Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (113)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Richards, A. J.
Right arrow Articles by Snead, M. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Richards, A. J.
Right arrow Articles by Snead, M. P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1339-1343
A family with Stickler syndrome type 2 has a mutation in the COL11A1 gene resulting in the substitution of glycine 97 by valine in [alpha]1(XI) collagen
Introduction
Results
Discussion
Materials And Methods
   Linkage analysis
   cDNA amplification
   Single stranded conformational analysis
   Sequencing
   Restriction enzyme analysis
Acknowledgements
References

A family with Stickler syndrome type 2 has a mutation in the COL11A1 gene resulting in the substitution of glycine 97 by valine in [alpha]1(XI) collagen

A family with Stickler syndrome type 2 has a mutation in the COL11A1 gene resulting in the substitution of glycine 97 by valine in [alpha]1(XI) collagen Allan J. Richards1,2, John R. W. Yates1,3, Rebecca Williams1,4, Stewart J. Payne4, F. Michael Pope1,2,3, John D. Scott5 and Martin P. Snead4,5,*

1Department of Pathology, University of Cambridge, Tennis Court Road, Cambridge CB2 1QP, UK, 2MRC Connective Tissue Genetics Group, Strangeways Research Laboratory, Worts Causeway, Cambridge CB1 4RN, UK and 3Department of Medical Genetics, 4Molecular Genetics Laboratory and 5Vitreo-retinal Service, Addenbrooke's NHS Trust, Hills Road, Cambridge CB2 2QQ, UK

Received May 8, 1996; Revised and Accepted June 25, 1996

Stickler syndrome (hereditary arthro-ophthalmopathy) is the commonest inherited cause of retinal detachment and one of the commonest autosomal dominant connective tissue dysplasias. There is clinical and locus heterogeneity with about two thirds of families linked to the gene encoding type II procollagen (COL2A1). Families with Sticklers syndrome type 1 have a characteristic congenital vitreous anomaly and are linked without recombination to markers at the COL2A1 locus. In contrast families with the type 2 variety have a different vitreo-retinal phenotype and are not linked to the COL2A1 gene. Type XI collagen is a quantitatively minor fibrillar collagen related to type V collagen and associated with the more abundant type II collagen fibrils. A mutation in COL11A2, the gene for [alpha]2 (XI) procollagen, has recently been found in a family described as having Stickler syndrome, although there was no ocular involvement. Here we show for the first time that a family with the full Type 2 Stickler syndrome including vitreous and retinal abnormalities is linked to the COL11A1 gene and characterise the mutation as a Glycine to Valine substitution at position 97 of the triple helical domain caused by a single base G -> T mutation. These results are the first to provide confirmation that type XI collagen is an important structural component of human vitreous. They also support previous work suggesting that mutations in the genes encoding collagen XI can give rise to some manifestations of Stickler syndrome, but of these, only mutations in COL11A1 will give the full syndrome including the vitreo-retinal features.

INTRODUCTION

Stickler syndrome (hereditary arthro-ophthalmopathy) is an autosomal dominant condition characterised by ocular, articular, facial, auditory and oral features. It is the commonest autosomal dominant connective tissue dysplasias (1 ) and the commonest cause of inherited retinal detachment (2 ). There is clinical and locus heterogeneity with about two thirds of families showing linkage to the gene encoding Type II procollagen (COL2A1). We have recently shown that Stickler syndrome can be sub classified on the basis of vitreo-retinal phenotype: Type 1 families with a characteristic congenital vitreous anomaly show linkage without recombination to markers at the COL2A1 locus; Type 2 families with different congenital vitreo-retinal phenotypes are not linked to COL2A1 (3 ).

Type XI collagen is a quantitatively minor fibrillar collagen related to type V collagen and associated with the more abundant type II collagen fibrils (4 -6 ). A mutation in COL11A2, the gene for [alpha]2 (XI) procollagen, has recently been found in a family described as having Stickler syndrome (7 ), although there was no ocular involvement. In cartilage the type XI collagen molecule is a heterotrimer composed of [alpha]1, [alpha]2 and [alpha]3 (XI) chains. However in mammalian vitreous the [alpha]2 (XI) chain is replaced by [alpha]2 (V) collagen (8 ). In addition it is now clear that the [alpha]3 (XI) collagen chain is a splice variant of the COL2A1 gene (4 ,9 ,10 ). Therefore, the COL11A1 and COL5A2 genes were strong candidates for Type 2 Stickler syndrome.

