Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (85)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chung, W. Y.
Right arrow Articles by Tycko, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chung, W. Y.
Right arrow Articles by Tycko, B.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1101-1108
Chromosome 11p15.5 regional imprinting: comparative analysis of KIP2 and H19 in human tissues and Wilms' tumors
Introduction
Results
   KIP2 allelic expression in normal human tissues and WTs
   KIP2 and H19 DNA methylation in normal and tumor tissues
   Induction of H19 RNA but not KIP2 mRNA by aza-C exposure of RD cells
   KIP2 and H19 RNA expression in primary tumors
Discussion
Materials And Methods
   DNA and RNA methods and polymorphism analysis
   DNA and RNA probes and PCR primers
Acknowledgements
References

Chromosome 11p15.5 regional imprinting: comparative analysis of KIP2 and H19 in human tissues and Wilms' tumors

Chromosome 11p15.5 regional imprinting: comparative analysis of KIP2 and H19 in human tissues and Wilms' tumors Wai-Yee Chung+, Luwa Yuan+, Lin Feng+, Terrence Hensle1 and Benjamin Tycko*

Department of Pathology and 1Department of Surgery, Division of Pediatric Urology, Columbia University College of Physicians and Surgeons, New York, NY, USA

Received April 1, 1996; Revised and Accepted May 14, 1996

The imprinted H19 gene is frequently inactivated in Wilms' tumors (WTs) either by chromosome 11p15.5 loss of heterozygosity (LOH) or by hypermethylation of the maternal allele and it is possible that there might be coordinate disruption of imprinting of multiple 11p15.5 genes in these tumors. To test this we have characterized total and allele-specific mRNA expression levels and DNA methylation of the 11p15.5 KIP2 gene in normal human tissues, WTs and embryonal rhabdomyosarcoma (RMS). Both KIP2 alleles are expressed but there is a bias with the maternal allele contributing 70-90% of mRNA. Tumors with LOH show moderate to marked reductions in KIP2 mRNA relative to control tissues and residual mRNA expression is from the imprinted paternal allele. Among WTs without LOH most cases with H19 inactivation also have reduced KIP2 expression and most cases with persistent H19 expression have high levels of KIP2 mRNA. In contrast to the extensive hypermethylation of the imprinted H19 allele, both KIP2 alleles are hypomethylated and WTs with biallelic H19 hypermethylation lack comparable hypermethylation of KIP2 DNA. 5-aza-2'-deoxycytidine (aza-C) increases H19 expression in RD RMS cells but does not activate KIP2 expression. These data indicate coordinately reduced expression of two linked paternally imprinted genes in most WTs and also suggest mechanistic differences in the maintenance of imprinting at these two loci.

INTRODUCTION

Genomic imprinting leads to parent-of-origin-dependent gene silencing with monoallelic RNA expression in tissues of the offspring. Recent observations have suggested the existence of chromosomal domains containing clusters of imprinted genes. In the Prader-Willi syndrome/Angelman syndrome (PWS/AS) region of human chromosome 15q11-q13 there are at least five distinct transcripts which are normally expressed exclusively from the paternal allele and this region is predicted to contain at least one additional gene with the opposite pattern of maternal-restricted expression (1 -3 ). Similarly, in the region of human chromosome 11p15.5 which is associated with the Beckwith-Weidemann syndrome (BWS) and which is subject to recurrent maternal loss of heterozygosity (LOH) in embryonal tumors such as Wilms' tumor (WT) and embryonal rhabdomyosarcoma (RMS) there are two well-studied imprinted genes: H19, which is paternally imprinted, and IGF2, which is silenced on the opposite (maternal) allele (4 -8 ) and the syntenic region of mice contains these two loci (9 ,10 ) as well as at least three other imprinted genes: Ins-2 (11 ), Mash2 (12 ) and KIP2 (13 ). Recently, the human KIP2 gene, which encodes a cyclin-cdk inhibitor and which has been proposed as a candidate tumor suppressor gene (14 ), has been localized centromeric to IGF2 and close to the positions of several chromosomal translocation breakpoints in kindreds with BWS (15 ).

The clustering of imprinted genes in chromosomal domains could have important implications both for the mechanism of imprinting and for the mode of disregulation of imprinted genes in human diseases. The latter aspect is highlighted by the fact that in several rare but informative kindreds with PWS or AS germline deletions of relatively small intervals of DNA spanning an `imprinting center' near the 5' end of the SNRPN gene prevent the appropriate resetting of the functional and methylation imprint of multiple 15q11-q13 loci during gametogenesis (1 ,3 ). It is thought that, at least in PWS, the coordinate silencing (inappropriate imprinting) of multiple loci produces a contiguous multigene effect, with silencing of multiple genes leading to the disease phenotype. In principal, a domain effect of this type could also occur in WTs and/or in BWS. Indeed, there is already good evidence for coordinately altered expression of two contiguous 11p15.5 genes, IGF2 and H19, in a large subset of WTs and in rare cases of BWS. In about half of WTs which retain 11p15.5 heterozygosity inactivation of H19 via biallelic hypermethylation correlates with a reciprocal biallelic activation of the oppositely imprinted and closely linked IGF2 gene (16 -18 ). These tumors therefore have a normal 11p15.5 genotype but a bipaternal epigenotype, at least at these two loci. In at least two WT patients this pattern was observed not only in the tumor but also in the non-neoplastic kidney parenchyma (16 ) and some individuals with BWS also show this pattern, with H19 hypermethylated and inactive and IGF2 biallelically active, in their non-neoplastic tissues (19 ).

However, the reciprocal alterations in expression of H19 and IGF2 may reflect a local regulatory circuit based on mutually exclusive occupancy by the promoters of these genes of a single enhancer element, i.e. `enhancer competition' (20 ). This raises the issue of whether there is disruption of functional imprinting in WTs over a more extended region such as that implicated in PWS. A potentially significant difference between the two conditions would seem to be the timing of the critical events; disruption of imprinting in PWS is a gametic process while the conversion to a bipaternal epigenotype in WTs appears in most if not all cases to reflect a somatic event in a tumor precursor cell. To determine whether there is conversion to a bipaternal epigenotype over multiple 11p15.5 loci in WTs it will be necessary to carry out a gene-by-gene analysis of functional and methylation imprinting analogous to that which has been undertaken in the PWS/AS region. Here we describe a comparative analysis of this type for the KIP2 and H19 genes.

