Evolutionary conservation of sequence and expression of the bHLH protein Atonal suggests a conserved role in neurogenesis
Evolutionary conservation of sequence and expression of the bHLH protein Atonal suggests a conserved role in neurogenesisNissim Ben-Arie1,2, Alanna E. McCall1, Scott Berkman3, Gregor Eichele3, Hugo J. Bellen2,4 and Huda Y. Zoghbi1,2,4,*
1Department of Pediatrics, 2Department of Molecular and Human Genetics, 3Department of Biochemistry and 4Howard Hughes Medical Institute, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030, USA
Received May 14, 1996;Revised and Accepted June 20, 1996GenBank accession no. U61148-U61152
atonal is a Drosophila proneural gene that belongs to the family of basic helix-loop-helix (bHLH)- containing proteins. Itis expressed in the chordotonal organs and photoreceptor cells, and flies that lack Atonal protein are ataxic and blind. Here we report the cloning of atonal homologs from red flour beetle, puffer fish, chicken, mouse, and human. The bHLH domain is conserved throughout evolution, while the entire coding region is highly similar in mammals. Both the chicken and the mouse homologs are expressed early in embryogenesis in the hind brain, and specifically in cells predicted to give rise to the external granular layer of the cerebellum. In addition, these genes are expressed throughout the dorsal part of the spinal cord, in patterns different from those found for other genes, like LH-2 and wnt-1. The mouse homolog (Math1) maps to mouse chromosome 6, and the human homolog (HATH1) to human chromosome 4q22. Two neurological mouse mutants, Lc and chp, were found to map to the vicinity of Math1, but are not caused by mutations in Math1. The evolutionary conservation of this gene and its mRNA expression patterns during embryogenesis suggests that it plays a key role in the development of the vertebrate central nervous system.
The molecular mechanisms that control mammalian neural development involve many genes, most of which remain to be isolated and characterized (1 ). Drosophila and mammals seem to use similar molecular mechanisms to determine which cells will become part of the nervous system (2 ). Many of thegenes required for the specification of neuronal identity (3 ), neuronal differentiation (4 ), and growth cone guidance (5 ) in Drosophila have vertebrate homologs, whose sites of expression and function are reminiscent of their Drosophila homologs (1 ,5 -8 ). Hence, progress in understanding neural development in Drosophila provides an excellent basis for studies aimed at investigating the mechanisms that control neuronal development in the mammalian nervous system.
One class of genes that is of particular interest in neuronal development encodes a family of proteins that contain a basic helix-loop-helix (bHLH) motif (9 -12 ). These proteins are transcription factors with a basic domain necessary for DNA binding, and two helices that allow the formation of heterodimers with other bHLH proteins.
atonal is a proneuralgene that belongs to the family of bHLH-containing proteins, and that plays an essential role in the development of the Drosophila nervous system (13 ). In Drosophila embryos atonal is expressed in the ectodermal proneural clusters and sensory organ precursors that give rise to the chordotonal organs, which are receptors for stretch and/or vibration (proprioception), as well as in the optic furrow of the eye-antennal disc and in the inner proliferative zone of the developing brain lobe (13 -15 ). Deletion of genomic region spanning the atonal locus causes a lack of a subset of the PNS organs that includes all the ventral chordotonal organs and some multiple dendritic neurons (13 ). In addition, these flies lack photoreceptors and develop an apoptotic atrophy of the imaginal disc (15 ). Adult flies that lack atonal are viable; however, they are blind, uncoordinated and fly poorly (15 ).
In this study we show that Drosophila atonal is evolutionarily conserved and that its sequence shares high similarity within the bHLH domain with homologs from Tribolium castenium (red flour beetle), Fugu rubripes (puffer fish), chicken, mouse, and human. Expression analysis revealed that the mouse and chicken homologs are expressed in the dorsal regions of the hind brain and spinal cord. We have mapped the mouse atonal homolog (Math1) to the central portion of mouse chromosome 6 near two mouse mutants with neurological features: lurcher (Lc) and cerebellar-hypoplasia (chp). To determine if the phenotype in Lc/+ and chp/chp mutant mice is caused by a defect in Math1, the coding region from Lc and chp was sequenced and the genomic locus was studied by Southern analysis. No mutations nor genomic rearrangements were found in Math1 for either Lc or chp, suggesting that these genes are not allelic with Math1. The human atonal homolog (HATH1) was cloned and mapped. It is highly similar to the mouse Math1 gene (89% identity) and maps to human chromosome 4q22. The expression patterns of the vertebrate homologs of Drosophilaatonal and the high conservation of the coding sequence within the bHLH domain suggest that this gene plays an important role in the development of the vertebrate nervous system.