We now report the results of a study in a large Type 2 pedigree in which linkage to COL2A1 had been excluded. Slit lamp biomicroscopy of affected members of the pedigree revealed congenitally abnormal vitreous architecture suggesting that likely candidates would be the genes encoding other collagens that associate with, and structurally stabilise, type II collagen.

RESULTS

The four generation Stickler syndrome Type 2 family studied consisted of seven affected and nine normal individuals. All affected individuals had the characteristic ocular, auditory and oro-facial features of Stickler syndrome (Fig. 1 ). Abnormal vitreous architecture is the hallmark of the syndrome and was considered a prerequisite for the diagnosis. It was present in all affected individuals; in each case the myopia was congenital, non-progressive and of high degree.

Table 1 . Two point lod scores between Type 2 Stickler syndrome and polymorphic markers
 

  

  

 Recombination fraction
Locus

 Location

 Marker

0.0

 0.001

 0.05

 0.1

 0.2

 0.3

 0.4
COL2A1

 12q12-q13.2

 3'VNTR

 -[infinity]

 -7.2

 -2.7

 -1.3

 -0.6

 -0.2

 -0.1
CRTL1

 5q13-q14

 [GT] repeat

 -[infinity]

 -10.2

 -3.4

 -2.3

 -1.2

 -0.6

 -0.2
COL3A1

 2q14-q32

 IVS 25

 -[infinity]

 -7.6

 -2.6

 -1.8

 -1.1

 -0.7

 -0.4
COL9A1

 6q12-q14

 [CA] repeat

 -[infinity]

 -13.2

 -4.7

 -3.2

 -1.8

 -1.0

 -0.4
COL11A2

 6p21.3

 D6S105

 -[infinity]

 -4.8

 -1.4

 -0.9

 -0.4

 -0.1

 0.0
 

  

 D6S276

 -[infinity]

 -6.6

 -1.6

 -0.8

 -0.2

 -.06

 -0.1
COL11A1

 1p21

 D1S206

 1.2

 1.2

 1.0

 0.9

 0.5

 0.2

 0.0
 

  

 D1S223

 2.7

 2.7

 2.5

 2.2

 1.7

 1.1

 0.6

Genomic DNA was extracted from peripheral blood of all 16 family members. In addition skin biopsies from II-6 and III-2 (Fig. 1 ) were used to obtain dermal fibroblast cultures. Polymorphic markers within or close to the COL2A1, COL5A2, COL11A1 and COL11A2 genes were analysed as well as the gene (CRTL1) for the proteoglycan link protein which plays an integral role in the stabilisation of cartilage extracellular matrix and has recently been linked to Wagner's disease and Erosive Vitreo- retinopathy (11 ).


Figure 1.Type 2 Stickler syndrome pedigree. Symbols show ocular, auditory, articular, and oral features of affected individuals.


Analysis of the COL2A1 VNTR polymorphism (12 ) showed at least three recombinants with the disease which excluded linkage to COL2A1 up to a recombination fraction of 0.05 (Table 1 ). This region of exclusion would extend to the flanking marker D12S18 distally and well beyond the COL2A1 gene which encompasses only 30 kb (13 ). Linkage analysis of a polymorphic [GT]n repeat in the 5' promoter region of CRTL1 (14 ) showed several recombinations and was also excluded (Table 1 ).

COL5A2 maps to 2q14-q32, the same region of chromosome 2 as COL3A1 (15 ). A highly polymorphic sequence from intron 25 of COL3A1 (16 ) was amplified by PCR and used as a marker for COL5A2. Linkage was excluded by the demonstration of at least two recombinations between the disease and COL5A2 locus. Using the polymorphic markers D6S105 and D6S276 the COL11A2 locus at 6p21 was also excluded by recombination between the disease and marker loci (Table 1 ).

Linkage to COL11A1 was tested with two [CA]n repeat polymorphisms D1S223 and D1S206. These markers are 2 cM from the COL11A1 gene (Warman, M.L., Tiller, G., pers. comm.) at 1p21 (17 ). With D1S223, all meioses were informative and no recombinants were detected, giving a maximum lod score of 2.7. Analysis with D1S206 was only partially informative giving a maximum lod score of 1.2 at zero recombination. These data strongly suggested the disease locus to be COL11A1.