RESULTS

KIP2 allelic expression in normal human tissues and WTs

To assess possible functional imprinting of human KIP2, we first searched for exonic polymorphisms within this gene. We focused on a region including the complex repetitive sequence in exon 2 which contains various G/C-rich 5-7 bp repeats. When this region was amplified by genomic PCR and the products separated on denaturing acrylamide gels genomic DNAs from about half of individuals examined yielded two distinct allelic bands (Figs 1 , 2 ). Sequencing of the two alleles in several individuals showed that the length differences reflected a variable G/C-rich insertion/deletion polymorphism at the 5' border of the repetitive region, with the polymorphic region of the repeat beginning in some individuals at position 1710 of the genomic sequence (accession D64137) and extending roughly to position 1755. We next amplified genomic DNAs and cDNAs in parallel using exon 2 upstream and exon 4 downstream PCR primers (p1 and p3, Fig. 1 ). Since two introns were encompassed by the primers, the cDNA products could be distinguished from the variable background resulting from contaminating genomic DNA. Comparison of matched PvuII restriction fragments of the radiolabeled genomic and cDNA products on denaturing gels showed a consistent allelic bias in the cDNA lanes (Fig. 2 ). This allelic bias was reproducible in multiple analyses of independent cDNA preparations and aliquots, indicating that it was not an artifact from amplification of limiting amounts of cDNA. Also, since either `upper' (long) or `lower' (short) alleles could be found as the predominantly expressed allele in different individuals, the apparent allelic expression bias was not an artifact of differential amplifiability of the two classes of alleles. Densitometry of lightly exposed autoradiograms showed that the predominantly expressed KIP2 allele gave rise to 66-90% of the total steady state mRNA (Table 1 ). The allelic expression bias was seen in a variety of fetal, juvenile and adult human tissues, including fetal kidney and skeletal muscle, the precursor tissues of WTs and another embryonal tumor with recurrent maternal chromosome 11p15.5 LOH, embryonal rhabdomyosarcoma (RMS).


Figure 1. Positions of probes, PCR primers and methylation-sensitive restriction sites in the human KIP2 sequence. The polymorphic repeat region in exon 2 is hatched. R = RsaI, P = PvuII.


Figure 2. (A) PCR analysis of allelic representation in KIP2 cDNAs. c = cDNA; g = genomic DNA. F = father; M = mother. Ki = kidney, Skm = skeletal muscle, Lu = lung, Te = testis. The genomic and cDNA bands are of comparable size since the labeled PCR products have been digested with PvuII prior to electrophoresis. Multiple analyses for some of the tissues are shown to illustrate the reproducibility of the observed allelic bias. (B) Parental origin of the lost allele in WT802 established by PCR/RFLP analysis at the LWY-EcoRI polymorphism linked to H19. The lower allele, which must be maternal, is lost from the tumor.

Table 1 . KIP2 allelic expression bias in normal human tissues and in a WT with retention of chromosome 11p15.5 heterozygosity
Tissue (case number)

 cDNA from imprinted allele
Fetal skeletal muscle (673)

 0.10
WT (614)

 0.20
Juvenile kidney (614)

 0.16
Juvenile kidney (802)

 0.14
Juvenile kidney (650)

 0.18
Adult kidney (628)

 0.24
Newborn kidney (826)

 0.22 (0.19, 0.28)
Newborn skeletal muscle (826)

 0.30
Fetal testis (366)

 0.15
Fetal skeletal muscle (367)

 0.34 (0.36, 0.32)
Fetal kidney (642)

 0.22

To determine the parental origin of the functionally imprinted KIP2 allele (defined conventionally as the transcriptionally repressed allele) we analyzed genomic DNA and cDNAs from the non-neoplastic kidney of a patient with WT and from the WT itself in parallel with genomic DNAs from both parents by PCR with the KIP2 primers and with primers spanning a second informative polymorphism (referred to as LWY-EcoRI) downstream of the H19 gene (Fig. 2 a,b, WT802). In this case the tumor had lost 11p15.5 heterozygosity, reflected in the loss of the upper KIP2 and lower LWY-EcoRI allelic bands in the genomic lanes. The lost alleles in this case were maternal, as indicated by the LWY-EcoRI analysis, and the lost allele was the more highly expressed one in the KIP2 cDNA analysis of the non-neoplastic kidney. The cDNA analysis also showed that the WT cells continued to express detectable KIP2 mRNA and did so from the retained imprinted paternal allele, with slight residual maternal KIP2 expression most likely deriving from non-neoplastic stromal elements in the tumor. These data indicated that, as in mice, human KIP2 is paternally imprinted, and that WTs with (maternal) LOH lose the more transcriptionally active allele of this gene.

We next wished to compare the stringency of KIP2 imprinting with that of H19. Previous studies of allelic expression of human H19 in fetal and adult tissues have not shown significant expression from the imprinted allele (except in placenta) but these have relied primarily on detection of the allelic bands by ethidium bromide staining rather than by radiolabeling. To quantitatively compare KIP2 and H19 functional imprinting we carried out reverse transcription-PCR/RFLP analysis of H19 RNA (4 ,6 ) in a heterozygous case and subjected the gels to Southern blotting with a radiolabeled H19 probe. Densitometry showed that in newborn skeletal muscle and kidney (from case 826; KIP2 analysis shown in Table 1 and Fig. 2 ) the imprinted H19 allele did produce detectable RNA transcripts but that the band intensities were less than 5% of those from the active allele (data not shown). Thus, in these tissues human H19 is subject to more stringent functional imprinting than KIP2.

KIP2 and H19 DNA methylation in normal and tumor tissues

The KIP2 gene resembles H19 in its structure: it is a small gene with small introns and it contains a high density of CpG dinucleotides not only in its 5' promoter region but also throughout the transcribed region. Methylation of CpGs in the promoter and body of the human H19 gene is highly allele-specific, with the imprinted paternal allele showing complete methylation of each of 20 HpaII (CCGG) and 12 CfoI (GCGC) sites roughly evenly distributed over a 3.5 kb region including the gene and its minimal promoter and the active maternal allele lacking methylation of all or most of these sites (6 ,16 -18 ). That this allele-specific methylation might have a role in maintenance of the functional imprint is suggested by the activation of the paternal H19 allele in DNA methyltransferase-deficient mice (21 ) and by the fact that 5-azacytidine can reactivate the silent H19 allele in human tumor cells in culture (22 ). Also, WTs which retain the maternal H19 allele frequently show transcriptional inactivation of this allele correlating with pathological CpG hypermethylation (16 -18 ). The human KIP2 gene is even more CpG-rich than H19: it contains 74 HpaII sites and 62 CfoI sites distributed over a 3.2 kb region (Fig. 1 ). Allele-specific DNA methylation, with the imprinted paternal allele more highly methylated, was previously reported for mouse KIP2 (13 ). For these reasons we wished to assess CpG methylation of human KIP2 DNA.