The Drosophilaatonal gene belongs to the family of bHLH transcription factors, but the sequence and size of the bHLH domain are sufficiently different to make it distinctive from other members of this family (Fig. 1 ). Degenerate PCR primers corresponding to sequences within the basic and the second helix domains of the Drosophilaatonal protein (13 ) were used to amplify fragments from genomic DNA of Tribolium castenium (red flour beetle), Fugu rubripes (puffer fish), and chicken. Sequencing of the cloned PCR products revealed a high degree of similarity between the bHLH domain of the Drosophila Atonaland the amplified homologous domain from the various species (67-78% identity). Notably, the cross-species similarity of atonal homologs within the bHLH domain was higher than the similarity between atonal and other Drosophila bHLH-containing genes (20-50%), and all the PCR products had the exact same length as atonal (Fig. 1 A).
To analyze the temporal expression of Math1 transcripts, a developmental mouse embryonic northern analysis was performed. A fragment of Math1 spanning the bHLH domain was hybridized to poly(A)+ RNA isolated from mouse embryos at different stages of development. As shown in Figure 3 , a single 2.5 kb band was detected from E11 to E17 with the strongest signal at E11.
In situ hybridization analysis was used to compare the spatial and temporal expression patterns of mouse and chicken atonal homologs (Math1 and Cath1, respectively) in the CNS. In the mouse, expression is first seen by embryonic day 9 in the dorsal part of the neural tube in neuroblasts situated lateral to the roof plate (Fig. 4 A, panel 1). Serial sections along the anteroposterior axis of an E12 mouse embryo revealed expression of Math1 in the dorsal neuroblasts, both in the metencephalon (Fig. 4 A, panel 2) and along the entire length of the spinal cord (Fig. 4 A, panels 3 to 10), with the exception of the posterior-most region of the spinal cord (data not shown). There is strong expression of Math1 in the rhombic lip (Fig. 4 A, panel 3), the region in which the precursors of the external granule neurons of the cerebellum arise. External granular cells of the postnatal cerebellum strongly express atonal in the mouse (16 ). Similarly, Cath1 expression in the chick brain was detected between E12 and E18, when maximal granule cell migration occurs (not shown). Cath1 expression in the chicken spinal cord is identical to that seen in mouse (Fig. 4 B, panels 1-6). Expression is first seen around Hamburger-Hamilton stage 17 (E3) in the rostral section of the neural tube and persists until stage 28 (E6, arrows in Fig. 4 B, panel 6). Panels 1-3 depict expression in the spinal cord of a stage 22 embryo at the cervical (Fig. 4 B, panel 1), lumbar (Fig. 4 B, panel 2) and caudal (Fig. 4 B, panel 3) levels. Similar to Math1 expression pattern, Cath1-positive cells extend to the roof plate, but do not include this structure (Fig. 4 B, panels 4 and 6).
