Ott, a mouse X-linked multigene family expressed specifically during meiosis
Ott , a mouse X-linked multigene family expressed specifically during meiosisShona M. Kerr*, Mary H. Taggart, Muriel Lee and Howard J. Cooke
Medical Research Council Human Genetics Unit, Western General Hospital, Crewe Road, Edinburgh EH4 2XU, UK
Received March 22, 1996;Revised and Accepted May 15, 1996
The tissue expression patterns of 10 mouse testis cDNAs were analysed by RT-PCR to search for new mammalian meiotic genes. The homologue of the rat synaptonemal complex protein gene SCP1 is expressed in embryonic ovary, adult brain and testis. One novel gene is stringently testis specific and another is expressed exclusively in testis and embryonic ovary. The latter clone is not expressed in the testes of adult sex-reversed mice which lack germ cells, and therefore represents a meiosis-specific gene. It is part of a mouse multigene family, members of which are clustered and map genetically and physically to a single region of the X chromosome. We have named this family Ott (ovary testis transcribed). Steady-state levels of a 2.3 kb polyadenylated Ott mRNA are high throughout meiotic prophase in the testis when the X chromosome is generally transcriptionally inactive. A second transcript of 1 kb is also detectable from 4 weeks of age onwards. The two mRNAs have different 3' ends and contain different protein coding information. At least seven Ott genes are transcribed specifically during meiosis and are predicted to encode `pioneer' proteins with an unusual structure, containing tandem arrays of a degenerate eight amino acid repeat. This work could lead to the identification of a human Ott homologue, which is likely to be X-linked and would provide a candidate locus for some cases of male infertility.
The process of meiosis is common to sexually reproducing organisms and consists of a series of steps which include DNA replication, pairing and recombination of homologous chromosomes, with two successive rounds of chromosome segregation. Many yeast meiotic mutants have been isolated and there are estimated to be at least 100 meiotically induced genes in Saccharomyces cerevisiae (1 ). Approximately 30 such genes, specifically expressed during meiosis and required for each step of the process, have been cloned. In mammals, defects in meiosis-specific genes might be expected to cause medically important problems such as aneuploidy, the main cause of pregnancy loss in humans, and infertility, which affects up to 10% of all couples. However, few mammalian meiosis-specific genes have been described. Those that have include components of the synaptonemal complex, a structure involved in pairing homologous chromosomes (2 ,3 ) and the XY body (4 ).
Several spermatogenesis genes are located on the mammalian Y chromosome, and deletions of specific regions of the Y can lead to sterility. If a meiotic gene is located on the X chromosome it could also be involved in some cases of male infertility. From the pachytene stage of male meiosis onwards, the X and Y chromosomes are condensed into the XY body and are thought to be transcriptionally inactive (reviewed in 5 ). In contrast, during female meiosis, the two X chromosomes pair and participate in recombination over their entire length and both are transcriptionally active (reviewed in 6 ). However, mechanisms exist to ensure that products from X-linked genes are present when required in the testis. Control of gene expression in the testis is complex, and differential splicing, alternative polyadenylation and translational control by mRNA storage have all been described. The 3'-untranslated region (3' UTR) is important in mediating some of these effects (reviewed in 7 ).
We have attempted to isolate new mammalian meiosis-specific genes by analysis of a collection of cDNAs obtained from prepubertal mouse testis via a simple clone selection and sequencing approach (8 ). Our initial criterion to select candidate genes was based on the assumption that many spermatogenic genes will be active only in the testis and many meiotic genes expressed only in germ cells, although this will exclude those genes which show biologically irrelevant expression in other tissues or have multiple functions. Analysis of expression has also been used by others to focus on promising clones (9 -11 ). This is important in view of the large number of novel testis cDNAs of unknown function which have been described recently in both mouse (8 ,11 ,12 ) and man (13 ,14 ). The huge recent increase in the number of database entries is due mainly to expressed sequence tags (ESTs) from somatic cells. If a testis clone is still novel this therefore increases the likelihood that it has a restricted pattern of expression.
Northern blot analysis showed that nearly half of the novel clones from our collection which could be assessed were testis-specific in their expression (8 ). To extend this work, the more sensitive technique of RT-PCR was used to determine the pattern of expression of some of these genes in mouse embryonic and adult tissues. Clone f252 from our collection (8 ), the initial single-pass sequence of which is 94% identical to the rat synaptonemal complex protein SCP1, provides a meiosis-specific standard for expression analyses. Analyses of four clones with similarity to genes involved in chromosome function, one clone with similarity to a mouse testis-specific RNA and five new sequences, all of which are testis-specific by northern blotting, are described here. One of the novel clones has an expression pattern which is apparently meiosis-specific. Structural and functional analyses of the X-linked multigene family from which this clone derives are presented.