Mutational analysis of COL11A1 was performed on RT-PCR products using RNA extracted from cultured dermal fibroblasts. In total 14 overlapping cDNA products, covering the entire open reading frame, were analysed. Single stranded conformational analysis of cDNA product 5 indicated sequence variation in affected individuals which was absent in normal controls (data not shown). When this PCR product was directly sequenced a heterozygous single base change was observed (Fig. 2 ) which substituted glycine 97 by valine and disrupted the normal Gly-X-Y collagen sequence (the normal convention of numbering the first glycine of the triple helix as 1 has been used). This base change creates a BsrI restriction enzyme site and incubation of the cDNA with this enzyme confirmed the presence of the mutation in the RT-PCR products (Fig. 3 ). The gene structure of COL11A1 has not yet been determined, however the corresponding region in COL11A2 would lie within exon 19 (18 ). Genomic DNA from each family member was amplified using primers 5' and 3' of the base change, in regions likely to lie within exons 18 and 20. A product of 1.4 kb was obtained. The enzyme BsrI cut the DNA normal DNA into three fragments of approximately 525, 475 and 400 bp. In affected individuals an extra BsrI site was detected which cut the 400 bp band approximately in half, resulting in two fragments of around 200 bp, which appear as a single band. The seven affected individuals all possessed the extra BsrI site and must consequently carry the glycine to valine substitution (Fig. 4 ). Analysis of 100 chromosomes from 50 unrelated controls produced only the pattern of bands seen in the normal family members (data not shown).


Figure 2. Sequence analysis. Sequence obtained by direct sequencing of RT-PCR product 5 from III-2 and a normal control (C1). The heterozygous T/G base in the patient is indicated and the alteration to the amino acid sequence shown.


Figure 3. cDNA analysis. The RT-PCR product 5 from II-6, III-2 and two normal controls (C1, C2) was incubated with restriction enzyme BsrI and then analysed by agarose gel electrophoresis, along with known standards (M). The two fragments produced by the new BsrI site are indicated by arrow heads.


Figure 4.Genomic analysis. Amplified genomic DNA containing the proposed exon 19 was amplified from each family member and incubated with BsrI. The products were analysed by agarose gel electrophoresis, along with standard markers (M) as indicated. The extra band present in digested DNA from affected individuals is indicated by the arrow head.


DISCUSSION

The evidence that this base change in COL11A1 is the causative mutation in this pedigree is four fold. Firstly, Sticklers syndrome Type 1 is consistently caused by mutations of COL2A1 (19 ,20 ). Type XI collagen is known to associate with type II collagen fibers and it is now known that the [alpha]3(XI) collagen chain is a product of the COL2A1 gene. This implies a functional relationship between collagens II and XI. Secondly, mutations of [alpha]2(XI) collagen, which is not expressed in the vitreous, cause a Stickler-like phenotype but without any ocular involvement (21 ). Thirdly, linkage analysis with markers close to the COL11A1 gene were fully informative and produced a maximum lod score of 2.7, which strongly implied a causative association with the COL11A1 gene. Fourthly, there are numerous precedents in other collagen genes which show that substitutions of triple helical glycines cause inherited disorders of the extracellular matrix (19 ,20 ,22 ,23 ). Furthermore such change does not occur in the normal general population.

The mutation will have a dominant negative effect, since it will disrupt the function of normal gene products with which the abnormal [alpha]1(XI) associates, namely [alpha]2(XI), [alpha]3(XI) and [alpha]2(V) collagens.Thus half of the [alpha]1(XI) containing heterotrimers will contain the mutant protein. In contrast all type 1 Stickler mutations of [alpha]1(II)/[alpha]3(XI) have so far been caused by premature termination codons in COL2A1. This causes haploinsufficiency with half normal amounts of wild type [alpha]1(II) and [alpha]3(XI) collagens, but no protein capable of collagen trimer formation. Other dominant negative mutations of COL2A1 have caused more severe disorders such as Kniest dysplasia and achondrogenesis (19 ,20 ) because they affect not only the [alpha]3(XI) chain but also the more abundant homotrimer [alpha]1(II)3 collagen resulting in only 1/8 production of the normal molecule. These permutations may well account for the characteristic and distinct vitreous phenotypes seen in Type 1 and Type 2 Stickler patients. The results from this pedigree provide strong support for previous work (21 ) suggesting that mutations in the genes encoding collagen XI can give rise to some manifestations of Type 2 Stickler syndrome. However, on the basis of our results and studies on bovine vitreous (8 ), it is likely that of these, only mutations in COL11A1 will give the full syndrome including the vitreo-retinal features. The mutation characterised here is the first described in the COL11A1 gene and provides a valuable human comparison with the transgenic mice model which express only normal [alpha]1(XI) collagen and appear to have a more severe phenotype (24 ).