To map DNA methylation within the KIP2 gene we used a Southern blotting approach similar to that which we previously applied in studies of the H19 gene (6 ,16 ). Genomic DNAs from normal fetal and adult tissues, a series of WTs and one case of RMS were digested with a non-methylation-sensitive restriction enzyme (RsaI for most blots) either with or without a second methylation-sensitive enzyme (CfoI or HpaII for most blots). The digested DNAs were subjected to Southern blotting with probes for the 5' upstream region, exon 1 or exon 2-3 of the KIP2 gene and, for comparison, with corresponding probes for the H19 gene. In this assay, digestion of the high molecular weight bands to lower molecular weight bands by the methylation-sensitive enzymes indicates hypomethylation and persistence of high molecular weight bands indicates hypermethylation. Normal fetal, juvenile and adult kidney and skeletal muscle DNAs and DNAs from a series of 19 WTs, one adrenal cortical carcinoma and one RMS were subjected to this analysis using the three KIP2 probes shown in Figure 1 . The tumors in this series could be grouped into three classes with respect to 11p15.5 allelic loss and H19 epigenotype: (i) those with 11p15.5 LOH (the RMS and ADCC and 7 WTs); (ii) those with retention of heterozygosity but with biallelic H19 hypermethylation and loss of H19 expression (7 WTs); and (iii) those with retention of heterozygosity with normal H19 allelic methylation and high H19 expression (5 WTs).

With each of the three probes, all normal tissues and all 21 tumors, regardless of 11p5.5 allelic status or H19 DNA methylation status showed digestion of KIP2 DNA to fragments of less than or equal to 200-250 base pairs (bp) with CfoI or HpaII. Examples in control tissues and two of the tumors are shown in Figure 3 a. The fact that the tumors with LOH did not show detectably different band patterns compared to the normal tissues supports the conclusion that the imprinted KIP2 allele is not widely hypermethylated. Comparison with the band patterns obtained when the same blots were hybridized with the H19 probes highlights the contrast between the widespread hypomethylation of human KIP2 DNA and the widespread hypermethylation of the imprinted H19 allele. Consistent with previous studies, this hypermethylation was seen as complete resistance to digestion of the imprinted H19 allele in normal tissues and of both alleles in the tumors with LOH or with epigenetic H19 inactivation (Fig. 3 a and data not shown). No structural rearrangements or deletions of KIP2 or H19 DNA were detected in Southern blots of the tumor samples.


Figure 3. (A) Examples of Southern blot comparisons of DNA methylation of KIP2 and H19 in normal tissues and WTs. R = RsaI, C = CfoI, H = HpaII. The H19 RsaI lanes show two allelic bands in informative heterozygous samples; WT514 and WT520 both retained 11p15.5 heterozygosity, as indicated by other markers (29), but they are not heterozygous at the H19 RsaI RFLP. Full resistance to digestion of the RsaI bands with CfoI and HpaII in these samples reflects biallelic H19 hypermethylation. KIP2 showed biallelic hypomethylation with all three of the probes shown in Fig. 1 and none of 21 tumors examined showed KIP2 hypermethylation sufficient to generate protected bands greater than 200-250 bp in Southern blot analysis. The faint band between the 1.5 and 0.6 kb markers in the KIP2 exon 2-3 analysis is presumed to represent a cross-hybridizing genomic sequence. (B) Methylation analysis of the first exon region of murine KIP2.

Since DNA fragments of less than about 100 bp are not well visualized by Southern blotting the results to this point indicated the absence of any continuous intervals in KIP2 DNA which are fully methylated at CfoI or HpaII sites over more than 200-250 bp, but did not exclude the possibility of methylation of interspersed sites. To test the methylation of a set of specific CpG dinucleotides genomic DNAs were digested with the infrequently-cutting methylation-sensitive restriction enzymes ApaI and XhoI (ApaI does not contain an internal CpG in its recognition sequence but is sensitive to methylation of the last C residue-all ApaI sites in KIP2 are bordered by 3' G residues and therefore should show methylation dependence). With both enzymes there was complete digestion to the predicted fragments indicating lack of CpG methylation of at least 75% of ApaI sites and at least 75% of XhoI sites distributed through the 5' half of the gene (data not shown). Higher resolution methods such as direct methylation-sensitive genomic sequencing will be required to carry out finer mapping of KIP2 DNA methylation. One region of particular interest for this type of mapping will be the repetitive region in exon 2, which contains the highest density of CpGs. However, even this region must contain at least several unmethylated CpGs on both alleles since genomic DNAs of a WT with 11p15.5 LOH (WT802) and the corresponding non-neoplastic kidney predigested individually with CfoI, HpaII, NarI, SacII or SmaI could no longer be amplified by PCR with the flanking primers P1 and P2 (data not shown).

The widespread hypomethylation of human KIP2 was somewhat unexpected in view of the previous reports of easily detectable allele-specific DNA methylation at the murine KIP2 locus (13 ). Since that study used a PCR method to assess methylation, we wished to directly compare DNA methylation of the mouse and human genes by Southern blotting. In contrast to the results obtained for the human gene, when neonatal mouse kidney DNA was examined by this method using a KIP2 first exon probe it was found to be fully resistant to digestion with CfoI and partially resistant to digestion with HpaII (Fig. 3 b). This indicated complete methylation of all CfoI sites and, for some of the chromosomes, all HpaII sites in a region of 1.1 kb including the first exon. While we have not tested the allele-specificity of this methylation, the HpaII digestion pattern is consistent with the presence of allele-specific methylation since both a fully protected band and lower molecular weight bands are present. These results are consistent with the previous data in the murine system and suggest that at least in some strains the mouse KIP2 gene may be more highly methylated than its human counterpart. That this might in turn be correlated with more stringent functional imprinting is suggested by the previously published reverse transcription-PCR data (13 ), which appear to show monoallelic expression of the mouse gene. The stringency of methylation imprinting of transgenes can clearly vary among mouse strains (23 ,24 ) and variable functional imprinting of the IGF2R gene has been reported in humans (25 ). It would not be surprising if such variation was also present at the KIP2 locus. Indeed this is already suggested by the different proportions of KIP2 mRNA expressed from the imprinted allele in skeletal muscle from two different fetuses in our series (Table 1 ).