Some of the genes required for meiosis in mammals should show a highly specific pattern of expression, as is the case for many yeast meiotic genes. Ten clones with an adult mouse testis-positive, brain- and kidney-negative pattern of expression by Northern blotting (8 ) were therefore analysed in more detail by RT-PCR. Four clones have similarity to proteins with functions which may be important in meiosis, one (b096) has similarity to a previously identified testis-specific RNA and, at the start of this analysis, five clones had no significant database match (Table 1 ). In summary, clone a005 is similar to the protein kinase encoded by the S.cerevisiae checkpoint gene BUB1 (15 ). The predicted protein from clone b080 matches the RNP consensus sequences RNP-1 and RNP-2 within an RNA recognition motif (16 ), with the top score the Drosophila melanogaster RNA binding protein La/SS-B (17 ). Rat and human ESTs with high similarity to the b080 DNA sequence have been reported recently. Clone f226 has several partially overlapping regions of high similarity to the 3' UTR of the hamster RCC1 (regulator of chromosome condensation) gene (18 ) and a weak match to the 3' end of the human RCC1 gene. Clone f252 is the mouse homologue (Sycp1) of the rat gene encoding the synaptonemal complex protein SCP1 (19 ). Longer and more accurate DNA sequences than the previous single-pass data were obtained for all 10 clones.
Northern blotting is relatively insensitive and requires large numbers of cells. RT-PCR is a more appropriate technique to assay expression in a wide variety of tissues and to analyse the small quantity of RNA available from embryonic ovary, which is where the early stages of meiosis occur in females. Thirty cycles of PCR amplification were performed, which means the reaction is no longer increasing exponentially. Primers for a ubiquitously expressed ribosomal protein were used as an internal control (Materials and Methods). The 10 clones pre-selected by northern blotting are expressed at high and broadly equivalent levels in testis. If, under the same conditions, the adult testis sample is strongly positive for the gene under analysis and another tissue is negative, while the control primers give a signal in all samples, it is reasonable to conclude that the gene is either not expressed in that tissue or is expressed at an extremely low level. The primer pairs used for RT-PCR are listed in Table 1 and the results summarized in Table 2 .
aClones are listed alphabetically with the names of longer cDNAs in brackets for b080 (st3) and f252 (n001). bSense (s) and antisense (as) primer sequences for RT-PCR are shown with the predicted PCR product sizes.
aE represents 18.5 day embryo samples, with all other samples from adult mice. Tissues are abbreviated as: b, brain; o, ovary; t, testis; h, heart; k, kidney; li, liver; lu, lung; p, placenta; s, spleen. + = strong signal, +- = weak signal, - = no signal. bS16 is a control ribosomal protein gene, other clones are as Table 1.
In most cases, mRNAs corresponding to the clones are expressed in a wide variety of embryonic and adult tissues, often including brain and kidney even though these were negative by northern blotting, demonstrating the greater sensitivity of RT-PCR. These genes may have important functions in meiosis but, because of their widespread expression, were not studied further. In contrast, clone b096 is only expressed in adult testis (Table 2 ). This clone has some sequence similarity to another testis-specific mRNA of unknown function from the mouse t-complex, pBs6.2 (20 ). The region of alignment is likely to be in the 3' UTR, as both sequences have stop codons in all three frames. This may represent a motif involved in some aspect of transcriptional or post-transcriptional regulation peculiar to the testis. Expression of the meiotic gene Sycp1 can be detected in adult brain in addition to 18.5 day embryo ovary and adult testis (Table 2 ). Low levels are detectable in 18.5 day embryo testis and increase throughout the first cycle of meiosis until the time at which the synaptonemal complex is formed. The ovary expression is predicted for a component of the synaptonemal complex but has not been demonstrated previously. The brain expression is not apparent by Northern analysis and there are several reports of otherwise testis-specific genes being expressed at low levels in brain [e.g. (10 )] but it is not clear whether this is functionally significant. Expression in brain is therefore not a good criterion for scoring a gene as non-meiotic. Clone b013 is only expressed in brain and testis, therefore, like b096, may be involved in spermatogenesis rather than meiosis. Finally, clone d030 is expressed exclusively in embryonic ovary and in testis and is a candidate meiosis-specific gene (Fig. 1 A).