The nature of the atonal homologs-positive cells in the spinal cord is presently unknown. However, several molecular markers delineating cell populations in the dorsal region of the neural tube have recently been identified (18 ,19 ). Figure 4 C depicts the expression of Math1 (panels 1 and 4), the LIM/homeodomain gene (20 ), LH-2, (panels 2 and 5) and wnt-1 (21 ) (panels 3 and 6) mRNA in the caudal (top panels) and cervical regions (bottom panels) of a day 12 mouse embryonic spinal cord. LH-2 defines a subset of dorsal commissural neurons (18 ) and wnt-1 expression defines the dorsal midline of the spinal cord (21 ). Initially, Math1 transcripts are found in the dorsal-most region that is adjacent and partially included in the wnt-1 expression domain (compare panels 1 and 3 in Fig. 4 C). Likewise, there is an overlap of the expression domains of Math1 and LH-2 (Fig. 4 C, panels 1 and 2). Since RNA in situ hybridization does not afford cellular resolution, it is not possible to be certain whether any of the hybridizing cells simultaneously express Math1 and LH-2. However, the expression patterns establish that cells expressing these two genes are at least intermingled in the more medial domain of the dorsal spinal cord. It is interesting to note that there are LH-2 positive cells in the lateral region of the spinal cord which does not express Math1. This may imply that LH-2 expression does not depend on the expression of Math1 after migration has taken place. In the developmentally more advanced cervical region of the spinal cord, wnt-1 and Math1 expression still partially overlap (Fig. 4 C, panels 4 and 6). In contrast, Math1 expressing cells and LH-2 expressing cells localize to different but adjacent regions, with LH-2 positive cells located lateral to those containing Math1 mRNA. Taken together, these expression studies indicate that Math1 is transiently expressed in both chick and mouse in a population of neuroblasts residing lateral to the roof plate. Unlike LH-2-expression, which is seen in neuroblasts that migrate laterally (Fig. 4 C, panels 2 and 5), Math1-expression is seen only in neuroblast that are immediately below the roof plate and are situated more medially. The partial overlap of the expression regions of Math1 and LH-2 in the early stages of spinal cord development (Fig. 4 C, panels 1 and 2) raises the possibility that Math1-expressing neurons define a stem cell population which serves as a precursor of LH-2 neurons and possibly of other neurons. The evolutionarily conserved localization of Math1 and Cath1-positive cells and the transient expression of these genes, are consistent with this hypothesis.
The high conservation of Atonal bHLH domain in many species, in addition to the similar expression patterns in the nervous system of chicken and mouse, suggest that atonal homologs have an important function in neuronal development in most species. To determine whether a mouse with Math1 mutation(s) exists, we mapped this gene in the mouse. The genetic mapping was performed using interspecific backcrosses between C57BL/6J and Mus spretus (SPRET/Ei). Hybridization of the Math1 probe to genomic DNA from the two strains identified a BamHI restriction fragment length polymorphism (Fig. 5 A). This polymorphism was subsequently used to genotype 93 animals from a (C57BL/6J * SPRET/Ei)F1 * C57BL/6J backcross, and 92 animals from a (C57BL/6J * SPRET/Ei)F1 * SPRET/Ei backcross.
The Drosophilaatonal gene product plays an important role in the neurogenesis of the chordotonal organs that are involved in proprioception. In addition, the atonal homologs were found to be exclusively expressed in subsets of neurons in the cerebellum, hind brain and spinal cord in both chicken and mouse. The finding that Math1 maps close to two neurological mutations, Lc (25 ) and chp (Dr Muriel Davisson, pers. comm.) both of which cause ataxia, raised the possibility that Math1 may be disrupted in either mutant mouse. Therefore, the coding region of Math1 was PCR-amplified, cloned, and sequenced from affected Lc and chp homozygotes and the appropriate wild type control animals. No mutations were found in the Math1 gene of the mutant mice throughout the coding region. To identify potential genomic rearrangement in the Math1 locus, Southern analysis was performed, using various fragments from Math1 coding and non-coding regions and genomic DNA from affected homozygotes, heterozygotes and wild type mice. No genomic rearrangements were detected but the possibility still remained that mutations in regulatory regions, such as the promoter, may cause the phenotype. Therefore, a genetic analysis was performed to determine more accurately the genetic distance between Math1 and chp or Lc. The Math1 ORF was used as a probe on panels of interspecific backcrosses. Recombinations were found between chp and Math1 (Drs Susan Cook and Muriel Davisson, pers. comm.), as well as between Lc and Math1 (Dr Nathaniel Heintz, pers. comm.), which confirmed the conclusion that Math1 is not the gene mutated in these mice.