MATERIALS AND METHODS

Linkage analysis

All pedigree members underwent full clinical and ophthalmologic examination by two of the authors (MPS, JDS). Informed written consent was received in all cases and prior ethical approval for the study was obtained. The criteria for diagnosis of Type 2 Stickler syndrome were as follows: (i) architecturally abnormal vitreous gel but absence of Type 1 congenital vitreous anomaly in all affected subjects (2 ); and in addition, any three of the following features: (ii) myopia, stable or progressive, onset at any age; (iii) rhegmatogenous retinal detachment or paravascular pigmented lattice degeneration; (iv) joint laxity with abnormal Beighton score (25 ) with or without radiological evidence of joint degeneration; (v) audiometric confirmation of sensorineural hearing defect; (vi) high arched or cleft palate.

Leukocyte DNA was extracted from 20-30 ml of peripheral blood according to standard procedures. Analysis of the marker loci was carried out by PCR amplification of genomic DNA using the reported primer sequences in 25 [mu]l reaction volumes. Each reaction contained a forward primer which had been end labeled with [gamma]32P ATP and T4 polynucleotide kinase. Alleles were separated by electrophoresis in 4-6% denaturing polyacrylamide gels and visualised by autoradiography. Lod scores were calculated using the LIPED computer program (26 ). Autosomal dominant inheritance was assumed with complete penetrance.

cDNA amplification

Total cytoplasmic RNA was isolated from cultured dermal fibroblasts and used to reverse transcribe cDNA as previously described (27 ). Using the cDNA sequences described by Bernard et al. andYoshika and Ramirez (accession No.J04177) (28 ,29 ) 14 cDNAs were amplified. These covered the entire open reading frame as follows, product [1] bases 142-680; [2] 536-1070; [3] 931-1489; [4] 1349-1893; [5]1784-2348; [6] 2196-2740; [7] 2630-3128; [8] 3007-3528; [9] 3418-3924; [10] 3793-4316; [11] 4168-4721; [12] 4604-5114; [13] 4982-5439; [14] 5315-5816. Each product was approximately 500 bp in length and overlapped its 5' and 3' neighbours by around 100 bp. Each set of primers corresponded to the first 24 sense and last 24 antisense nucleotides of the 14 products. These were first reverse transcribed using the antisense primer from each product's 3' neighbour. An initial round of amplification used the same antisense primer and the 5' sense primer of the desired final product. The resulting cDNA (around 900 bp) was purified using a Quiquicktm spin column (Quiagen) and eluted in 50 [mu]l of 10 mM Tris-HCl pH 8.0, 0.1 mM EDTA. One [mu]l of this was then used to amplify the final product (around 500 bp) using the nested 3' antisense primer contained within the initial amplification product but the same 5' primer. The antisense primer used for reverse transcription and primary amplification of product 14 covered bases 6010-6033. All amplification reactions were performed using an Ampliwaxtm PCR Gem (Perkin Elmer) to utilise the hot start technique. A final reaction volume of 100 [mu]l contained 20 mM Tris-HCl pH 8.4, 50 mM KCl, 2.5 mM MgCl2, 200 [mu]M of each dNTP, 25 pmol of each primer and 2.5 U Taq DNA polymerase. After initial denaturation of 5 min at 95oC, 35 cycles of 95oC 1.5 min, 65oC 1.5 min and 72oC 3 min were used to obtain the cDNA products

Single stranded conformational analysis

Each cDNA product was incubated with restriction enzymes which cut the cDNA at 1-3 sites. For most products two different restriction enzymes were used to generate at least one fragment of a size (around 200 bp or less) suitable for SSCP analysis. After digestion 10 [mu]l of loading buffer (95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol) was added to the 20 [mu]l reactions, and heat denatured at 97-100oC for 5 min. Electrophoresis was performed at 4oC in a 0.75 mM thick gel which consisted of 0.5 * MDE (Flowgen) 0.6 * TBE buffer. Bands were visualised by silver staining.