Northern analysis indicates that the Ott cDNA hybridizes to two mRNAs in adult testis, of 2.3 and 1.0 kb. Both size classes are present in poly(A)-selected adult testis RNA (data not shown). RT-PCR detects Ott expression throughout prophase of the first male meiotic cycle from 6 to 16 days after birth (Fig. 1 B). RNA samples throughout testis development were also analysed by Northern blotting, to measure the steady-state level of each RNA species. Spermatogenesis occurs as a synchronized wave, so that at any given time in the first cycle the types of cell present are known. Figure 2 A, track 7, shows the two classes of hybridizing RNAs in adult mouse testis. Neither is detectable in adult ovary (lane 1) or brain (lane 8). Meiosis I in the female occurs during embryogenesis, so the lack of expression in adult ovary would be predicted for a meiosis-specific gene. The Ott primers also fail to detect expression in adult ovary by RT-PCR (data not shown). The heterogeneity in the observed testis signal is due, in part, to mRNAs with different numbers of repeat motifs (see below). The smaller RNA is absent from the 8-, 14- and 20-day-old testis samples, weakly present at 28-day (lane 5) and strongly in 35-day-old testis (lane 6). In contrast, the larger RNA slowly declines from the 8 day level towards adulthood. Approximately equal amounts of RNA were loaded in each track, as shown by the S16 ribosomal protein control (Fig. 2 B). At 14 days, early and mid-pachytene cells are present, and at day 20 diakinesis/metaphase I has been reached (22 ). Round spermatids will be detectable by day 28 and mature sperm by day 35; therefore, the smaller RNA approximately coincides with the appearance of haploid cells.
The northern analysis described above predicts the existence of two classes of cDNA. A 12/13 day and two adult mouse testis cDNA libraries were screened and a set of Ott clones of different insert sizes obtained and sequenced (Materials and Methods). The structure of these clones is summarized in Figure 3 . Clone f442 was identified in the initial set of 306 mouse testis cDNAs (8 ), a further indication of the high level of Ott gene expression in pre-pubertal testis. Sequence analysis of the clones reveals that the different sized inserts do not simply vary in the length of the 5' end, as would be expected for different cDNAs derived from the same mRNA. Firstly, two different sites of 3' end formation exist. The upstream site (I) is only observed in clones from adult testis, which would suggest it is used in the smaller mRNA described above. This was tested by probing northern blots with DNA from downstream of site I. The 1.0 kb species in adult testis RNA does not hybridize (data not shown), confirming that the smaller transcript terminates at a different position to the larger. Site I is not preceded by the conserved AAUAAA hexanucleotide, but a variant AUUAAA is present, and is present but not used in the longer clones. In contrast, the downstream site (II) used in the larger mRNA has the conserved hexanucleotide 14-17 bases from the poly(A) tail in different cDNAs. Interestingly, clones which use site II also contain U-rich elements, an important cleavage site determinant in the mammalian polyadenylation signal (23 ), 10-30 bases downstream of the point at which cleavage occurs in mRNAs which use site I.
The primers used in RT-PCR, F717/8 (Fig. 3 ), do not amplify mouse genomic DNA (data not shown), suggesting that all members of the Ott family contain at least one intron. In contrast, primers G322 and G364 which are respectively within and immediately downstream of the repetitive region give products of two size classes with Musmusculus genomic DNA as template. These correspond approximately by agarose gel electrophoresis to the two products described above for cDNAs ak27 and m11. Mus spretus genomic DNA under the same conditions only produces a product of the smaller size (data not shown). This difference allows genetic mapping in interspecific backcrosses between M.musculus and M.spretus, in the panel of animals backcrossed to M.spretus. PCR of DNA from an initial set of random animals from the EUCIB backcross (25 ) resulted in the mapping of the G322/G364 marker to the X chromosome. Further analysis of DNA from known recombinant animals (Materials and Methods) allowed fine mapping of the Ott marker between the anchor loci Plp and DXHar2 to a genetic position of 62 cM from the centromeric end (Fig. 6 A). The EUCIB backcross shows significant distortion of the transmission ratio of some X-linked alleles, which could reduce the accuracy of the Ott map position. The Jackson lab backcross (26 ) was therefore analysed by PCR as above. Of 88 animals which could be scored, the G322/G364 marker shows no recombinants with the DXMit34 marker at 63 cM on the X chromosome, in good agreement with the EUCIB results.
Figure 6.Genetic and physical mapping. (A) Schematic illustration of the mouse X chromosome showing EUCIB anchor markers, the Mecp2 control (27), and the position from backcross mapping of the G322/G364 PCR marker (Ott). (B) FISH with Ott (m11) cDNA and Mecp2 probes. (C) FISH with catch-linker DNA from YAC 20c4 as probe. (D) FISH with catch-linker DNA from YAC 100a4 as probe. The positions of hybridization are arrowed, and all 40 chromosomes are shown in each panel.
The 1.7 kb insert from cDNA m11 (Fig. 3 ) was used as a FISH probe to male mouse embryonic stem (ES) cell chromosomes. This cDNA probe hybridizes to a site on the mouse X chromosome, in bands F1-3 (Fig. 6 B). The single-copy Mecp2 gene, which maps to the central span of the mouse X chromosome (27 ), was included as a control. The physical location of the signal given by the Ott cDNA agrees well with the genetic mapping. It is of interest to determine whether all Ott family members map to this region. Genomic clones were obtained by PCR screening of mouse YAC library DNA with primers G322 and G364 (Materials and Methods). The library is divided into 25 pools representing ~4 equivalents of the mouse genome. Twenty pools were positive, consistent with the presence of a multigene family. Three of the four YACs chosen for analysis give more than one size of PCR product, suggesting that they contain more than one Ott gene, a result confirmed by sequencing (data not shown). This indicates that at least some of the genes in the family are closely linked, but an estimate of the size of the locus would require further detailed analysis.
