Tissue and lineage-specific variation in inactive X chromosome expression of the murine Smcx gene
Tissue and lineage-specific variation in inactive X chromosome expression of the murine Smcx geneLaura Carrel, Patricia A. Hunt and Huntington F. Willard*
Department of Genetics and Center for Human Genetics, Case Western Reserve University School of Medicine and University Hospitals of Cleveland, Cleveland, OH, 44106, USA
Received June 19, 1996;Revised and Accepted July 5, 1996
To understand how gene expression patterns are established on the inactive X chromosome during development, we have studied the murine gene Smcx, which is expressed from both the active and inactive mouse X chromosomes. In all tissues assayed, Smcx only partially escapes X inactivation, with expression levels from the inactive X allele ~30-65% that of the active X allele. Additionally, inactive X expression levels differed between extraembryonic and embryonic tissues and among different tissues from newborn and adult mice. Imprinted extraembryonic tissue had the lowest levels of inactive X Smcx expression, whereas the highest levels were in heart. These data suggest that the chromosomal basis of X inactivation differs among tissues, perhaps reflecting differences in the timing or regulation of inactivation in these cell lineages.
X chromosome inactivation silences most genes on one X chromosome in mammalian females to equalize dosage with males who have only a single X chromosome (reviewed in1 ,2 ). The initiation of X inactivation early during development requires the presence in cis of the X inactivation center (XIC); the XIST gene, which maps to this region and is expressed exclusively from the inactive X chromosome, is required for this process and demonstrates many, but perhaps not all, of the properties expected for the XIC (3 -7 ). Once inactivation has spread across the chromosome and X-linked gene expression patterns are established, this chromosomal state must be propagated and maintained throughout all subsequent somatic cell divisions by an as yet poorly understood process. As one approach to understand the chromosomal basis of X inactivation, genes that `escape' inactivation [i.e. those expressed from both the active (Xa) and inactive X (Xi) chromosomes] have been studied to determine whether they contain or lack specific elements or identify regions involved in the process of X inactivation. At least in humans, some genes that escape inactivation appear to be clustered (8 ,9 ). Nonetheless, the developmental and chromosomal mechanism(s) whereby these genes are expressed from the Xi chromosome remain unknown.
To address these issues, we have studied a gene, Smcx, that is expressed from the Xa and Xichromosomes in mouse. Smcx (also known as Xe169) (10 ,11 ) has a Y-linked homologue (12 ) that functions as the H-Y minor histocompatability antigen (13 ). Other X-linked genes that have ubiquitously expressed functional Y-linked homologues (e.g. the human genes ZFX and RPS4X) have been demonstrated to be fully expressed from the inactive X chromosome (14 ,15 ). Thus, the X-linked Smcx gene would be predicted to similarly escape inactivation (and be fully expressed from the inactive X) to ensure proper dosage compensation between males and females.
We have analyzed Smcx expression from the Xi in the context of three different systems: non-random inactivation in different tissues from an X;autosome translocation carrier, non-random X inactivation in imprinted extraembryonic tissues, and embryonic tissues from crosses in which X inactivation patterns are determined by different alleles of the X controlling element (Xce) (Fig. 1 a). Unexpectedly, our results indicate that, despite having an expressed Y-linked homologue, Smcx only partially escapes X inactivation. Further, Xi expression levels differ among different tissues and between extraembryonic and embryonic tissues, thus suggesting that the chromosomal basis for X inactivation may differ among tissues, perhaps reflecting the timing of inactivation in these cell lineages.