Sequencing

For sequencing, a cDNA amplification product was purified on a Quiquicktm spin column and eluted in water. It was then directly cycle sequenced using the Exo(-) Pfu cyclisttm DNA sequencing kit (Stratagene) as recommended by the manufacturers. The products were analysed in a 6% denaturing polyacrylamide gel and autoradiographed.

Restriction enzyme analysis

Genomic DNA from all 16 family members and 50 normal unrelated controls were amplified essentially as described above using the primers X18S (5'gggtttgatggacttccgggtctg) and X20AS (5'tggaagacctcttggtccaatttc) The 1.4 kb products were incubated with the restriction enzyme BsrI at 65oC, as were the product 5 cDNAs from two affected and two normal individuals. These were then analysed by electrophoresis in a 2% agarose gel, stained with ethidium bromide and visualised under UV light.

ACKNOWLEDGEMENTS

The authors are grateful to the many consultants who have referred patients to the vitreo-retinal service at Addenbrooke's Hospital. MPS is in receipt of an Oxford Ophthalmological Congress Research Scholarship and a grant from the Addenbrooke's NHS Trust Endowment Fund. RW is in receipt of a research grant from the Iris Fund for the Prevention of Blindness. The authors are grateful to Dr D.E. Barton for valuable help with grant submission. We thank Dr George Tiller from Vanderbilt University Medical Center, Nashville, TN and Dr Matt Warman from the Department of Clinical Genetics at Case Western Reserve University School of Medicine, Cleveland, Ohio for helpful discussions and primer details for COL11A1 and COL11A2. We thank Dr Alan Nicholls from MRC Connective Tissue Genetics Group, Cambridge for COL3A1/COL5A2 markers.

REFERENCES

1 Herrman, J., France ,T.D., Spranger, J.W., Opitz, J.M., Wiffler, C (1975) The Stickler syndrome (hereditary arthro-ophthalmopathy). Birth Defects, Orig. Art. Serv. 2, 76-103.

2 Scott, J.D. (1980) Congenital myopia and retinal detachment. Trans. Opthalmol Soc. UK 100, 69-71.

3 Snead, M.P.,Payne, S.J., Barton, D.E., Yates, J.R.W., Al-Imara, L., Pope, F.M., and Scott, J.D. (1994) Stickler syndrome: Correlation between vitreo-retinal phenotypes and linkage to COL 2A1. Eye 8, 609-614. MEDLINE Abstract

4 Burgeson, R.E., Hebda, P.A. Morris, N.P., Hollister, D.W(1982) Human cartilage collagens. Comparison of cartilage collagens with human type V collagen. J. Biol. Chem. 257, 7852-7856. MEDLINE Abstract

5 Mendler, M., Eich-Bender, S.G., Vaughan, L., Winterhalter, K.H., Bruckner, P. (1989) Cartilage contains mixed fibrils of collagen types II, IX, and XI. J. Cell Biol. 108, 191-197. MEDLINE Abstract

6 Fichard, A., Kleman, J.-P., and Ruggiero F. (1994) Another look at collagen V and XI molecules. Matrix Biol. 14, 515-531.

7 Vikkula, M., Mariman, E.C.M., Lui, V.C.H., Zhidkova, N.I., Tiller, G.E., Goldring, M.B., van Beersum, S.E.C., de Waal Malefijt, M.C., van den Hoogen, F.H.J., Ropers, H.-H., Mayne, R., Cheah, K.S.E., Olsen, B.R., Warman, M.L., Brunner, H.G. (1995) Autosomal dominant and recessive osteochondrodysplasias associated with the COL11A2 locus. Cell 80, 431-437. MEDLINE Abstract

8 Mayne, R., Brewton, R.G., Mayne, P.M., Baker, J.R. (1993) Isolation and characterisation of the chains of type V / type XI collagen present in bovine vitreous. J. Biol. Chem. 268, 9381-9386. MEDLINE Abstract

9 Eyre, D. and Wu, J.J. (1987) The type XI or 1[alpha]2[alpha]3[alpha] collagen. In Mayne, R. and Burgeson, R.E. (eds) Structure and function of collagen types. New York, Academic Press, pp. 261-281.