Plugs of yeast cells containing each of the four YACs were electrophoresed on a pulsed field gel and the regions of the gel containing the YACs cut out. YAC DNA from all four clones was then PCR amplified by a catch-linker procedure, biotin labelled and hybridized to mouse ES cell chromosomes (Materials and Methods). Two of the YACs, 20c4 and 100a4, hybridize only to a site on the X chromosome, in band F (Fig. 6 C and D respectively). This is in the same region as that of the m11 cDNA (Fig. 6 B). YAC 78g5 hybridizes to this site, a second site on the X and to chromosome 15, whereas YAC 82h2 hybridizes to the XF1-3 site as well as chromosome 7 (data not shown). The most likely explanation for these results is that 78g5 and 82h2 are chimeric YACs, since they each label different autosomes and chimerism is a common feature of such clones. A single X-linked location for all the Ott genes is supported further by Southern analysis of male and female mouse DNA. Every hybridizing band on an EcoRI digest of genomic DNA probed with m11 cDNA is more intense in females compared with males (data not shown).
RT-PCR analysis has allowed the identification of one cDNA clone (b096) with a stringently testis-specific pattern of expression and one (d030) which is expressed at a detectable level only in testis and embryonic ovary (Table 2 ). The RT-PCR was performed at a sufficiently sensitive level to measure lower levels of expression than northern blot analysis, but would not have been able to detect the very low levels of illegitimate or ectopic transcription which may occur universally (28 ). However, the fact that expression of a synaptonemal complex protein gene, Sycp1, is detectable in adult brain where it is unlikely to have functional activity illustrates that caution is required. Nevertheless, the validity of this approach is confirmed by the identification of two novel clones with highly restricted expression patterns in the mouse.
The most likely explanation for the lack of expression of Ott genes in sex-reversed mice (Fig. 1 B) is that functional expression of these genes is germ cell-specific. It is also possible, however, that the lack of germ cells could affect gene expression in neighbouring somatic cells such as the Sertoli cell. Using germ-Sertoli cell co-culture, it has been shown that follicle-stimulating hormone (FSH) stimulation of Sertoli cells results in increased synthesis of germ cell RNA (reviewed in 29 ). In this respect, the Ott genes show an interesting pattern of expression during development of the testis (Fig. 2 ). The first round of meiosis is distinct from subsequent cycles because the supporting Sertoli cells are learning to communicate with the expanding germ cell population. The functional and morphological changes which happen to the Sertoli cells during this time are hormonally modulated. It is possible that transcription of the two size classes of Ott mRNA in the testis is hormonally controlled, as levels of testosterone rise as FSH levels decline once the testis nears full development.
It is not yet clear whether the two sizes of mRNA are transcribed from the same or different genes, or whether differential splicing or promoter usage together with use of a different polyadenylation site is responsible for the smaller mRNA. The use of different polyadenylation sites may reflect translational control of Ott gene expression. The site I sequence AUUAAA is the most common variant in vertebrate mRNAs and also has the highest polyadenylation efficiency of all variants tested in vitro, ~80% of AAUAAA (30 ). The mouse testis-specific form of the c-abl mRNA also shows alternative polyadenylation without an AAUAAA sequence (31 ). This alternative polyadenylation site is specific for the haploid stage of spermatogenesis, a result which could also apply to Ott site I, as mRNA using this site is first detectable in 28-day-old animals (Fig. 2 ).
Another intriguing aspect of the expression studies is that the Ott genes are X-linked (Fig. 6 ). During male meiosis, the sex chromosomes are condensed into the XY body, which by [3H]uridine incorporation studies is transcriptionally inactive (reviewed in 5 ). In agreement with this, splicing components are largely excluded from the XY body in male meiotic nuclei (32 ). Ott RNA is detectable throughout the time of formation of the XY body, but this could be due to the stability of existing transcripts rather than active transcription. Spermatogenic cells have several methods to ensure the availability of products normally encoded by the X chromosome. In the case of the X-linked HPRT gene the germ cell copes with X inactivation by stabilization of gene products. HPRT transcript levels decrease only 5- to 10-fold over a period of 13 days during meiotic prophase in the testis (33 ), so if transcription ceases the HPRT message must be very stable.
The predicted OTT polypeptides are highly hydrophilic, with the ak27 protein having an isoelectric point of 10.9. The unusual eight amino acid repeats and the fact that the large and small transcripts are predicted to encode different sized polypeptides suggest a structural rather than enzymatic role for at least the repetitive domain of the OTT proteins. We will investigate this hypothesis by the production of antibodies and by identification of interacting proteins through the `two-hybrid' system. It is also possible that sequencing projects in other organisms will reveal a homologous gene, although not all mammalian meiotic genes will necessarily have homologues in organisms such as Caenorhabditis elegans, Drosophila or S.cerevisiae.