The mouse crosses in these studies are outlined in Figure 1 a. Expression of Smcx was first analyzed in inter-subspecies F1 female offspring resulting from the mating of a female carrying Searle's translocation, T(X;16)16H (T16H), and a Mus musculus castaneus (CAST) male. T16H females demonstrate non-random inactivation of the paternal X (Xp); in balanced translocation females, although either X chromosome carrying the Xic (the normal or the 16X) can be inactivated initially, cells with an inactive 16X chromosome are dosage imbalanced and are selected against (16 -18 ). This interspecific cross provides multiple polymorphisms to distinguish alleles on the active maternal X (Xm) from the inactive Xp (e.g. Fig. 1 b and refs 9 ,19 ,20 ). Two control genes, Hprt and Xist, were analyzed to establish that all samples have complete non-random inactivation, since Xist is expressed exclusively from the Xi chromosome (21 ,22 ) while Hprt is subject to inactivation (23 ) (Fig. 1 b). Therefore, in these experiments, any CAST Smcx expression detected must reflect expression from the Xi. RT-PCR of cDNA from F1 female offspring indicates that both Smcx alleles are transcribed, confirming that Smcx escapes X inactivation (bottom panel, Fig. 1 b) (10 ,11 ). However, the intensity of Xp and Xm amplification products is unequal, suggesting that expression of Smcx from the Xi is reduced relative to the Xa.
Relative levels of Smcx expression from the Xi were analyzed using a quantitative RT-PCR assay, whereby the ratio of Smcx alleles could be reproduced consistently. Levels were measured in both embryonic and extraembryonic tissues. In mouse, the earliest X inactivation is imprinted with Xp non-randomly inactivated in some extraembryonic tissues at 3.5 to 4.5 days post coitum (d.p.c.) (24 -26 ). Inactivation of embryonic tissues initiates at ~5.5 d.p.c. (25 ,27 ), and recent data suggest that it may be completed in some tissues as late as 10.5 d.p.c. (28 ). In all (T16H * CAST) F1 embryos tested, Smcx partially escaped X inactivation even at the earliest timepoint analyzed, 10.5 d.p.c. (Fig. 2 ). For the three embryos tested, Smcx Xi levels were an average of 42% (+- 1%) of Xa levels, with no significant difference between embryos. Further, in a 12.5 d.p.c. F1 embryo in which expression in yolk sac endoderm and in the embryo proper were compared directly, the level of Xi expression in extraembryonic yolk sac endoderm (31% of Xa) was significantly lower (p <0.001) than levels measured in embryonic tissues. Similar levels of Xi expression in yolk sac endoderm are also reported by Sheardown et al. in the accompanying paper (29 ). These data suggest that Xi expression of Smcx is different in imprinted (non-randomly inactivated) extraembryonic tissues and in randomly inactivated embryonic tissues (Fig. 1 a), although whether these differences have a temporal or an ontological basis remains unknown.
The low levels of Smcx Xi expression in embryos and in tissues from newborn and adult mice could represent partial expression in each cell within these tissues or complete reactivation in a small subset of cells. To distinguish these possibilities, a cell line was established from tail fibroblasts from a (C57BL/6 * CAST) F1 newborn female and expression was tested in independent single-cell subclones. Hprt expression data indicate that the CAST X chromosome was the active X in each of the five subclones analyzed in detail (Fig. 3 ), although the C57BL/6 was the active X in one of four other clones not shown in Figure 3 . If Smcx was active in only a subset of cells, subclone expression levels would be predicted to vary. However, the Smcx Xi allele was expressed at similar levels in each clone (notably less than the Xa allele) (Fig. 3 ), suggesting (as the simplest hypothesis) that Xi levels within tissues reflect the reduced expression from each cell within that tissue, rather than cellular heterogeneity.
Smcx was previously reported to escape X inactivation based on expression studies in F1 interspecific female mice carrying the T16H translocation (10 ,11 ). However, neither of these earlier studies examined levels of Xi expression. In our work, Smcx expression has been analyzed in translocation females with non-random X inactivation, in extraembryonic tissues in which X inactivation is subject to regulation by imprinting, and in embryos in which the initiation of X inactivation is influenced by the Xce locus. Although Smcx has a constitutively expressed Y-linked homologue, in each of these contexts and at all timepoints tested, the data indicate that Smcx expression from the Xi is reduced significantly relative to Xa levels. Additionally, levels of XiSmcx expression in different tissues and/or lineages were not equivalent. This suggests that either complete dosage compensation is not necessary or that complete escape from inactivation is not necessary for dosage compensation. If the Y homologue is expressed at similar levels as the X-linked gene, our studies would predict higher levels of Smcx in male cells than in female cells.