10 Sandell, L.J., Morris, N., Robbins, J.R., Goldring, M.B (1991) Alternatively spliced type II procollagen mRNAs define distinct populations of cells during vertebral development: Differential expression of the amino-propeptide. J. Cell. Biol. 114, 1307-1319. MEDLINE Abstract

11 Brown, D.M., Graemiger, R.A., Hergersberg, M., Schinzel, A., Messmer, E.P., Niemeyer, G., Schneeburger, S.A., Streb, L.M., Taylor, C.M., Kimura,A.E., Weingeist, T.A., Sheffield, V.C., Stone, E.M. (1995) Genetic linkage of Wagner disease and Erosive vitreoretinopathy to Chromosome 5q13-14. Arch. Ophthalmol., 113, 671-675. MEDLINE Abstract

12 Stoker, N.G., Cheah, K.S.E., Griffin, J.R., Pope, F.M., Solomon, E. (1985) A highly polymorphic region 3' to the human Type II collagen gene. Nucleic Acids Res. 13, 4613-4622. MEDLINE Abstract

13 Cheah, K.S.E., Stoker, N.G., Griffin, J.R., Grosveld, F.G., Solomon, E. (1985) Identification and characterisation of the human type II collagen gene (COL2A1). Proc. Natl Acad. Sci. USA 82, 2555-2559.

14 Hecht, J.T., Blanton, S.H., Wang, Y., Daiger, S.P., Horton, W.A., Rhodes, C., Yamada, Y., Francomano, C.A. (1992) Exclusion of human proteoglycan link protein (CRTL-1) and Type II collagen COL 2A1 genes in pseudoachondroplasia. Am. J. Med. Genet. 44, 420-424. MEDLINE Abstract

15 Cutting, G.R., McGinniss, M.J., Kasch, L.M., Tsipouras, P., Antonarakis, S.E. (1990) Physical mapping by PFGE localizes the COL3A1 and COL5A2 genes to a 35-kb region on human chromosome 2. Genomics 8, 407-410. MEDLINE Abstract

16 Lee, B., Vitale, E., Superti-Furga, A., Steinmann, B. and Ramirez, F. (1991) G to T transversion at position +5 of a splice donor site causes skipping of the preceding exon in the type III procollagen transcripts of a patient with Ehlers-Danlos syndrome type IV. J. Biol. Chem. 266, 5256-5259. MEDLINE Abstract

17 Henry, I., Bernheim, A., Bernard, M., Van der Rest, M., Kimura, T., Jeanpierre, C., Barichard, F., Berger, R., Olsen BR., Ramirez, F., Junien, C. (1988) Mapping of a human fibrillar collagen gene, pro[alpha]1(XI) (COL11A1) to the p21 region of chromosome 1. Genomics 3, 87-90. MEDLINE Abstract

18 Vuoristo, M., Pihlajamaa, T., Vandenberg, P., Prockop, D., Ala-Kokko L. (1995) The human COL11A2 gene structure indicates that the gene has not evolved with the genes for the major fibrillar collagens. J. Biol. Chem. 270, 22873-22881.

19 Vikkula., Metsaranta, M., Ala-Kokko, L. (1994) Type II collagen mutations in rare and common cartilage diseases. Ann. Med. 26, 107-114. MEDLINE Abstract

20 Spranger, J., Winterpacht, A., Zabel, B. (1994) The type II collagenopathies a spectrum of chondrodysplasias. Eur. J. Pediatr. 153, 56-65. MEDLINE Abstract

21 Brunner, H.G., van Beersum, S.E.C., Warman, M.L., Olsen, B.R., Ropers, H.-H., Mariman, E.C.M. (1994) A Stickler syndrome gene is linked to chromosome 6 near the COL11A2 gene. Hum. Mol. Genet. 3, 1561-1564. MEDLINE Abstract

22 Kuivaniemi, H., Tromp, G., Prockop, D.J. (1991) Mutations in collagen genes: Causes of rare and some common diseases in humans. FASEB J. 5, 2052-2060. MEDLINE Abstract

23 Cristiano, A.M., Ryynanen, M., Uitto, J. (1994) Dominant dystrophic epidermolysis bullosa: Identification of a glycine-to-serine substitution in the triple-helical domain of type VII collagen. Proc. Natl Acad. Sci. USA 91, 3549-3553.