Ott primers can amplify a repeat-containing region of >500 bp from genomic DNA, suggesting that the entire repetitive region may be contained on a single exon. The minimum size of this exon is greater than the average size of a vertebrate exon derived from either sequence analysis (137 bases) (34 ) or exon trapping of mouse genomic DNA (165 bases) (35 ). However, all Ott genes contain at least one intron, as primers F717/8, which bind 3' of the repeat region (Fig. 3 ), do not amplify genomic DNA. It is likely that there has been an expansion of the number of repeats over time, possibly as a result of unequal crossing over events. It will be interesting to analyse the sequences of Ott genes from other species and to determine whether it is a multigene family in all species. Database searches with full-length Ott cDNA ak27 (Fig. 4 ) show that the only good similarity (78% identity in 138 bp with no gaps) at the DNA level is to a region of mouse genomic DNA immunoselected as a retinoic acid response element (RARE) (36 ). This DNA (accession no. x70189) has a complex highly repetitive structure and the similarity may not be biologically relevant, particularly since the experimental procedure favoured the recovery of non-functional multimeric rather than classical RARE motifs (36 ). It is, however, possible that this sequence could be derived from a degenerate Ott family member.
Ohno's law states that loci that map to the mouse X chromosome also exhibit X linkage in man. Weak signals are detectable on human genomic DNA hybridized at low stringency with a mouse Ott cDNA (data not shown). However, it is difficult to predict which region of the human X chromosome might contain an Ott homologue. The man-mouse comparative map of this chromosome is composed of a minimum of eight well characterized blocks of homologous loci (37 ), but the synteny around 62-63 cM is complex, with human homologues present from bands Xp11, Xq22 and Xp22. No mouse mutant with a phenotype of affected reproductive organs and sterility maps near the Ott region of the mouse X chromosome. XO mice, unlike comparable human females, are fertile but have reduced numbers of germ cells and a shortened period of fertility. The germ cell loss may be due partly to inadequate dosage of X-encoded gene products during meiosis; therefore, the Ott genes may be among the candidates for this effect. Further analysis of the expression of this gene family and the cellular location and function of the encoded proteins should provide valuable information about the process of meiosis in mammals. Furthermore, the identification of a human homologue will provide a candidate locus which may be mutated in a proportion of infertile individuals.
Total RNA and poly(A)-containing RNA were isolated from tissues of Swiss mice as described (8 ). Poly(A)-containing RNA was also extracted directly from solid tissue with detergent and guanidinium thiocyanate by hybridization with Dynabeads oligo(dT)25 using a protocol provided by the manufacturer (Dynal). The embryo ovary sample was from a pool of eight 18.5 day post-coital females and the embryo testis sample from two 18.5 day post-coital males from the same mother. First strand cDNA primed with oligo(dT) was made by reverse transcription of poly(A)+ RNA using a Superscript kit and protocols provided by the manufacturer (Gibco BRL). A reaction mix was made and all RNA samples described in Table 2 were reverse transcribed in the same experiment. As a control for DNA contamination, reverse transcriptase (RT) was omitted from at least one sample in each reaction. Pairs of oligonucleotides for RT-PCR were designed using the PRIMER program (38 ) and have a GC clamp of two bases at the 3' end. RT-PCR used a standard set of PCR conditions (denaturation 94oC 30 s, annealing 50oC 45 s, elongation 72oC 1 min plus 1 s each cycle, for 30 cycles) with 2 U of Taq polymerase (Cetus) and 1 [mu]l of first strand cDNA reaction as template, in a final volume of 50 [mu]l. In all cases, primers were at a final concentration of 125 nM. RT samples were assayed in the presence and absence of the control primers 5' AGGAGCGATTTGCTGGTGTGGA and 5' GCTACCAGGCCTTTGAGATGGA which amplify the cDNA for the S16 ribosomal protein to give a 102 bp product (39 ). Reaction products were analysed by electrophoresis through a 2% gel made from a 1:1 mixture of Nusieve (FMC) and multipurpose agarose (Flowgen), stained with ethidium bromide and photographed on Tmax 100 film (Kodak). Northern blotting was as described (8 ). The S16 loading control probe was prepared by gel purification of the PCR product from RT-PCR with the above S16 primers and detects a 0.65 kb mRNA (40 ). Primer extension used kinase-labelled oligo I725 (5' CGCCATCACTTTGCCACCTCC) and standard procedures (41 ).