The initiation of inactivation in extraembryonic membranes is clearly different than in embryonic tissues, occurring at an earlier timepoint and involving exclusively the Xp chromosome. However, the chromosomal basis of X inactivation in both lineages has been generally assumed to be identical. Extraembryonic tissues show less DNA methylation than embryonic tissues (33 ), a finding that might have predicted relaxed regulation of genes on the inactive X, rather than the more stringent control or silencing that is reported here for Smcx. In mouse, only one other gene, an [alpha]-fetoprotein transgene integrated on the X chromosome, has shown inactivation differences between extraembryonic and embryonic tissues (34 ). However, this effect is opposite to what was seen for Smcx, since the transgene was subject to X inactivation in fetal liver, yet escaped inactivation in extraembryonic tissues.
Tissue-specific variation and age-related reactivation in inactive X expression has been reported for the G6pd gene in the Virginia opossum (35 ). X inactivation in marsupials preferentially silences the Xp chromosome, yet this inactivation has been thought to be less stable than eutherian X inactivation (reviewed in 36 ). While its homologous loci in mouse and human are subject to inactivation, the tissue-variable expression pattern observed for G6pd in this marsupial is similar to that reported here for Smcx. This may suggest that the developmental and/or chromosomal mechanisms of inactivation in marsupials and eutherian mammals are more similar than previously thought and that it is the differences for particular genes in their chromosomal location, heterochromatin context, or other gene-specific features that explain variability in expression levels and in their stability. The analysis of many more genes in marsupials, mice, and in humans will be required to examine this hypothesis.
These results add complexity to the study of X inactivation by demonstrating that Xi expression, at least at the Smcx locus, is influenced in a tissue-specific manner (see model, Fig. 4 ). Although more complex models involving stochastic control of gene expression are formally possible (37 ), the lack of variability among single-cell subclones argues that the observed tissue-specific differences reflect the early establishment of inactivation patterns within each tissue, and not long-term maintenance of these patterns. Such heterochromatin-induced differences could reflect the local chromatin context at Smcx, established during development as a function of the timing of X inactivation in specific tissues. Extraembryonic tissues, which initiate inactivation early, have the lowest levels of XiSmcx expression. Studies of an X-linked lacZ trangene indicate that X inactivation is completed at different times in different embryonic tissues (28 ). Of the tissues reported to complete inactivation late, only heart has been examined for Smcx expression and has the highest levels of Xi expression reported here. A temporal model posits that the establishment of inactive chromatin differs between tissues in a time-dependent fashion and is more complete the earlier inactivation occurs. Such a model need not apply to all genes and/or all regions on the chromosome; indeed, a recent study (38 ) demonstrated that two X-linked genes do not show differences in inactivation rates. Alternatively, tissue-specific control elements may influence the extent of X inactivation independent of the timing of inactivation by altering heterochromatin formationin specific tissues or by regulating the ability to activate Smcx transcription within heterochromatin. Such a putative effect might be specific to Smcx or might relate to X inactivation generally.
Females carrying the T16H translocation and CAST males were obtained from the Jackson Laboratory (Bar Harbor, ME). Additional T16H females, C57BL/6 females and F1 interspecific animals were bred in house. For timed matings plug day was counted as day 0. Yolk sac endoderm was isolated by dissociation with pancreatin/ trypsin or glycine (42 ). Embryos were separated into two parts, and all samples were snap frozen in liquid nitrogen prior to RNA and DNA isolation. Embryos in this study were analyzed at 10.5 and 12.5 d.p.c., timepoints when X inactivation is complete (27 ,28 ) as well ascell selection in T16H females (16 -18 ). One 12.5 d.p.c. embryo was the progeny of a T16H female mated to a second generation backcross [or N(2)] male derived from the backcross of a (C57BL/6 * CAST) F1 female to a C57BL/6 male. This N(2) male carries the CAST alleles of Hprt, Xist and Smcx.
