (1991) [alpha]-Tropomyosin mutually exclusive exon selection: competition between branchpoint/polypyrimidine tract determines default exon choice. Genes Dev. 5, 642-655. MEDLINE Abstract

22 Reed, R. (1989) The organization of 3' splice site sequences in mammalian introns. Genes Dev. 3, 2113-2123. MEDLINE Abstract

23 Smith, C.W., Nadal-Ginard, B. (1989) Mutually exclusive splicing of alpha-tropomyosin exons enforced by an unusual lariat branch point location: implication for constitutive splicing. Cell 56, 749-758. MEDLINE Abstract

24 Roscigno, R.F., Weiner, M., Garcia-Blanco, M.A. (1993) A mutational analysis of the polypyrimidine tract of introns. J. Biol. Chem. 268, 11222-11229. MEDLINE Abstract

25 Bothwell, A.L.M., Ballard, D.W., Philbrick, W.M., Lindwall, G., Maher, S.E., Bridgett, M.M., Jamison, S.F., Garcia-Blanco, M.A. (1991) Murine polypyrimidine tract binding protein. J. Biol. Chem. 266, 24657-24663.

26 Choi, Y.D., Grabowski, P.J., Sharp, P.A., Dreyfuss, G. (1986) Heterogeneous nuclear ribonucleoproteins: role in RNA splicing. Science 231, 1534-1539. MEDLINE Abstract

27 Garcia-Blanco, M.A., Jamison, S.F., Sharp, P.A. (1989) Identification and purification of a 62,000-dalton protein that binds specifically to the polypyrimidine tract of introns. Genes Dev. 3, 1874-1886. MEDLINE Abstract

28 Gerke, V. and Steitz, J.A. (1986) A protein associated with small nuclear ribonucleoprotein particles recognizes the 3' splice site of premessenger RNA. Cell 47, 973-984. MEDLINE Abstract

29 Singh, R., Valcarcel, J., Green, M.R. (1995) Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins. Science 268, 1173-1176. MEDLINE Abstract

30 Tazi, J., Alibert, C., Temesamani, J., Reveillaud, I., Cathala, G., Brunel, C., Jeanteur, P. (1986) A protein that specifically recognizes the 3' splice site of mammalian pre-mRNA introns is associated with a small nuclear ribonucleoprotein. Cell 47, 755-766. MEDLINE Abstract

31 Wang, J., Pederson, T. (1990) A 62,000 molecular weight spliceosome protein crosslinks to the intron polypyrimidine tract. Nucleic Acids Res. 18, 5995-6001. MEDLINE Abstract

32 Zamore, P.D., Patton, J.D., Green, M. (1992) Cloning and domain structure of the mammalian splicing factor U2AF. Nature 355, 609-614. MEDLINE Abstract

33 Higuchi, R. (1989) Using PCR to engineer DNA. In: Erlich HA (ed.) PCR Technology. Principles and Applications for DNA Amplification. New York, Stockton, pp. 61-70.

34 Martiniuk, F., Bodkin, M., Tzall, S., Hirschhorn, R. (1990) Identification of the base-pair substitution responsible for a human acid alpha glucosidase allele with lower `affinity' for glycogen (GAA 2) and transient gene expression in deficient cells. Am. J. Hum. Genet. 47, 440-445. MEDLINE Abstract

35 Caceres, J.F., Stamm, S., Helfman, D.M., Krainer, A.R. (1994) Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors. Science 265, 1706-1709. MEDLINE Abstract

*To whom correspondence should be addressed at: 10/9N244, 9000 Rockville Pike, Bethesda, MD 20892, USA

This page is maintained by OUP admin. Last updated Thu Oct 31 15:25:15 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 NeurologyHome page
A. C. Nascimbeni, M. Fanin, E. Tasca, and C. Angelini
Molecular pathology and enzyme processing in various phenotypes of acid maltase deficiency
Neurology, February 19, 2008; 70(8): 617 - 626.
[Abstract] [Full Text] [PDF]

Home page
 NeurologyHome page
M. A. Kroos, R. J. Pomponio, M. L. Hagemans, J.L.M. Keulemans, M. Phipps, M. DeRiso, R. E. Palmer, M. G.E.M. Ausems, N. A.M.E. Van der Beek, O. P. Van Diggelen, et al.
Broad spectrum of Pompe disease in patients with the same c.-32-13T->G haplotype
Neurology, January 9, 2007; 68(2): 110 - 115.
[Abstract] [Full Text] [PDF]

Home page
 BrainHome page
I. Naom, M. D'alessandro, C. A. Sewry, P. Jardine, A. Ferlini, T. Moss, V. Dubowitz, and F. Muntoni
Mutations in the laminin {alpha}2-chain gene in two children with early-onset muscular dystrophy
Brain, January 1, 2000; 123(1): 31 - 41.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. Yan, J. Heus, N. Lu, R. C. Nichols, N. Raben, and P. H. Plotz
Transcriptional Regulation of the Human Acid alpha -Glucosidase Gene. IDENTIFICATION OF A REPRESSOR ELEMENT AND ITS TRANSCRIPTION FACTORS Hes-1 AND YY1
J. Biol. Chem., January 12, 2001; 276(3): 1789 - 1793.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Raben, N.
Right arrow Articles by Plotz, P. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Raben, N.
Right arrow Articles by Plotz, P. H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?