Insert cDNAs from [lambda] phage were sequenced using a solid-phase PCR-based method as described (8 ), except that a manual procedure using [35S]dATP and Sequenase 2.0 (USB) was also followed. In most cases, Ott cDNAs were sequenced on both strands to confirm base differences. Contigs were produced using the program GelAssemble within the GCG software package (42 ) at the MRC Human Genome Mapping Project Resource Centre. Sequences have been deposited in the EMBL database with the accession numbers shown in Table 1 and Figure 3 . Sequences were compared with the NBRF protein database using the program BLASTX (43 ) and with the EMBL DNA database using the program BLASTN (44 ). Additional cDNA clones were obtained by standard methods of screening duplicate plaque lifts of [lambda] libraries (41 ) using Hybond-N membranes (Amersham). The cDNA libraries were from 12/13 day mouse testis (8 ) and adult mouse testis (Stratagene and A. Klink, pers. comm.). Hybridization probes were made from PCR products of the cDNA clone of interest, and primary positive signals were verified by PCR before plaque purification.
DNA pools of a yeast artificial chromosome (YAC) library from a female C57BL/6J mouse (Research Genetics) were screened by PCR with primers G322 (5' GCAGTTAGGCTTCAACATGGC) and G364 (5' TTTCTTCCTCTTGGACCATGG). PCR used standard conditions (see above) with an annealing temperature of 53oC and 30 cycles. Twenty of the 25 pools gave one or more products. Pools with four different patterns of PCR products were chosen and individual YAC clones obtained. Growth of yeast cells, pulsed-field gel electrophoresis and isolation of YAC DNA followed standard procedures. Clone 20c4 contains a visible YAC of 450 kb, 100a4 is 500 kb, 78g5 is 650 kb and 82h2 is 500 kb.
PCR primers G322 and G364 (see above) amplify a 503 bp product from cDNA clone m11 and a 551 bp product from cDNA clone ak27. PCR of genomic DNA from M.musculus C57BL/6 produces bands of approximately both sizes whereas M.spretus genomic DNA only gives the smaller product. The polymorphism was used initially to type 50 animals from the (C57BL/6*M.spretus) F1*M.spretus panel of the European Collaborative Interspecific Backcross (25 ). The G322/G364 marker shows 0/41 recombinants (0 cM, LOD = 12.3) and 1/41 recombinants (2.4 cM, LOD = 10.3) with the X chromosome anchor loci Plp and DXHar2 respectively. For finer mapping, 50 recombinants between these markers and 42 between Xist and Plp were typed resulting in 27/133 recombinants (20.3 cM, LOD = 10.9) with Plp and 24/132 recombinants (18.2 cM, LOD = 12.6) with DXHar2. FISH analysis was as described (45 ). The 1.7 kb cDNA insert from clone m11 was isolated then labelled by nick translation in the presence of biotin-16-dUTP. The Mecp2 probe was a gift from Dr P. Tate. DNA from isolated YACs was amplified by a catch-linker procedure (46 ). Oligonucleotides D921 (5' GTCAAGAATTCTGTACCGTGGAC) and D922 (5' GATCGTGCACGGTAGCGAATTCT) anneal to give a GATC overhang which is compatible with YAC DNA digested with Sau3A. The resulting ligation reactions were PCR amplified with primer D921 alone using standard conditions. PCR products from each YAC were then labelled with biotin-16-dUTP by nick translation. These probes were hybridized to metaphase chromosomes from exponentially growing cultures of the M.musculus male ES cell line CGR8. Hybridization was done in the presence of mouse Cot-1 DNA to suppress repeated sequences. Fluorescence images were collected on a Zeiss Axioplan microscope and recorded digitally.
This work was supported by the Medical Research Council. We thank Michael Rhodes of HGMP for assistance with backcross mapping analysis and members of the Chromosome Biology Section for critical reading of the manuscript.
1 Burns, N., Grimwade, B., Ross-Macdonald, P.B., Choi, E., Finberg, K., Roeder, G.S. and Snyder, M. (1994) Large-scale analysis of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae. Genes Dev.,8, 1087-1105.MEDLINE Abstract
2 Meuwissen, R.L.J., Offenberg, H.H., Dietrich, A.J.J., Riesewijk, A., van Lersel, M. and Heyting, C. (1992) A coiled-coil related protein specific for synapsed regions of meiotic prophase chromosomes. EMBO J., 11, 5091-5100.
3 Lammers, J.H.M., Offenberg, H.H., Van Aalderen, M., Vink, A.C.G., Dietrich, A.J.J. and Heyting, C. (1994) The gene encoding a major component of the lateral elements of synaptonemal complexes of the rat is related to X-linked lymphocyte-regulated genes. Mol. Cell. Biol., 14, 1137-1146.