In this study we have shown that the bHLH domain encoded by the Drosophilaatonal homologs is conserved throughout the animal kingdom. This domain was identified in insects, fish, birds, and mammals and shares high sequence similarity. Homology searches consistently identified the vertebrate sequences as the closest to the fruit fly gene, with much higher scores obtained between Atonal and the vertebrate homologs than between Atonal and any other Drosophila gene products. In addition, the size of the bHLH domain is the same in atonal homologs from all species tested. Since other bHLH-containing Drosophila genes have varying size, due to differences in the loop length, the unique size found in Atonal homologs may be used as another criterion to establish the homology relationship. The conservation of the sequence and the size of the bHLH domain from Drosophila Atonal and the putative homologs from other speciessuggests that the cloned genes are the homologs of atonal. The bHLH domain is almost identical in vertebrates, while the whole coding region and its flanking sequences are highly similar in mammals. It was shown (13 ) that the bHLH domain is necessary and sufficient to promote correct protein dimerization and recognition of the DNA target, and might therefore be considered the `core' of the protein. The high homology between the Drosophila and vertebrate Atonal bHLH domain suggests that the function of the protein is conserved in different species.
Similar conservation of the bHLH domain was found also for the genes of the achaete-scute complex (AS-C). The similarity in the AS-C genes between different species is very akin to our findings. In both cases, animals that are evolutionarily distant show sequence and size conservation only at the bHLH domain whereas mammalian homologs are conserved throughout the coding region. Functional conservation was shown for the hydra homolog of AS-C through its proneural activity in Drosophila (28 ). This may be due to the fact that although the overall identity between the hydra and the Drosophila homologs is low, the bHLH domain is 67% identical. The same conservation of function may apply to the atonal homologs, which have low overall similarity with Drosophila atonal, but high degree of similarity at the bHLH domain (e.g. in chicken and mouse). The demonstration of conservation of neuronal expression patterns in mouse and chicken homologs of atonal in this study, in addition to their sequence conservation, suggests a preservation of a function during the early stages in the development of the nervous system.
The vertebrate atonal homologs were shown by RNA in situ hybridization to be expressed in mouse starting at E9 and in chicken by Hamburger-Hamilton stage 17. Both homologs are expressed in the dorsal-most part of the spinal cord and hind brain, lateral to the roof plate along the entire length of the spinal cord. There is also strong expression of Math1 and Cath1 in the rhombic lip, which contain the cells that will give rise to the external granular layer of the cerebellum. The rhombic lip expresses Math1 and Cath1 at the stage in which the granular cell precursors are being born, prior to their dorsomedial migration, a process that eventually produces the external granular layer (29 ). Our expression studies raise the possibility that the dorsal neuroectodermal cells which express atonal give rise to the LH-2 positive commissural neurons. However, the possibility remains, that neuroepithelial cells in the spinal cord will undergo a second migration wave, through the developing dorsal roots, after the emigration of neural crest cells has been completed, to acquire various fates (30 ). Thus in vertebrates, atonal homologs might be involved in the specification of the fate of neuronal precursor cells, as was shown in Drosophila. However, in Drosophila the progenitors are ectodermal cells, while in vertebrates the progenitors may be already committed to a neuronal fate or may even be neurons already at the time atonal homologs are expressed.
It seems feasible to hypothesize that mutations in Math1 may affect the development of the mouse nervous system based on the role of atonal in the development of the Drosophila chordotonal organs, the fact that adult flies that lack atonal have poor coordination (15 ), and the expression patterns in the brain and the spinal cord of vertebrates. A search for mouse and/or human disease caused by mutation in Math1 and HATH1, respectively, was undertaken through their mapping. The mapping of atonal homologs to mouse chromosome 6 and to human chromosome 4q22 defines a new linkage conservation between the two species. Genes more centromeric to Math1 map to human chromosome 7, while the region that is more distal on mouse chromosome 6 maps to human chromosome 2.
It was intriguing to discover that two neurological mutants chp and Lc map within 2 cM of Math1. We did not find any mutations in the coding region of Math1 or any genomic rearrangements in homozygote Lc/Lc or chp/chp mutant mice. Furthermore, recombinations between Math1 and both chp and Lc, excluded Math1 as a candidate gene for these mutants. A more direct approach to reveal the function of Math1 in the development of the nervous system is the generation of mice that lack the gene, which is currently in progress (N.B.A. and H.Y.Z., unpublished results).