Balanced T16H female embryos were distinguished from unbalanced and normal littermates by fluorescence in situ hybridization (43 ) using probes proximal (DXWas70) and distal (YAC B2-4, that includes Xist) to the T16H breakpoint, together with a chromosome count [to exclude the few animals with an unbalanced karyotype that may survive to 10.5 d.p.c. (44 )]. Alternatively, embryos were scored as females if DNA analysis showed two Hprt and Xist alleles and translocation carriers were further identified by complete non-random paternal Xist and maternal Hprt expression.
RNA and DNA were isolated using TRIzol (GibcoBRL) according to the manufacturer's recommendations except that RNA samples were extracted twice with TRIzol to remove residual DNA. Yolk sac endoderm samples were isopropanol precipitated overnight at -80oC in the presence of 1 [mu]g of yeast tRNA as a carrier. RNA from yolk sac endoderm samples was dissolved in 10 [mu]l H2O, and 3 [mu]l used for subsequent reverse transcription steps. For embryos or tissues, 1-5 [mu]g of RNA was used. Reverse transcription was essentially as described (45 ), except that 10 pg of oligo dT was added in addition to an equivalent concentration of random hexamers. From a final reverse transcription reaction volume of 20 [mu]l, 1 [mu]l or 1 [mu]l of a 1:10 dilution was used for subsequent PCR analysis.
Standard PCR conditions have been described (45 ) and all primers were annealed at 55oC. For Hprt, a G -> C change at nucleotide 1143 was identified in CAST (sequence from ref. 46 ). Alleles were differentiated by HinfI digestion of amplification products generated with Hprt-a: GCCTAAGATGAGCGCAAGTT and b: GTGGGAAAATACAGCCAACACT. The highly polymorphic 5' repeat region of Xist (47 ) revealed several sequence changes and a net 3 bp size difference in CAST. The entire 503 bp repeat region was amplified with primers Xist mp2: GTGTGTATGGTGGACTTACCT and mp7: ACACGCAAATTAGAGGCATAG (47 ), and the products were digested with NcoI, which recognizes a single non-polymorphic restriction site. Using the end-labeled primer Xist-mp2, the smaller 227 and 230 bp labeled products could easily be separated on 5% polyacrylamide sequencing gels. Sequence from a Smcx cDNA clone (43 ) in different mouse strains identified several polymorphisms, including a stretch of ten cytosines in the 3' UTR in M. domesticus strains that is reduced to eight cytosines in CAST. A 446 bp product was amplified with primers Smcx 1: CAAGCCTGCTTCTTAGAGGTG and 7: GGACAGCTATGTGAAGTTTCCT, and subsequently all products were digested with the non-polymorphic restriction enzyme EcoO109. Amplification with the labeled primer Smcx-1 generates labeled 182 and 180 bp fragments in the different mouse strains.
Dried acrylamide gels were exposed to phosphor screens and radioactivity was directly measured with a PhosphorImager 445 SI (Molecular Dynamics). Band intensity was determined by measuring counts for each band within a fixed area and subtracting lane background across that same area. Because the polymorphic size difference is small, Smcx alleles that are present in equimolar ratios should amplify equally. Any deviation from this 1:1 (Xp:Xm) ratio should reflect differences in the starting concentration (i.e., in cDNA samples, expression differences) of either allele. Further, since both alleles are co-amplified and compared in relation to each other, samples are internally controlled and the ratios will not be affected by possible variation in sample loading or initial concentration differences. A series of control experiments was performed to establish the number of amplification cycles within linear range of the amplification profile conditions in which the relative ratio of Smcx alleles could be reproduced consistently. For each sample tested, the Xp/Xm ratio was constant (data not shown). In subsequent experiments, 26 or 28 cycles of amplification were performed and each sample was repeated multiple times as a measure of consistency.