4 Calenda, A., Allenet, B., Escalier, D., Bach, J. and Garchon, H. (1994) The meiosis-specific Xmr gene product is homologous to the lymphocyte Xlr protein and is a component of the XY body. EMBO J., 13, 100-109.MEDLINE Abstract
5 McKee, B.D. and Handel, M.A. (1993) Sex chromosomes, recombination, and chromatin conformation. Chromosoma, 102, 71-80.MEDLINE Abstract
6 Handel, M.A. and Hunt, P.A. (1992) Sex-chromosome pairing and activity during mammalian meiosis. BioEssays, 14, 817-822.MEDLINE Abstract
7 Jackson, R.J. (1993) Cytoplasmic regulation of mRNA function: the importance of the 3' untranslated region. Cell, 74, 9-14.MEDLINE Abstract
8 Kerr, S.M., Vambrie, S., McKay, S.J. and Cooke, H.J. (1994) Analysis of cDNA sequences from mouse testis. Mammalian Genome, 5, 557-565.
10 Starborg, M., Brundell, E. and Hoog, C. (1992) Analysis of the expression of a large number of novel genes isolated from mouse prepubertal testis. Mol. Reprod. Dev.,33, 243-251.MEDLINE Abstract
11 Yuan, L., Liu, J. and Hoog, C. (1995) Rapid cDNA sequencing in combination with RNA expression studies in mice identifies a large number of male germ cell-specific sequence tags. Biol. Reprod., 52, 131-138.MEDLINE Abstract
12 Hoog, C. (1991) Isolation of a large number of novel mammalian genes by a differential cDNA library screening strategy. Nucleic Acids Res.,19, 6123-6127.MEDLINE Abstract
13 Affara, N.A., Bentley, E., Davey, P., Pelmear, A. and Jones, M.H. (1994) The identification of novel gene sequences of the human adult testis. Genomics, 22, 205-210.MEDLINE Abstract
14 Pawlak, A., Toussaint, C., Levy, I., Bulle, F., Poyard, M., Barouki, R. and Guellaen, G. (1995) Characterization of a large population of mRNAs from human testis. Genomics, 26, 151-158.MEDLINE Abstract
15 Roberts, B.T., Farr, K.A. and Hoyt, M.A. (1994) The Saccharomyces cerevisiae checkpoint gene BUB1 encodes a novel protein kinase. Mol. Cell. Biol., 14, 8282-8291.MEDLINE Abstract
16 Kenan, D.J., Query, C.C. and Keene, J.D. (1991) RNA recognition: towards identifying determinants of specificity. Trends Biochem. Sci., 16, 214-220.MEDLINE Abstract
17 Bai, C., Li, Z. and Tolias, P.P. (1994) Developmental characterization of a Drosophila RNA-binding protein homologous to the human systemic lupus erythematosus-associated La/SS-B autoantigen. Mol. Cell. Biol.,14, 5123-5129.MEDLINE Abstract
18 Uchida, S., Sekiguchi, T., Nishitani, H., Miyauchi, K., Ohtsubo, M. and Nishimoto, T. (1990) Premature chromosome condensation is induced by a point mutation in the hamster RCC1 gene. Mol. Cell. Biol., 10, 577-584.MEDLINE Abstract
19 Kerr, S.M., Taggart, M.H., Lee, M. and Cooke, H.J. (1996) Sequence and mapping of mouse synaptonemal complex protein genes Sycp1 and Sycp1-rs. Mammalian Genome,7, 209-211.MEDLINE Abstract
20 Mazarakis, N.D., Nelki, D., Lyon, M.F., Ruddy, S., Evans, E.P., Freemont, P. and Dudley, K. (1991) Isolation and characterisation of a testis-expressed developmentally regulated gene from the distal inversion of the mouse t-complex. Development, 111, 561-571.MEDLINE Abstract
21 Simpson, E.M. and Page, D.C. (1991) An interstitial deletion in mouse Y chromosomal DNA created a transcribed zfy fusion gene. Genomics, 11, 601-608.MEDLINE Abstract
22 Goetz, P., Chandley, A.C. and Speed, R.M. (1984) Morphological and temporal sequence of meiotic prophase development at puberty in the male mouse. J. Cell Sci., 65, 249-263.MEDLINE Abstract
23 Chen, F., MacDonald, C.C. and Wilusz, J. (1995) Cleavage site determinants in the mammalian polyadenylation signal. Nucleic Acids Res., 23, 2614-2620.MEDLINE Abstract
24 Kozak, M. (1991) Structural features in eukaryotic mRNAs that modulate the initiation of translation. J. Biol. Chem., 266, 19867-19870.MEDLINE Abstract
25 E.U.C.I.B. (1994) Towards high resolution maps of the mouse and human genomes-a facility for ordering markers to 0.1cM resolution. Hum. Mol. Genet., 3, 621-627.