The identification of the human homolog, HATH1, and its mapping to human chromosome 4q22 will allow the testing of patients with unmapped inherited neurological disorders, especially those manifesting ataxia. The fact that the coding region of HATH1 is encoded in one relatively small exon will allow the direct amplification and sequence analysis of HATH1 from patients. In addition, the use of the adjacent polymorphic marker, D4S1557, may facilitate such a screen.
To conclude, we have presented data that show that a cross species conservation of a Drosophila proneural gene exists throughout evolution. The fact that both sequence and expression pattern similarities are identified for atonal homologs may imply that similar, even if not identical, pathways for the early development of the nervous system may occur in insects, birds and mammals.
Degenerate primers corresponding to the basic and second helix of Drosophila atonal (13 ) were designed: D2, residues 1109-1128 (GCIGCIAA(C/T)GCI(A/C)GIGA(A/G)(C/A)G) and D1, residues 1226-1246 (IAT(G/A)TAIGT(C/T)TGIGCCAT(C/A)TG). PCR-amplification was carried out in 10 mM Tris, pH 8.3, 50 mM KCl, 0.01% gelatin, 1.25 mM MgCl2, 0.25 mM each dNTP, 1.25 U AmpliTaq (Cetus)/50 [mu]l and 1 [mu]M of each primer. Amplification was performed in MJR thermocycler, programmed as follows: 40 cycles of denaturation at 94oC for 1 min, annealing at 50oC for 1 min and elongation at 72oC for 1 min. Sequencing was performed either manually, using Sequenase 2.0 kit (USB) or on an ABI 373A sequencer with dyedeoxy terminators. Homology searches were performed on the National Center for Biotechnology Information (NCBI) server by the BLASTP program (31 ), using BLOSUM62 matrix and no filters. Databases searches included GenBank, PDB, SwissProt and PIR.
The following libraries were screened or utilized for PCR-amplification: Tribolium castenium embryonic cDNA library (kindly provided by Dr Sue Brown), Chicken embryonic (HH14-17) cDNA library (Stratagene), Mouse embryonic (E10.5, E12.5, E14.5, E16.5) cDNA libraries (kindly provided by Dr Allen Bradley), Mouse 129/Sv genomic library (Stratagene), and Human genomic library (kindly provided by Dr Christie Ballantyne). The libraries were screened according to standard procedures (32 ). For cross species hybridization, the filters were washed at low stringency (3* SSC at 50oC; 1* SSC is 0.15 M NaCl and 15 mM citric acid), while for cross mammals the hybridization stringency was higher (0.1-0.5* SSC at 65oC).
To map Math1 genomic DNA from C57BL/6J and SPRETUS/Ei mouse strains was digested with a battery of restriction enzymes and hybridized to a Math1 probe. BamHI digestion produced the largest visible difference between the two, and was thus chosen for the genotyping of the animals. Two backcross panels, BSS and BSB (The Jackson Laboratory), were used to identify the critical recombinations that define the interval at which Math1 maps (see Results).
To identify human YACs containing HATH1, we used the primers and conditions developed for STS UT6525 (GenBank accession number L30585), which was found by homology searches to be identical to HATH1. These primers were utilized to screen the CEPH Mega YACs library by PCR. DNA was extracted from the positive YACs in agarose blocks (33 ), and subjected to Alu-PCR using PDJ34 primers (34 ). FISH was performed on human chromosomes as described in (35 ). Chromosomes were counterstained with 4',6-diamidin-2-phenylindol-dihydrochlorid (DAPI) to determine the subchromosomal localization of the signal. More than 10 chromosomes were examined for each probe.
To identify mutations in the open reading frame of Math1, the following primers were used for PCR amplification: MA5 (ACCTCCTCTAACACGGCAC) and MA6 (AGGGCATTTGGTTGTCTCAG). PCR was performed in a Cetus 9600 thermocycler, programmed as follows: 35 cycles of denaturation at 94oC for 30 s, annealing at 60oC for 30 s and elongation at 72oC for 100 s, with an extension of the first and last steps. Amplification mix was as above, except for a MgCl2 concentration of 3 mM. PCR products were subcloned into pBlueScriptII/KS+ (Stratagene) and sequenced on an ABI sequencer. To achieve high accuracy and overlapping readings, the following internal oligonucleotides were used for sequencing, in addition to MA5 and MA6: MA1 (CAGAAGCAAAGGAGGCTGGC), MA2 (GCTTCTTGTCGTTGTTGAAGG), MA3 (TCTGCTGCATTCTCCCGAGC) and MA4(GCACCGAGTAACCCCCAGAG).