24 Li, Y., Lacerda, D.A., Warman, M.L., Beier, D.R., Yoshioka, H., Ninomiya, Y., Oxford, J.T., Morris, N.P., Andrikopoulos, K., Ramirez, F., Wardell, B.B., Lifferth, G.D., Teuscher, C., Woodward, S.R., Taylor, B.A., Seegmiller, R.E., Olsen, B.R. et al. (1995) A fibrillar collagen gene, COL11A1, is essential for skeletal morphogenesis. Cell 80, 423-430. MEDLINE Abstract

25 Beighton, P., Solomon, L., Soskolene, L (1973) Articular mobility in an African population. Ann. Rheum. Dis. 32, 413-418. MEDLINE Abstract

26 Ott, J. (1974) Estimation of the recombination fraction in human pedigrees: efficient computation of the likelihood for human linkage studies. Am. J. Hum. Genet. 26, 588-597. MEDLINE Abstract

27 Johnson,P.H., Richards, A.J., Lloyd, J.C., Pope, F.M., Hopkinson, D.A. (1995) Efficient strategy for the detection of mutations in the acrogeric Ehlers-Danlos syndrome type IV. Hum. Mut. 6, 336-342. MEDLINE Abstract

28 Bernard, M., Yoshioka,H., Rodrigez, E., Van der Rest, M., Kimura, T., Ninomiya, Y., Olsen, BR., Ramirez, F. (1988) Cloning and sequencing of pro-[alpha]1(XI) collagen cDNA demonstrates that type XI belongs to the fibrillar class of collagens and reveals that the expression is not restricted to cartilagenous tissue. J. Biol. Chem. 263, 17159-17166. MEDLINE Abstract

29 Yoshika, H. and Ramirez, F. (1990) Pro-[alpha]1(XI) collagen. Structure of the amino-terminal propeptide and expression of the gene in tumor cell lines. J. Biol. Chem. 265, 6423-6426.

*To whom correspondence should be addressed

This page is maintained by OUP admin. Last updated Thu Oct 31 15:27:05 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Pharmacol. Rev.Home page
H. Jarvelainen, A. Sainio, M. Koulu, T. N. Wight, and R. Penttinen
Extracellular Matrix Molecules: Potential Targets in Pharmacotherapy
Pharmacol. Rev., June 1, 2009; 61(2): 198 - 223.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
W. Halfter
Change in Embryonic Eye Size and Retinal Cell Proliferation following Intravitreal Injection of Glycosaminoglycans
Invest. Ophthalmol. Vis. Sci., August 1, 2008; 49(8): 3289 - 3298.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
W. Halfter, U. Winzen, P. N. Bishop, and A. Eller
Regulation of eye size by the retinal basement membrane and vitreous body.
Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3586 - 3594.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
A. G. Marneros and B. R. Olsen
Physiological role of collagen XVIII and endostatin
FASEB J, May 1, 2005; 19(7): 716 - 728.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
A. J. Richards, S. Meredith, A. Poulson, P. Bearcroft, G. Crossland, D. M. Baguley, J. D. Scott, and M. P. Snead
A Novel Mutation of COL2A1 Resulting in Dominantly Inherited Rhegmatogenous Retinal Detachment
Invest. Ophthalmol. Vis. Sci., February 1, 2005; 46(2): 663 - 668.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
X. Jiao, R. Ritter III, J. F. Hejtmancik, and A. O. Edwards
Genetic Linkage of Snowflake Vitreoretinal Degeneration to Chromosome 2q36
Invest. Ophthalmol. Vis. Sci., December 1, 2004; 45(12): 4498 - 4503.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
A V Poulson, J M M Hooymans, A J Richards, P Bearcroft, R Murthy, D M Baguley, J D Scott, and M P Snead
Clinical features of type 2 Stickler syndrome
J. Med. Genet., August 1, 2004; 41(8): e107 - e107.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Koch, F. Laub, P. Zhou, R. A. Hahn, S. Tanaka, R. E. Burgeson, D. R. Gerecke, F. Ramirez, and M. K. Gordon
Collagen XXIV, a Vertebrate Fibrillar Collagen with Structural Features of Invertebrate Collagens: SELECTIVE EXPRESSION IN DEVELOPING CORNEA AND BONE
J. Biol. Chem., October 31, 2003; 278(44): 43236 - 43244.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
S. L. Go, A. Maugeri, J. J. S. Mulder, M. A. van Driel, F. P. M. Cremers, and C. B. Hoyng
Autosomal Dominant Rhegmatogenous Retinal Detachment Associated with an Arg453Ter Mutation in the COL2A1 Gene
Invest. Ophthalmol. Vis. Sci., September 1, 2003; 44(9): 4035 - 4043.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
P. Paluru, S. M. Ronan, E. Heon, M. Devoto, S. C. Wildenberg, G. Scavello, A. Holleschau, O. Makitie, W. G. Cole, R. A. King, et al.
New Locus for Autosomal Dominant High Myopia Maps to the Long Arm of Chromosome 17
Invest. Ophthalmol. Vis. Sci., May 1, 2003; 44(5): 1830 - 1836.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
C. Braybrook, S. Lisgo, K. Doudney, D. Henderson, A. C. B. Marcano, T. Strachan, M. A. Patton, L. Villard, G. E. Moore, P. Stanier, et al.
Craniofacial expression of human and murine TBX22 correlates with the cleft palate and ankyloglossia phenotype observed in CPX patients
Hum. Mol. Genet., October 15, 2002; 11(22): 2793 - 2804.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
C. C. Morton
Genetics, genomics and gene discovery in the auditory system
Hum. Mol. Genet., May 15, 2002; 11(10): 1229 - 1240.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. L. Sertie, V. Sossi, A. A. Camargo, M. Zatz, C. Brahe, and M. R. Passos-Bueno
Collagen XVIII, containing an endogenous inhibitor of angiogenesis and tumor growth, plays a critical role in the maintenance of retinal structure and in neural tube closure (Knobloch syndrome)
Hum. Mol. Genet., August 12, 2000; 9(13): 2051 - 2058.
[Abstract] [Full Text] [PDF]