26 Rowe, L.B., Nadeau, J.H., Turner, R., Frankel, W.N., Letts, V.A., Eppig, J.T., Ko, M.S.H., Thurston, S.J. and Birkenmeier, E.H. (1994) Maps from two interspecific backcross DNA panels available as a community genetic mapping resource. Mammalian Genome, 5, 253-274.MEDLINE Abstract
27 Quaderi, N.A., Meehan, R.R., Tate, P.H., Cross, S.H., Bird, A.P., Chatterjee, A., Herman, G.E. and Brown, S.D.M. (1994) Genetic and physical mapping of a gene encoding a methyl CpG binding protein, Mecp2, to the mouse X chromosome. Genomics, 22, 648-651.MEDLINE Abstract
28 Kaplan, J., Kahn, A. and Chelly, J. (1992) Illegitimate transcription: its use in the study of inherited disease. Hum. Mutat., 1, 357-360.MEDLINE Abstract
29 Pescovitz, O.H., Srivastava, C.H., Breyer, P.R. and Monts, B.A. (1994) Paracrine control of spermatogenesis. Trends Endocrinol. Metab., 5, 126-131.
30 Sheets, M.D., Ogg, S.C. and Wickens, M.P. (1990) Point mutations in AAUAAA and the poly(A) addition site: effects on the accuracy and efficiency of cleavage and polyadenylation in vitro. Nucleic Acids Res., 18, 5799-5805.MEDLINE Abstract
31 Meijer, D., Hermans, A, von Lindern, M., van Agthoven, T., de Klein, A. Mackenbach, P., Grootegoed, A., Talarico, D., Della Valle, G. and Grosveld, G. (1987) Molecular characterization of the testis specific c-abl mRNA in mouse. EMBO J.,6, 4041-4048.MEDLINE Abstract
32 Richler, C., Ast, G., Goitein, R., Wahrman, J., Sperling, R. and Sperling, J. (1994) Splicing components are excluded from the transcriptionally inactive XY body in male meiotic nuclei. Mol. Biol. Cell, 5, 1341-1352.MEDLINE Abstract
33 Singer-Sam, J., Robinson, M.O., Bellve, A.R., Simon, M.I. and Riggs, A.D. (1990) Measurement by quantitative PCR of changes in HPRT, PGK-1, PGK-2, APRT, MTase, and Zfy gene transcripts during mouse spermatogenesis. Nucleic Acids Res., 18, 1255-1259.MEDLINE Abstract
34 Hawkins, J.D. (1988) A survey on intron and exon lengths. Nucleic Acids Res.,16, 9893-9908.MEDLINE Abstract
35 Nehls, M., Pfeifer, D., Micklem, G., Schmoor, C. and Boehm, T. (1994) The sequence complexity of exons trapped from the mouse genome. Curr. Biol.,4, 983-989.MEDLINE Abstract
36 Rudert, F. and Gronemeyer, H. (1993) Retinoic acid response elements with a highly repetitive structure isolated by immuno-selection from genomic DNA. J. Steroid Biochem. Mol. Biol., 46, 121-133.MEDLINE Abstract
37 Blair, H.J., Reed, V., Laval, S.H. and Boyd, Y. (1994) New insights into the man-mouse comparative map of the X chromosome. Genomics, 19, 215-220.
38 Dietrich, W., Katz, H., Lincoln, S.E., Shin, H., Friedman, J., Dracopoli, N.C. and Lander, E.S. (1992) A genetic map of the mouse suitable for typing intraspecific crosses. Genetics, 131, 423-447.MEDLINE Abstract
39 Leonard, M.W., Lim, K. and Engel, J.D. (1993) Expression of the chicken GATA factor family during early erythroid development and differentiation. Development, 119, 519-531.MEDLINE Abstract
40 Wagner, M. and Perry, R.P. (1985) Characterization of the multigene family encoding the mouse S16 ribosomal protein: strategy for distinguishing an expressed gene from its processed pseudogene counterparts by an analysis of total genomic DNA. Mol. Cell. Biol., 5, 3560-3576.MEDLINE Abstract
41 Sambrook, J., Fritsch, E. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
42 Devereux, J., Haeberli, P. and Smithies, O. (1984) A competitive set of sequence analysis programmes for the VAX. Nucleic Acids Res.,12, 387-395.MEDLINE Abstract
43 Gish, W. and States, D.J. (1993) Identification of protein regions by database similarity search. Nature Genet., 3, 266-272.MEDLINE Abstract
44 Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990) Basic local alignment tool. J. Mol. Biol., 215, 403-410. MEDLINE Abstract
45 Fantes, J.A., Bickmore, W.A., Fletcher, J.M., Ballesta, F., Hanson, I.M. and van Heyningen, V. (1992) Submicroscopic deletions at the WAGR locus, revealed by nonradioactive in situ hybridization. Am. J. Hum. Genet.,51, 1286-1294.MEDLINE Abstract
46 Kipling, D., Wilson, H.E., Thomson, E.J. and Cooke, H.J. (1995) YAC cloning of Mus musculus telomeric DNA: physical, genetic, in situ and STS markers for the distal telomere of chromosome 10. Hum. Mol. Genet.,4, 1007-1014.MEDLINE Abstract
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Thu Oct 31 15:26:30 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996