Table 2 . KIP2 and H19 RNA expression in primary tumors and RD cells (northern)
Case

 11p15.5 alleles

 H19 me-CpG

 H19 RNA

 KIP2 RNA

 KIP2 RNA
 

  

  

 (northern)

 (RPA)

WT251

 LOH

 +/+

 <0.05

 0.18

  
WT540

 LOH

 +/+

 <0.05

 0.40 (+/-0.10)

 0.34
WT802

 LOH

 +/+

 <0.05

 0.22

  
WT667

 LOH

 +/+

 <0.05

 0.11 (+/-0.06)

  
WT753

 LOH

 +/+

 <0.05

 0.20

  
WT616

 LOH

 +/+

 <0.05

 0.06

 0.15
WT521

 LOH

 +/+

  

 <0.05

  
WT903

 LOH

 +/+

 <0.05

 <0.05

  
RMS663

 LOH

 +/+

 0.05

  

 0.12
 

  

  

  

  

  
WT428

 ROH

 +/+

 <0.05

 <0.05

  
WT511

 ROH

 +/+

 <0.05

 <0.05

  
WT614*

 ROH

 +/+

 0.10

 1.35

  
WT515

 ROH

 +/+

 <0.05

 0.07

  
WT516

 ROH

 +/+

 <0.05

 0.25

  
WT517

 ROH

 +/+

 <0.05

 <0.05

  
WT899

 ROH

 +/+

 <0.05

 <0.05

  
 

  

  

  

  

  
WT537

 ROH

 +/-

 >1

 0.45

 0.40
WT564

 ROH

 +/-

 >1

 0.61 (+/-0.15)

  
WT650

 ROH

 +/-

 >1

 0.05 (+/-0.03)

  
WT914

 ROH

 +/-

 0.80

 0.42

  
 

  

  

  

  

  
RD control

  

 +/+

 <0.05

 0.05

  
RD+0.5 [mu]M aza-C

  

 +/-

 0.50

 0.06

  
RD+1.0 [mu]M aza-C

  

 +/-

 0.48

 0.06
Values for RNA expression are relative to fetal kidney. Fetal skeletal muscle, the presumed precursor tissue of RMS, expresses about twice as much H19 RNA as fetal kidney and about the same amount of KIP2 mRNA (Fig. 5 and data not shown).Values in parentheses are the standard errors obtained from three or four repeated determinations. LOH = loss of heterozygosity; ROH = retention of heterozygosity. +/+ = biallelic DNA hypermethylation; +/- = monoallelic DNA hypermethylation. *WT614 was an unusually well-differentiated tumor which was felt to be a WT by some pathologists but was classified as nephrogenic adenofibroma by a consultant pathologist (B. Beckwith, National Wilms' Tumor Study Group).

Induction of H19 RNA but not KIP2 mRNA by aza-C exposure of RD cells

The demethylating drug aza-C is a covalent inhibitor of the cytosine DNA methyltransferase which has been widely used as a probe for the methylation-dependence of expression of various genes, notably those which are imprinted or subject to inactivation on the X chromosome. To test for the methylation dependence of KIP2 expression we exposed RD cells, a permanent line derived from an embryonal RMS which shows a structurally normal KIP2 gene at the level of Southern analysis, to 0.5 or 1 [mu]mol concentration of aza-C for 10 days, followed by incubation in medium lacking the drug. Both drug concentrations induced a complete and permanent growth arrest of the cells without acute toxicity. The cells became enlarged and frequently multinucleated and elongated forms were observed. These persisted on the plates with only a slow decrease in cell number for up to 2 weeks after withdrawal of the drug (data not shown). Total RNA and DNA was prepared from control cells and aza-C-treated cells 4 days after the drug pulse. Southern blotting with the H19 exon 3-5 probe indicated conversion from a band pattern indicating complete (biallelic) H19 DNA methylation in the control RD cells to one which precisely matched the normal monoallelic hypermethylation of fetal skeletal muscle in the aza-C-treated RD cells (data not shown). As expected, northern blotting indicated that the drug treatment had caused a marked increase (greater than 20-fold) in H19 RNA, accompanied by a less marked (2-fold) decrease in IGF2 mRNA (Fig. 4 a and Table 2 ). In contrast, quantitation of KIP2 mRNA by RNAse protection assay (RPA) showed that the steady-state levels of this transcript were unaffected by the drug treatment, remaining at low levels in the treated cells (Fig. 4 b and Table 2 ).


Figure 4.Northern blot analysis of KIP2 and H19 RNA in fetal kidney, WTs and a primary RMS. The KIP2 autoradiogram was exposed for 2 days; the H19 and GAPDH autoradiograms were exposed for 2 h. Each of the tumors analyzed on this blot had lost 11p15.5 heterozygosity. Densitometric comparisons were made on the upper KIP2 band, since this transcript has the size of the full-length protein-coding cDNA.

KIP2 and H19 RNA expression in primary tumors

That both KIP2 and H19 are paternally imprinted suggests a priori that the levels of their transcripts might be coordinately reduced in embryonal tumors with loss of maternal chromosome 11p15.5 alleles, but since the functional imprinting of human KIP2 is `leaky' and since at least some WTs with 11p15.5 LOH continue to express KIP2 mRNA from the retained (duplicated) paternal allele, a quantitative assessment of KIP2 mRNA was of interest. We also wished to examine KIP2 expression in the two classes of WTs without LOH; those with and without conversion to a bipaternal H19/IGF2 epigenotype. Since KIP2 mRNA levels are low even in normal tissues sensitive detection methods were required. KIP2 mRNA was measured by northern blotting of poly-A enriched RNA and by RPA using a KIP2 RNA probe which spanned parts of exons 3 and 4 and a control GAPDH RNA probe (Fig. 4 b,c). The precision of the RPA was shown in three ways: a series of five different fetal kidneys all gave very similar results (Fig. 4 b and data not shown), repeated analyses of several of the WTs showed small standard errors (Fig. 4 b and Table 2 ) and the northern blotting results correlated well with the RPA data (Fig. 4 b,c and Table 2 ).