A polyclonal cell line was established from tail fibroblasts from a (C57BL/6 * CAST) F1 newborn female. This line was maintained in culture and then plated at very low density (no more than 5 cells/ 100 mm dish) to isolate independent single cells, which were subsequently expanded. FISH with an X chromosome probe, DXWas70, indicated that although all subcloned lines were tetraploid, each line demonstrated the presence of four X chromosomes in each cell (>20 cells counted). Exclusive expression of the C57BL/6 allele of Xist and the CAST allele of Hprt demonstrated that in each cell line shown in Figure 3 the CAST X chromosomes were active and C57BL/6 X chromosomes were inactive.
We thank C. Brown for helpful discussions and are grateful to K. Gustashaw, K. Mroz, and R. LeMaire for technical assistance. This work was supported by NIH research grants GM45441 (to HFW) and HD27393 (to PAH).
1 Brown, C. J. and Willard, H. F. (1993) Molecular and genetic studies of human X chromosome inactivation. Adv. Dev. Biol., 2, 37-72.
2 Willard, H. F. (1995) Sex chromosomes and X chromosome inactivation. In C. R. Scriver, A. L. Beaudet, W. S. Sly and D. Valle (eds.), The Metabolic Basis of Inherited Disease. McGraw-Hill Publishing Co., New York, pp 719-735.
3 Brown, C. J., Ballabio, A., Rupert, J. L., Lafreniere, R. G., Grompe, M., Tonlorenzi, R. and Willard, H. F. (1991) A gene from the region of the human X inactivation centre is expressed exclusively from the inactive X chromosome. Nature, 349, 38-44.MEDLINE Abstract
4 Brown, C. J., Hendrich, B. D., Rupert, J. L., Lafreniere, R. G., Xing, Y., Lawrence, J. and Willard, H. F. (1992) The human XIST gene: analysis of a 17 kb inactive X-specific RNA that contains conserved repeats and is highly localized within the nucleus. Cell, 71, 527-542.MEDLINE Abstract
5 Kay, G. F., Penny, G. D., Patel, D., Ashworth, A., Brockdorff, N. and Rastan, S. (1993) Expression of Xist during mouse development suggests a role in the initiation of X chromosome inactivation. Cell, 72, 171-182.MEDLINE Abstract
6 Kay, G. F., Barton, S. C., Surani, M. A. and Rastan, S. (1994) Imprinting and X chromosome counting mechanisms determine Xist expression in early mouse development. Cell, 77, 639-650.MEDLINE Abstract
7 Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S. and Brockdorff, N. (1996) The Xist gene is required in cis for X chromosome inactivation. Nature, 379, 131-137.MEDLINE Abstract
8 Miller, A. P., Gustashaw, K., Wolff, D. J., Rider, S. H., Monaco, A. P., Eble, B., Schlessinger, D., Gorski, J. L., van Ommen, G. J., Weissenbach, J. and Willard, H. F. (1995) Three genes that escape X chromosome inactivation are clustered within a 6 Mb YAC contig and STS map in Xp11.21-p11.22. Hum. Mol. Genet., 4, 731-739.MEDLINE Abstract
9 Carrel, L., Clemson, C. M., Dunn, J. M., Miller, A. P., Hunt, P. A., Lawrence, J. B. and Willard, H. F. (1996) X inactivation analysis and DNA methylation studies of the ubiquitin activating enzyme E1 and PCTAIRE-1 genes in human and mouse. Hum. Mol. Genet., 5, 391-401.MEDLINE Abstract
10 Wu, J., Salido, E. C., Yen, P. H., Mohandas, T. K., Heng, H. H. Q., Tsui, L.-C., Park, J., Chapman, V. M. and Shapiro, L. J. (1994) The murine Xe169 gene escapes X-inactivation like its human homologue. Nature Genet., 7, 491-496.MEDLINE Abstract