As templates for mutation analysis we have used genomic DNA extracted from Lc/Lc and chp/chp mutant mice. Lc/+ mice are maintained at the Jackson Laboratory by mating with (C57BL/6J-AwJ * CBA/Ca)F1 mice. To obtain Lc/Lc homozygotes, Lc/+ mice were intercrossed. Lc/+ mice are ataxic, while Lc/Lc mice die within a few hours of delivery (36 ). DNA from chp/+ and chp/chp mice was obtained from Dr Muriel. Davisson. Control DNA was from C3H/HeJ-dw[J]/+ mice, the inbred strain on which chp mutation occurred. The same DNA samples were used in Southern analysis (32 ).
Mouse developmental northern blot was purchased from Stratagene. In each lane, the blot contains 2 [mu]g of poly(A)+ RNA extracted from whole mouse embryos at different stages of development. Hybridization was performed according to the manufacturer's instructions using a Math1 PCR product spanning the bHLH domain as a probe.
Embryo collection, sectioning and in situ hybridization were performed as previously described (37 ). Fragments of chicken and mouse atonal homologs in pBSII-KS+ were linearized and used as templates to transcribe either the sense or antisense [35S]-labeled riboprobes. Photographs are double exposures; in situ hybridization signals are colored, while the grey or blue color represents the nuclei stained with Hoechst 33258 dye. Both chicken and mouse probe contain the first 60 bp of the bHLH domain. The chicken probe extends 273 bp upstream to the bHLH domain, while the mouse probe includes about 1 kb 5' to the bHLH domain.
We thank the YAC core, headed by Dr Craig Chinault, and the FISH core, headed by Dr Antonio Baldini, both at the Genome Center at Baylor College of Medicine, for the screening of the YAC library and FISH mapping, respectively. We are grateful to Dr Eva Eicher for the generous gift of backcross DNA panels, assistance in analysis of the mouse mapping data and for critical review of the manuscript. We would like to thank Dr Muriel Davisson for providing chp DNA and sharing unpublished information, Dr Achim Gossler for providing the Etl1 probe, Dr Nathaniel Heintz for sharing unpublished mouse mapping data, Dr Igna Van den Veyver for comments on the manuscript, and Catherine Tasnier for catalyzing this fruitful collaboration. H.Y.Z. is an Investigator and H.J.B. is an Associate Investigator from the Howard Hughes Medical Institute. This work was supported by a grant from the National Institutes of Health, National Institute of Neurological Disease and Stroke (NS27699) to H.Y.Z.
1 Joyner, A.L. and Guillemot, F. (1994) Gene targeting and development of the nervous system. Curr. Op. Neurobiol.,4, 37-42.MEDLINE Abstract
2 Guillemot, F., Lo, L.-C., Johnson, J.E., Auerbach, A., Anderson, D.J. and Joyner, A.L. (1993) Mammalian achaete-scute homolog 1 is required for the early development of olfactory and autonomic neurons. Cell,75, 463-476.MEDLINE Abstract
3 Bodmer, R., Barbel, S., Shepherd, S., Jack, J.W., Jan, L.Y. and Jan, Y.N. (1987) Transformation of sensory organs by mutations of the cut locus of D. melanogaster. Cell,51, 293-307.MEDLINE Abstract
4 Vaessin, H., Ellsworth, G., Wolff, E., Bier, E., Jan, L.Y. and Jan, Y.N. (1991) prospero is expressed in neuronal precursors and encodes a nuclear protein that is involved in the control of axonal outgrowth in Drosophila.Cell,67, 941-953.MEDLINE Abstract
5 Kolodkin, A.L., Matthes, D.J. and Goodman, C.S. (1993) The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules. Cell,75, 1389-1399.MEDLINE Abstract
6 Andres, V., Nadal-Ginard, B. and Mahdavi, V. (1992) Clox, a mammalian homeobox gene related to Drosophilacut, encodes DNA-binding regulatory proteins differentially expressed during development. Development,116, 321-334.MEDLINE Abstract
7 Oliver, G., Sosa-Pineda, B., Geisendorf, S., Spana, E.P., Doe, C.Q. and Gruss, P. (1993) Prox 1, a prospero-related homeobox gene expressed during mouse development. Mech. Dev.,44, 3-16.MEDLINE Abstract
8 Salzberg, A. and Bellen, H.J. (1996) Invertebrate versus vertebrate neurogenesis: variations of the same theme? Dev. Genet.,18, 1-10.MEDLINE Abstract
9 Murre, C. and Baltimore, D. (1992) In McKnight, S.L. and Yamamoto, K.R. (eds), Transcriptional regulation. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, pp. 861-879.