All WTs with 11p15.5 LOH, as well as the RMS, expressed KIP2 mRNA at levels less than fetal kidney, but there was variation among the cases, with expression ranging from 40 to less than 5% of fetal kidney levels. Among the WTs which retained both KIP2 alleles the mRNA levels were more variable, with some cases showing markedly reduced expression and others showing intermediate or high expression (Fig. 5 and Table 2 ). In these cases there was no absolute correlation of KIP2 expression with H19 expression or DNA methylation, but a general trend was apparent: KIP2 mRNA was markedly reduced in five of the seven WTs with retention of heterozygosity but epigenetic inactivation of H19, while the group of tumors with retention of heterozygosity and persistent H19 RNA expression had the highest mean KIP2 mRNA levels, with markedly reduced expression in only one of four cases (Table 2 ).


Figure 5. (A) Northern blot analysis of H19 and IGF2 RNA in aza-C-treated RD cells with comparison to fetal muscle and a WT. (B) RPA analysis of KIP2 mRNA in normal tissues, aza-C-treated RD cells and WTs. FSkm = fetal skeletal muscle.

The northern blots showed three KIP2 mRNA bands of different sizes, with the predominant band in the normal fetal kidney and other tissues at about 1.7 kb and the two minor bands corresponding to shorter transcripts which show alternative splicing; the reduction in KIP2 expression in the WTs with 11p15.5 LOH reproducibly reflected a reduction in the major 1.7 kb band and the next largest transcript, with minor if any reductions of the smallest transcript (Fig. 4 and data not shown). If the smallest transcript derives from a distinct promoter then this could reflect promoter-specific imprinting of KIP2 analogous to that which has been reported for the IGF2 gene (26 ).

DISCUSSION

The absolute maternal bias in loss of 11p15.5 alleles in several types of human embryonal tumors including WT and RMS suggests the presence in this chromosomal region of one or more paternally imprinted tumor suppressor genes (27 ). Since LOH in these tumors is due to mitotic recombination and is coupled to the duplication of paternal alleles it is also possible that overexpression of one or more maternally imprinted growth promoting genes contributes to the progression of these tumors (28 ). Loss of 11p15.5 alleles in WTs involves the entire chromosomal sub-band in most if not all cases (29 ). According to the classical two-hit paradigm for loss of tumor suppressor genes a single gene in this region would be expected to be primarily responsible for promoting tumorigenesis, but alternatively tumorigenesis could reflect a one-hit coordinate loss or gain of expression of multiple imprinted growth-regulatory genes.

Recent data pointing to a domain-like clustering of imprinted genes in mouse and human chromosomes make this latter possibility increasingly attractive. The two best characterized putative imprinted domains are the chromosome 15q11-q13 PWS/AS region in humans and the chromosome 11p15.5 region in humans and a syntenic region of chromosome 7 in mice. Each of these chromosomal regions is known to contain at least five distinct imprinted genes or transcripts. It seems likely that additional imprinted genes are awaiting characterization in both of these regions and the question of whether the human diseases which map to these regions are effectively contiguous multigene syndromes is an important one.

Our finding of a reproducible allelic expression bias at the human KIP2 locus in normal tissues, with functional imprinting of the paternal allele, is in good agreement with recent findings of Kondo et al. in lung (30 ) and Matsuoka et al. in various tissues and in WTs (31 ). Based on the imprinting of KIP2, Matsuoka et al. suggest that the WT phenotype may reflect a disruption of imprinting of multiple chromosome 11p15.5 genes (31 ). Our quantitation of total KIP2 mRNA levels in a large series of WTs and our correlation of these data with H19 RNA levels provides some direct support for this notion. The finding of reduced KIP2 mRNA and H19 RNA, linked with increased IGF2 mRNA, in all WTs with 11p15.5 LOH, together with the predicted biological activities of these genes (growth suppression for KIP2 and H19 and growth promotion for IGF2) suggests that the WT phenotype may depend at least in part on the coordinately altered expression of these three genes. The reductions in KIP2 mRNA relative to fetal kidney levels are rather moderate in some of the WTs, but if the growth-inhibitory activity of p57/KIP2 protein is highly dose-dependent then this could still be physiologically significant. The situation in the WTs which retain both parental alleles is more complex since these cases have a wider range of KIP2 and H19 expression and since there is a general but not absolute correlation between the expression of these two genes in the tumors. The clear exceptions to the general correlation in our series were two cases (WTs 614 and 650, Table 2 ). It is interesting to note that the one case with aberrantly high KIP2 expression (WT614) was an unusually well-differentiated epithelial-predominant tumor which was classified as nephrogenic adenofibroma by a consultant pathologist.

Since most WTs which retain 11p15.5 heterozygosity and inactivate H19 epigenetically also show reductions in KIP2 mRNA it is possible that these cases have undergone disruption of functional imprinting of these two genes by a concerted process, but it is also possible that the two genes have both been selected for inactivation by independent mechanisms. The exceptional case in our series with high H19 expression and low KIP2 expression (WT650) certainly appears to have inactivated KIP2 by a mechanism unrelated to regional disruption of genomic imprinting. Some progress in resolving these ambiguities might be made by identifying an area of definite allele-specific DNA methylation within the human KIP2 gene or in linked regulatory sequences and then correlating the methylation of this sequence with that of H19 in the tumors, but examination of the functional and methylation imprinting of additional 11p15.5 genes in WTs will be more critical to test whether there is true regional disruption of imprinting in these tumors.

Somewhat unexpected findings in the current study were the overall biallelic hypomethylation of KIP2, both in normal tissues and in WTs and RMS, and the lack of activation of KIP2 mRNA expression in RD cells by concentrations of the demethylating agent aza-C which markedly affected H19 and IGF2 RNA levels in these cells. In fact, not all imprinted genes have shown easily detectable allele-specific methylation: the best precedent is the Igf2 gene in mice and its counterpart in humans. Both have shown only subtle allele-specific methylation of uncertain functional significance (19 ,32 ). This lack of a definite methylation imprint probably reflects the fact that functional imprinting at this locus is maintained, though perhaps not initiated (33 ), by `enhancer competition' with the downstream H19 gene, a gene which bears a very definite methylation imprint (34 -36 ). This reciprocal interaction with H19 probably underlies the sensitivity of IGF2 mRNA expression to treatment with aza-C-that the human KIP2 gene does not show a widespread methylation imprint and that KIP2 mRNA levels are insensitive to aza-C, at least in RD cells, suggests three possibilities: (i) the maintenance of imprinting of human KIP2 might not be critically dependent on DNA methylation; (ii) there may be functionally important methylated sites in or near KIP2 which are unusually resistant to demethylation by aza-C; or (iii) RD cells may have down-modulated KIP2 by a non-methylation dependent pathway unrelated to perturbation of the normal imprinting mechanism, for example, by mutation of a regulatory sequence or by loss of expression of a transcription factor required for high level induction of KIP2 mRNA.