Home page
 Arch Otolaryngol Head Neck SurgHome page
A. J. Griffith, S. S. Gebarski, N. T. Shepard, and P. R. Kileny
Audiovestibular Phenotype Associated With a COL11A1 Mutation in Marshall Syndrome
Arch Otolaryngol Head Neck Surg, July 1, 2000; 126(7): 891 - 894.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
J FABER, A WINTERPACHT, B ZABEL, W GNOINSKI, A SCHINZEL, B STEINMANN, and A SUPERTI-FURGA
Clinical variability of Stickler syndrome with a COL2A1 haploinsufficiency mutation: implications for genetic counselling
J. Med. Genet., April 1, 2000; 37(4): 318 - 320.
[Full Text]

Home page
 Br J OphthalmolHome page
A. J Richards, S. Martin, J. R W Yates, J. D Scott, D. M Baguley, F M. Pope, and M. P Snead
COL2A1 exon 2 mutations: relevance to the Stickler and Wagner syndromes
Br J Ophthalmol, April 1, 2000; 84(4): 364 - 371.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
U. K. Blaschke, E. F. Eikenberry, D. J. S. Hulmes, H.-J. Galla, and P. Bruckner
Collagen XI Nucleates Self-assembly and Limits Lateral Growth of Cartilage Fibrils
J. Biol. Chem., March 31, 2000; 275(14): 10370 - 10378.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
J. A GUGGENHEIM, G. KIROV, and S. A HODSON
The heritability of high myopia: a reanalysis of Goldschmidt's data
J. Med. Genet., March 1, 2000; 37(3): 227 - 231.
[Full Text]

Home page
 Rheumatology (Oxford)Home page
Z. Mustafa, K. Chapman, C. Irven, A. J. Carr, K. Clipsham, J. Chitnavis, J. S. Sinsheimer, V. A. Bloomfield, M. McCartney, O. Cox, et al.
Linkage analysis of candidate genes as susceptibility loci for osteoarthritis--suggestive linkage of COL9A1 to female hip osteoarthritis
Rheumatology, March 1, 2000; 39(3): 299 - 306.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Murakami, V. Lefebvre, and B. de Crombrugghe
Potent Inhibition of the Master Chondrogenic Factor Sox9 Gene by Interleukin-1 and Tumor Necrosis Factor-alpha
J. Biol. Chem., February 4, 2000; 275(5): 3687 - 3692.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
M. P Snead and J. R W Yates
Clinical and molecular genetics of Stickler syndrome
J. Med. Genet., May 1, 1999; 36(5): 353 - 359.
[Abstract] [Full Text]

Home page
 Genome ResHome page
B. J. B. Keats and C. I. Berlin
Genomics and Hearing Impairment
Genome Res., January 1, 1999; 9(1): 7 - 16.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (113)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Richards, A. J.
Right arrow Articles by Snead, M. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Richards, A. J.
Right arrow Articles by Snead, M. P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?