11 Agulnik, A. I., Mitchell, M. J., Mattei, M.-G., Borsani, G., Avner, P. A., Lerner, J. L. and Bishop, C. E. (1994) A novel X gene with a widely transcribed Y-linked homologue escapes X-inactivation in mouse and human. Hum. Mol. Genet., 3, 879-884.MEDLINE Abstract
12 Agulnik, A. I., Mitchell, M. J., Lerner, J. L., Woods, D. R. and Bishop, C. E. (1994) A mouse Y chromosome gene encoded by a region essential for spermatogenesis and expression of male-specific minor histocompatibility antigens. Hum. Mol. Genet., 3, 873-878.MEDLINE Abstract
13 Wang, W., Meadows, L. R., den Haan, J. M. M., Sherman, N. E., Chen, Y., Blokland, E., Hendrickson, R. C., Bishop, C. E., Hunt, D. F., Goulmy, E. and Engelhard, V. H. (1995) Human H-Y: A male-specific histocompatibility antigen derived from the SMCY protein. Science, 269, 1588-1590.MEDLINE Abstract
14 Fisher, E. M. C., Beer-Romero, P., Brown, L. G., Ridley, A., McNeil, J. A., Lawrence, J. B., Willard, H. F., Bieber, F. R. and Page, D. C. (1990) Homologous ribosomal protein genes on the human X and Y chromosomes: escape from X inactivation and implications for Turner syndrome. Cell, 63, 1205-1218.
15 Schneider-Gadicke, A., Beer-Romero, P., Brown, L. G., Nussbaum, R. and Page, D. C. (1989) The ZFX gene on the human X chromosome escapes X inactivation and is closely related to ZFY, the putative sex determinant on the Y chromosome. Cell, 57, 1247-1258.MEDLINE Abstract
16 Takagi, N. (1980) Primary and secondary nonrandom X chromosome inactivation in early female mouse embryos carrying Searle's translocation T(X;16)16H. Chromosoma, 81, 439-459.MEDLINE Abstract
17 Disteche, C. M., Eicher, E. M. and Latt, S. A. (1981) Late replication patterns in adult and embryonic mice carrying Searle's X-autosome translocation. Exp. Cell Res., 133, 357-362.MEDLINE Abstract
18 McMahon, A. and Monk, M. (1983) X-chromosome activity in female mouse embryos heterozygous for PGK-1 and Searles translocation, T(X;16) 16H. Genet. Res., Cambridge., 41, 69-83.
19 Ashworth, A., Rastan, S., Lovell-Badge, R. and Kay, G. (1991) X-chromosome inactivation may explain the difference in viability of XO humans and mice. Nature, 351, 406-408.MEDLINE Abstract
20 Adler, D. A., Bressler, S. L., Chapman, V. M., Page, D. C. and Disteche, C. M. (1991) Inactivation of the Zfx gene on the mouse X chromosome. Proc. Natl Acad. Sci. USA, 88, 4592-4595.MEDLINE Abstract
21 Brockdorff, N., Ashworth, A., Kay, G. F., Cooper, P., Smith, S., McCabe, V. M., Norris, D. P., Penny, G. D., Patel, D. and Rastan, S. (1991) Conservation of position and exclusive expression of mouse Xist from the inactive X chromosome. Nature, 351, 329-331.MEDLINE Abstract
22 Borsani, G., Tonlorenzi, R., Simmler, M. C., Dandalo, L., Arnaud, D., Capra, V., Grompe, M., Pizzati, A., Muzay, D., Lawrence, C., Willard, H. F., Avner, P. and Ballabio, A. (1991) Characterisation of a murine gene expressed from the inactive X chromosome. Nature, 351, 325-329.MEDLINE Abstract
23 Chapman, V. M. and Shows, T. B. (1976) Somatic cell genetic evidence for X-chromosome linkage of three enzymes in the mouse. Nature, 259, 665-667.MEDLINE Abstract
24 Takagi, N. and Sasaki, M. (1975) Preferential inactivation of the paternally derived X chromosome in the extraembryonic membranes of the mouse. Nature, 256, 640-642.MEDLINE Abstract