In conclusion, it appears increasingly likely that Wilms' tumor formation is promoted by the aberrant expression of multiple imprinted genes in an extended domain of chromosome 11p15.5, with a bipaternal epigenotype not only in the cases with LOH but also in about half of the cases which retain heterozygosity. Mitotic recombination is a sufficient explanation for the bipaternal endpoint in the tumors with LOH-whether there is a comparable single molecular event which accounts for disruption of imprinting of this domain in the precursor cells of WTs which retain 11p15.5 heterozygosity is an intriguing open question.

MATERIALS AND METHODS

DNA and RNA methods and polymorphism analysis

DNA was prepared by SDS/proteinase K digestion and phenol/chloroform extraction and RNA was prepared by extraction with Tri-reagent (Sigma) and in some cases subjected to mRNA enrichment by oligo-dT chromatography. Southern blotting for DNA methylation analysis was carried out as described (6 ). For northern analysis 3-4 [mu]g of poly-A enriched RNA was separated on 1% formaldehyde-agarose gels. For RPA total RNA, 10 [mu]g, was hybridized with a high specific activity KIP2 riboprobe and a lower specific activity GAPDH riboprobe for 16-20 h at 43oC and then digested with RNAse(RPAII kit, Ambion). Protected fragments of 255 bp (KIP2) and 220 bp (GAPDH) were resolved on 10% denaturing acrylamide gels. The LWY-EcoRI polymorphism is a newly identified marker located approximately 80 kb downstream of H19 and was detected using PCR primers listed below. Cycling conditions were an initial denaturation for 4 min at 94oC followed by 30 cycles of annealing at 52oC for 30 s, extension at 72oC for 1 min and denaturation at 94oC for 1 min, with a final extension at 72oC for 7 min. cDNAs were generated using Superscript MLV reverse transcriptase (GIBCO-BRL) with oligo-dT primer. The KIP2 repetitive sequence polymorphism was detected by PCR with exon 2 upstream and exon 4 downstream primers (p1 and p3, below). Cycling conditions were an initial denaturation for 5 min at 95oC followed by 20 cycles of annealing at 58oC for 30 s, extension at 72oC for 2 min and denaturation at 95oC for 1 min, a second set of 10 cycles with the annealing time reduced to 10 s and a final extension at 72oC for 5 min. For reliable amplification it was necessary to use a `hot-start', to include 5% DMSO in the PCR buffer and to use a long template thermostable DNA polymerase mixture (Expand Taq polymerase, Boehringer- Mannheim). After gel isolation of the appropriate bands 10 additional cycles of PCR were carried out under the same conditions (with 10 s annealing) using exon 2 upstream and exon 2 downstream primers radiolabeled with [gamma]32P-ATP and T4 kinase. The labeled PCR products were digested with PvuII and resolved on 6% denaturing acrylamide gels. Band intensities in linear range exposures of RPA and northern blot autoradiograms were measured using a Macintosh flatbed scanner and Image 1.49 software (NIH).

DNA and RNA probes and PCR primers

The H19 DNA probes have been previously described (6 ). The KIP2 DNA probes are shown in Figure 1 and were made by PCR using the following primers: (5' region probe) 5' region upstream: TGGAGTGGTCTGGCCCAAG; 5' region downstream: CCGCGATTAGCATAATGTAG (exon 1 probe) exon 1 upstream: CTACATTATGCTAATCGCGG; intron 1 downstream: AGGAGAGG- ACAGCGAGAAGA (exon 2-3 probe) exon 2 upstream (p1): CCGAAGTGGACAGCGACTCG; exon 4 downstream (p3): AAAACCGAACGCTGCTCTG.

The exon 2 downstream primer (p2) used in the labeling step of the KIP2 polymorphism analysis was CTGGTCAGCGAGAGGCTCCT. The mouse KIP2 exon 1 probe was made with primers upstream CTCGAGGGGTGCCGGCTAG and downstream GAACGCGGGATGACAGCCA.

The RPA probes were generated by transcription from plasmids (PCR vector, InVitrogen) containing small cDNA inserts made by reverse transcription-PCR using the following primers: KIP2 RPA upstream (exon 3): GCCAAGCGCAAGAGATCAG; KIP2 RPA downstream = exon 4 downstream (above). GAPDH RPA upstream: ACCACAGTCCATGCCATCA; GAPDH RPA downstream: TCCACCACCCTGTTGCTGT.

Plasmids were constructed by direct ligations of the PCR products and the orientation of the inserts was determined by restriction mapping. Plasmids were linearized with HindIII (KIP2) and XbaI (GAPDH) prior to in vitro transcription of antisense riboprobes.

The primers for detection of the LWY-EcoRI polymorphism were: LWY-EcoRI upstream: TGCAATTGTTACAGGAGAG; LWY-EcoRI downstream: ATGAGACTGAGTCCTACT

ACKNOWLEDGEMENTS

This work was supported by grants RO1CA60765 from the NIH and JFRA482 from the ACS to BT.

REFERENCES

1 Sutcliffe, J.S., Nakao, M., Christian, S,. Orstavik, K.H., Tommerup, N., Ledbetter, D.H., and Beaudet, A.L. (1994) Nature Genet. 8, 52-58. MEDLINE Abstract

2 Wevrick, R., Kerns, J.A., and Francke, U. (1994) Hum. Mol. Genet. 3, 1877-1882. MEDLINE Abstract

3 Buiting, K., Saitoh, S., Gross, S., Dittrich, B., Schwartz, S., Nicholls, R.D., and Horsthemke, B. (1995) Nature Genet. 9, 395-400. MEDLINE Abstract

4 Zhang, Y., and Tycko, B. (1992) Nature Genet. 1, 40-44. MEDLINE Abstract

5 Rainier, S., Johnson, L., Dobry, C.J., Ping, A.J., Grundy, P.E., and Feinberg, A.P. (1993) Nature 362, 747-749. MEDLINE Abstract

6 Zhang, Y., Shields, T., Crenshaw, T., Hao, Y., Moulton, T., and Tycko, B. (1993) Am. J. Hum. Genet. 53, 113-124. MEDLINE Abstract

7 Ohlsson, R., Nystrom, A., Pfeifer-Ohlsson, S., Tohonen, V., Hedbourg, F., Schofield, P., Flam, F., and Ekstrom, T.J. (1993) Nature Genet. 4, 94-97. MEDLINE Abstract