10 Murre, C., Bain, G., van Dijk, M.A., Engel, I., Furnari, B.A., Massari, M.E., Matthews, J.R., Quang, M.W., Rivera, R.R. and Stuiver, M.H. (1994) Structure and function of helix-loop-helix proteins. Biochem. Biophys. Acta.,1218, 129-135.
11 Jan, Y.N. and Jan, L.Y. (1994) Genetic control of cell fate specification in Drosophila peripheral nervous system. Ann. Rev. Genet.,28, 373-393.MEDLINE Abstract
12 Kageyama, R., Sasai, Y., Akazawa, C., Ishibashi, M., Takebayashi, K., Shimizu, C., Tomita, K. and Nakanishi, S. (1995) Regulation of mammalian neural development by helix-loop-helix transcription factors. Crit. Rev. Neurobiol.,9, 177-188.MEDLINE Abstract
13 Jarman, A.P., Grau, Y., Jan, L.Y. and Jan, Y.N. (1993) atonal is a proneural gene that directs chordotonal organ formation in the Drosophila peripheral nervous system. Cell,73, 1307-1321.MEDLINE Abstract
14 Jarman, A.P., Grell, E.H., Ackerman, L., Jan, L.Y. and Jan, Y.N. (1994) atonal is the proneural gene for Drosophila photoreceptors. Nature,369, 398-400.MEDLINE Abstract
15 Jarman, A.P., Sun, Y., Jan, L.Y. and Jan, Y.N. (1995) Role of the proneural gene, atonal, in formation of Drosophila chordotonal organs and photoreceptors. Development,121, 2019-2030.MEDLINE Abstract
16 Akazawa, C., Ishibashi, M., Shimizu, C., Nakanishi, S. and Kageyama, R. (1995) A mammalian helix-loop-helix factor structurally related to the product of Drosophila proneural gene atonal is a positive transcriptional regulator expressed in the developing nervous system. J. Biol. Chem.,270, 8730-8738.MEDLINE Abstract
17 Shimizu, C., Akazawa, C., Nakanishi, S. and Kageyama, R. (1995) MATH-2, a mammalian helix-loop helix factor structurally related to the product of Drosophila proneural gene atonal, is specifically expressed in the nervous system. Eur. J. Biochem.,229, 239-248.MEDLINE Abstract
18 Liem, K.F., Tremml, G., Roelik, H. and Jessell, T.M. (1995) Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell,82, 969-979.MEDLINE Abstract
19 Pfaff, S.L., Mendelsohn, M., Stewart, C.L., Edlund, T. and Jessell, T.M. (1996) Requirement for LIM homeobox gene Isl1 in motor neuron generation reveals a motor neuron-dependent step in interneuron differentiation. Cell,84, 309-320.MEDLINE Abstract
20 Xu, Y., M., B., Fisher, P., Rathbun, G., Oltz, E.M., Yancopoulos, G.D., Jessell, T.M. and Alt, F.W. (1993) LH-2: a LIM/homeodomain gene expressed in developing lymphocytes and neural cells. Proc. Natl Acad. Sci. USA,90, 227-231.MEDLINE Abstract
21 Parr, B.A., J., S.M., Vassikeva, G. and McMahon, A.P. (1993) Mouse Wnt genes exhibit discrete domains of expression in the early embryonic CNS abd limb buds. Development,119, 247-261.MEDLINE Abstract
22 Mouse Genome Database (MGD) 3.1. (1996) Mouse Genome Informatics, The Jackson Laboratory, Bar Harbor, Maine. (URL: http://www.informatics.jax.org/).