8 Giannoukakis, N., Deal, C., Paquette, J., Goodyer, C.G., and Polychronakos, C. (1993) Nature Genet. 4, 98-101. MEDLINE Abstract

9 DeChiara, T.M., Robertson, E.J., and Efstratiadis, A. (1991) Cell 64, 849-859. MEDLINE Abstract

10 Bartolomei, M.S., Zemel, S., and Tilghman, S.M. (1991) Nature 351, 153-155. MEDLINE Abstract

11 Giddings S.J., King, C.D., Harman, K.W., Flood, J.F., and Carnaghi, LR. (1994) Nature Genet. 6, 310-313. MEDLINE Abstract

12 Guillemot, F., Caspary, T., Tilghman, S.M., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., Anderson, D.J.., Joyner, A.L., Rossant, J., and Nagy, A. (1995) Nature Genet. 9, 235-241. MEDLINE Abstract

13 Hatada, I., and Mukai, T. (1995) Nature Genet. 11, 204-206. MEDLINE Abstract

14 Matsuoka, S., Edwards, M.C., Bai, C., Parker, S., Zhang, P., Baldini, A., Harper, J.W., and Elledge, S.J. (1995) Genes & Dev. 9, 650-662.

15 Hoovers, J.M.N., Kalikin, L.M., Johnson, L.A., Alders, M., Redeker, B., Law, D.J., Bliek, J, Steenman, M., Benedict, M. Wiegant, J., Lengauer, C. Taillon-Miller P., Schlessinger, D., Edwards, M.C., Elledge, S.J., Ivens, A., Westerveld, A., Little, P. Mannens, M., and Feinberg, A. (1995) Proc. Natl Acad. Sci. USA 92, 12456-12460.

16 Moulton, T., Crenshaw, T., Hao, Y., Moosikasuwan , J., Lin, N., Dembitzer, F., Hensle, T., Weiss, L., McMorrow, L., Loew, T., Kraus, W., Gerald, W., and Tycko, B. (1994) Nature Genet. 7, 440-447. MEDLINE Abstract

17 Steenman, M.J.C., Rainier, S., Dobry, C.J., Grundy, P., Horon, I.L., and Feinberg, A.P. (1994) Nature Genet. 7, 433-439.

18 Taniguchi, T., Sullivan, M.J., Osamu, O., and Reeve, A. (1995) Proc. Natl Acad. Sci. USA 92, 2159-2163. MEDLINE Abstract

19 Reik, W., Brown, K.W., Schneid, H., Le Bouc, Y, Bickmore W., and Maher, E.R. (1995) Hum. Mol. Genet. 4, 2379-2385. MEDLINE Abstract

20 Leighton, P.A., Ingram, R.S., Eggenschwiler, J., Efstratiatis, A., and Tilghman, S.M. (1995) Nature 375, 34-39. MEDLINE Abstract

21 Li, E., Beard C., and Jaenisch, R. (1993) Nature 366, 362-365. MEDLINE Abstract

22 Tycko, B. (1996) Mut. Res., in press.

23 Sapienza, C., Paquette, J., Tran, T.H., and Peterson, A. (1989) Development 107, 165-168. MEDLINE Abstract

24 Allen, N.D., Norris, M.L., and Surani, M.A. (1990) Cell 61, 853-861. MEDLINE Abstract

25 Xu, Y., Goodyer, C.G., Deal, C., and Polychronakos, C. (1993) Biochem. Biophys. Res. Comm. 197, 747-754. MEDLINE Abstract

26 Vu, T.H., and Hoffman, A.R. (1994) Nature 371, 714-717. MEDLINE Abstract

27 Tycko, B. (1994) Am. J. Pathol. 144, 431-443. MEDLINE Abstract

28 Wilkins, R.J. (1988) Lancet i, 329-331.

29 Moulton, T., Chung, W.-Y., Yuan, L., Hensle, T., Waber, P., Nissen, P., and Tycko, B. (1996) Med. Ped. Oncol. (in press).

30 Kondo, M., Matsuoka, S., Uchida, K., Osada, H., Nagatake, M., Takagi, K., Harper, J.W., Takahashi, T., Elledge, S.J., and Takahashi, T. (1996) Oncogene 12, 1365-1368. MEDLINE Abstract

31 Matsuoka, S., Thompson, J.S., Edwards, M.C., Barletta, J.M., Grundy, P., Kalikin, L.M., Harper, J.W., Elledge, S.J., and Feinberg, A.P. (1996) Proc. Natl Acad. Sci. USA 93, 3026-3030. MEDLINE Abstract

32 Koide, T., Ainscough, J., Wijgerde, M., and Surani, M.A. (1994) Genomics 24, 1-8. MEDLINE Abstract

33 Szabo, P.E., and Mann, J.R. (1995) Genes & Dev. 9, 3097-3108.

34 Ferguson-Smith, A.C., Sasaki, H., Cattanach, B.M., and Surani, M.A. (1993) Nature 362, 751-755. MEDLINE Abstract

35 Brandeis, M., Kafri, T., Ariel, M., Chaillet, J.R., McCarrey, J., Razin, A., and Cedar, H. (1993) EMBO J. 12, 3669-3677. MEDLINE Abstract

36 Bartolomei, M.S., Webber, A.L., Brunkow, M.E., and Tilghman, S.M. (1993) Genes & Dev. 7, 1663-1673.

*To whom correspondence should be addressed+The first three authors contributed equally to this work

This page is maintained by OUP admin. Last updated Thu Oct 31 15:26:30 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
W. Han, Z. Wu, Y. Zhao, Y. Meng, Y. Si, J. Yang, X. Fu, and L. Yu
FHL2 interacts with and acts as a functional repressor of Id2 in human neuroblastoma cells
Nucleic Acids Res., July 1, 2009; 37(12): 3996 - 4009.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
G. Rothschild, X. Zhao, A. Iavarone, and A. Lasorella
E Proteins and Id2 Converge on p57Kip2 To Regulate Cell Cycle in Neural Cells.
Mol. Cell. Biol., June 1, 2006; 26(11): 4351 - 4361.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
N Diaz-Meyer, Y Yang, S N Sait, E R Maher, and M J Higgins
Alternative mechanisms associated with silencing of CDKN1C in Beckwith-Wiedemann syndrome
J. Med. Genet., August 1, 2005; 42(8): 648 - 655.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
N. Sato, H. Matsubayashi, T. Abe, N. Fukushima, and M. Goggins
Epigenetic Down-Regulation of CDKN1C/p57KIP2 in Pancreatic Ductal Neoplasms Identified by Gene Expression Profiling
Clin. Cancer Res., July 1, 2005; 11(13): 4681 - 4688.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
G. Li, J. Domenico, J. J. Lucas, and E. W. Gelfand
Identification of Multiple Cell Cycle Regulatory Functions of p57Kip2 in Human T Lymphocytes
J. Immunol., August 15, 2004; 173(4): 2383 - 2391.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
J. Li, A. J. Bench, G. S. Vassiliou, N. Fourouclas, A. C. Ferguson-Smith, and A. R. Green
Imprinting of the human L3MBTL gene, a polycomb family member located in a region of chromosome 20 deleted in human myeloid malignancies
PNAS, May 11, 2004; 101(19): 7341 - 7346.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
N Diaz-Meyer, C D Day, K Khatod, E R Maher, W Cooper, W Reik, C Junien, G Graham, E Algar, V M Der Kaloustian, et al.
Silencing of CDKN1C (p57KIP2) is associated with hypomethylation at KvDMR1 in Beckwith-Wiedemann syndrome
J. Med. Genet., November 1, 2003; 40(11): 797 - 801.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
S. Fujii, R. Z. Luo, J. Yuan, M. Kadota, M. Oshimura, S. R. Dent, Y. Kondo, J.-P. J. Issa, R. C. Bast Jr, and Y. Yu
Reactivation of the silenced and imprinted alleles of ARHI is associated with increased histone H3 acetylation and decreased histone H3 lysine 9 methylation
Hum. Mol. Genet., August 1, 2003; 12(15): 1791 - 1800.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
Y. Li, H. Nagai, T. Ohno, M. Yuge, S. Hatano, E. Ito, N. Mori, H. Saito, and T. Kinoshita
Aberrant DNA methylation of p57KIP2 gene in the promoter region in lymphoid malignancies of B-cell phenotype
Blood, September 18, 2002; 100(7): 2572 - 2577.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
W. Hartmann, A. Waha, A. Koch, C. G. Goodyer, S. Albrecht, D. von Schweinitz, and T. Pietsch
p57KIP2 Is Not Mutated in Hepatoblastoma but Shows Increased Transcriptional Activity in a Comparative Analysis of the Three Imprinted Genes p57KIP2, IGF2, and H19
Am. J. Pathol., October 1, 2000; 157(4): 1393 - 1403.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
S. Lai, H. Goepfert, A. M. Gillenwater, M. A. Luna, and A. K. El-Naggar
Loss of Imprinting and Genetic Alterations of the Cyclin-dependent Kinase Inhibitor p57KIP2 Gene in Head and Neck Squamous Cell Carcinoma
Clin. Cancer Res., August 1, 2000; 6(8): 3172 - 3176.
[Abstract] [Full Text]

Home page
 Hum Mol GenetHome page
N. Blagitko, S. Mergenthaler, U. Schulz, H. A. Wollmann, W. Craigen, T. Eggermann, H.-H. Ropers, and V. M. Kalscheuer
Human GRB10 is imprinted and expressed from the paternal and maternal allele in a highly tissue- and isoform-specific fashion
Hum. Mol. Genet., July 1, 2000; 9(11): 1587 - 1595.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
S. Muller, D. van den Boom, D. Zirkel, H. Koster, F. Berthold, M. Schwab, M. Westphal, and W. Zumkeller
Retention of imprinting of the human apoptosis-related gene TSSC3 in human brain tumors
Hum. Mol. Genet., March 22, 2000; 9(5): 757 - 763.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
V. Juan, C. Crain, and C. Wilson
Evidence for evolutionarily conserved secondary structure in the H19 tumor suppressor RNA
Nucleic Acids Res., March 1, 2000; 28(5): 1221 - 1227.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
N. Bourcigaux, V. Gaston, A. Logié, X. Bertagna, Y. Le Bouc, and C. Gicquel
High Expression of Cyclin E and G1 CDK and Loss of Function of p57KIP2 Are Involved in Proliferation of Malignant Sporadic Adrenocortical Tumors
J. Clin. Endocrinol. Metab., January 1, 2000; 85(1): 322 - 330.
[Abstract] [Full Text]

Home page
 J. Mol. Diagn.Home page
S. Gattenloehner, B. Dockhorn-Dworniczak, I. Leuschner, A. Vincent, H.-K. Müller-Hermelink, and A. Marx
A Comparison of MyoD1 and Fetal Acetylcholine Receptor Expression in Childhood Tumors and Normal Tissues: Implications for the Molecular Diagnosis of Minimal Disease in Rhabdomyosarcomas
J. Mol. Diagn., November 1, 1999; 1(1): 23 - 31.
[Abstract] [Full Text]

Home page
 Am. J. Pathol.Home page
J. G. Falls, D. J. Pulford, A. A. Wylie, and R. L. Jirtle
Genomic Imprinting: Implications for Human Disease
Am. J. Pathol., March 1, 1999; 154(3): 635 - 647.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
E. Adriaenssens, L. Dumont, S. Lottin, D. Bolle, A. Lepretre, A. Delobelle, F. Bouali, T. Dugimont, J. Coll, and J.-J. Curgy
H19 Overexpression in Breast Adenocarcinoma Stromal Cells Is Associated with Tumor Values and Steroid Receptor Status but Independent of p53 and Ki-67 Expression
Am. J. Pathol., November 1, 1998; 153(5): 1597 - 1607.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
T. Caspary, M. A. Cleary, C. C. Baker, X.-J. Guan, and S. M. Tilghman
Multiple Mechanisms Regulate Imprinting of the Mouse Distal Chromosome 7 Gene Cluster
Mol. Cell. Biol., June 1, 1998; 18(6): 3466 - 3474.
[Abstract] [Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
R. S. Hansen, T. K. Canfield, A. M. Stanek, E. A. Keitges, and S. M. Gartler
Reactivation of XIST in normal fibroblasts and a somatic cell hybrid: Abnormal localization of XIST RNA in hybrid cells
PNAS, April 28, 1998; 95(9): 5133 - 5138.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
J. Liu, A. I. Kahri, P. Heikkila, and R. Voutilainen
Ribonucleic Acid Expression of the Clustered Imprinted Genes, p57KIP2, Insulin-Like Growth Factor II, and H19, in Adrenal Tumors and Cultured Adrenal Cells
J. Clin. Endocrinol. Metab., June 1, 1997; 82(6): 1766 - 1771.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (85)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chung, W. Y.
Right arrow Articles by Tycko, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chung, W. Y.
Right arrow Articles by Tycko, B.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?