23 Darling, S.M., Guenet, J.L., Simon-Chazottes, D., Shiels, P., Davies, W. and Gossler, A. (1996) The enhancer trap locus (Etl1) is closely linked to lurcher on mouse chromosome 6. Mamm. Genome,submitted.
24 Soininen, R., Schoor, R., Henseling, U., Tepe, C., Kisters Woike, B., Rossant, J. and Gossler, A. (1992) The mouse Enhancer trap locus 1 (Etl-1): a novel mammalian gene related to Drosophila and yeast transcription regulator gene. Mech. Dev.,39. MEDLINE Abstract
25 Norman, D.J., Fletcher, C. and Heintz, N. (1991) Genetic mapping of the lurcher locus on mouse chromosome 6 using intersubspecific backcross. Genomics,9, 147-153.MEDLINE Abstract
26 Gyapay, G., Morissette, J., Vignal, A., Dib, C., Fizames, C., Millasseau, P., Marc, S., Bernardi, G., Lathrop, M. and Weissenbach, J. (1994) The 1993-94 Genethon human genetic linkage map. Nature Genet.,7, 246-339.MEDLINE Abstract
27 Buetow, K.H., Ludwigsen, S., Scherpbier-Heddema, T., Quillen, J., Murray, J.C., Sheffield, V.C., Duyk, G.M., Weber, J.L., Weissenbach, J., Gyapay, G. and et al. (1994) Human genetic map. Genome maps V. Wall chart. Science,265, 2055-2070.MEDLINE Abstract
28 Grens, A., Mason, E., Marsh, J.L. and Bode, H.R. (1995) Evolutionary conservation of a cell fate specification gene: the hydra achaete-scute homolog has proneural activity in Drosophila. Dev.,121, 4027-4035.
29 Hatten, M.E. and Heintz, N. (1995) Mechanisms of neural patterning and specification in the developing cerebellum. Ann. Rev. Neurosci.,18, 385-408.MEDLINE Abstract
30 Sharma, K., Korade, Z. and Frank, E. (1995) Late-migrating neuroepithelial cells from the spinal cord differentiate into sensory ganglion cells and melanocytes. Neuron,14, 143-152.MEDLINE Abstract
31 Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D. (1990) Basic local alignment tool. J. Mol. Biol.,215, 403-410.MEDLINE Abstract
32 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
33 Den Dunnen, J.T. and Van Ommen, G.J.B. (1991) In Mathew, C. (ed.), Methods in Molecular Biology. The Humana Press Inc., Clifton, Vol. 9, pp. 169-182.
34 Zoghbi, H.Y. and Chinault, C. (1994) In Nelson, D.L. and Brownstein, B.H. (eds), YAC libraries, A User's Guide. W.H. Freeman and Co., New York, pp. 93-112.
35 Baldini, A. and Lindsay, E. (1994) In Choo, K.H.A. (ed.), Methods in Molecular Biology. Humana Press Inc., Totowa, Vol. 33, pp. 75-84.MEDLINE Abstract
36 Heintz, N., Norman, D., Gao, W.-Q. and Hatten, M. (1993) In Davies, K.E. and Tilghman, S.M. (eds), Genome maps and neurological disorders. Cold Spring Harbor Laboratory Press, New York, Vol. 6, pp. 19-45.
37 Sundin, O., Busse, H.G., Rogers, M.B., Gudas, L.J. and Eichele, G. (1990) Region-specific expression in early chick and mouse embryos of Ghox-lab and Hox 1.6, vertebrate homeobox-containing genes related to Drosophilalabial. Development,108, 47-58.MEDLINE Abstract
38 Zhao, C. and Emmons, S.W. (1995) A transcription factor controlling development of peripheral sense organs in C. elegans. Nature,373, 74-78.MEDLINE Abstract
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Thu Oct 31 15:27:05 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