25 Monk, M. and Harper, M. I. (1979) Sequential X chromosome inactivation coupled with cellular differentiation in early mouse embryos. Nature, 281, 311-313.MEDLINE Abstract
26 Harper, M. I., Fosten, M. and Monk, M. (1982) Preferential paternal X inactivation in extraembryonic tissues of early mouse embryos. J. Embryol. Exp. Morph., 67, 127-135.MEDLINE Abstract
27 Rastan, S. (1982) Timing of X-chromosome inactivation in postimplantation mouse embryos. J. Embryol. Exp. Morph., 71, 11-24.MEDLINE Abstract
28 Tan, S.-S., Williams, E. A. and Tam, P. P. L. (1993) X-chromosome inactivation occurs at different times in different tissues of the post-implantation mouse embryo. Nature Genet., 3, 170-174.MEDLINE Abstract
29 Sheardown, S., Norris, D., Fisher, A. and Brockdorff, N. (1996) The Smcx gene shows progressive escape from inactivation through ontogeny. Hum. Mol. Genet.,5, 1355-1360.MEDLINE Abstract
30 Cattanach, B. M., Pollard, C. E. and Perez, J. N. (1969) Controlling elements in the mouse X-chromosome 1. Interaction with the X-linked genes. Genet. Res., 14, 223-235.MEDLINE Abstract
31 Johnston, P. G. and Cattanach, B. M. (1981) Controlling elements in the mouse IV. Evidence of non-random X-inactivation. Genet. Res., 37, 151-160.MEDLINE Abstract
32 Cattanach, B. (1993) `News out of Harwell' Identification of the Mus castaneus Xce allele. Mouse Genome, 91
33 Kratzer, P. G., Chapman, V. M., Lambert, H., Evans, R. E. and Liskay, R. M. (1983) Differences in the DNA of the inactive X chromosomes of fetal and extraembryonic tissues of mice. Cell, 33, 37-42.MEDLINE Abstract
34 Krumlauf, R., Chapman, V. M., Hammer, R. E., Brinster, R. L. and Tilghman, S. M. (1986) Differential expression of [alpha]-fetoprotein genes on the inactive X chromosome in extraembryonic and somatic tissues of a transgenic mouse line. Nature, 319, 224-226.MEDLINE Abstract
35 Samollow, P. B., Robinson, E. S., Ford, A. L. and Vandenberg, J. L. (1995) Developmental progression of Gpd expression from the inactive X chromosome of the Virginia opossum. Dev. Genet., 16, 367-378.MEDLINE Abstract
36 Cooper, D. W., Johnston, P. G., Watson, J. M. and Graves, J. A. M. (1993) X-inactivation in marsupials and monotremes. Sem. Dev. Biol., 4, 117-128.
37 Walters, M. C., Fiering, S., Eidemiller, J., Magis, W., Groudine, M. and Martin, D. I. K. (1995) Enhancers increase the probability but not the level of gene expression. Proc. Natl Acad. Sci. USA, 92, 7125-7129.MEDLINE Abstract
38 LeBon, J. M., Tam, P. P. L., Singer-Sam, J., Riggs, A. D. and Tan, S. S. (1995) Mouse endogenous X-linked genes do not show lineage-specific delayed inactivation during development. Genet. Res., 65, 223-227.MEDLINE Abstract
39 Wareham, K. A., Lyon, M. F., Glenister, P. H. and Williams, E. D. (1987) Age related reactivation of an X-linked gene. Nature, 327, 725-727.MEDLINE Abstract
40 Brown, S. and Rastan, S. (1988) Age-related reactivation of an X-linked gene close to the inactivation centre in the mouse. Genet. Res., 52, 151-154.MEDLINE Abstract
41 Salido, E. C., Li, X. M., Yen, P. H., Martin, N., Mohandas, T. K. and Shapiro, L. J. (1996) Cloning and expression of the mouse pseudoautosomal steroid sulphatase gene (Sts). Nature Genet., 13, 83-86.MEDLINE Abstract
42 Hogan, B., Costantini, F. and Lacy, E. (1986) Manipulating the mouse embryo. Cold Spring Harbor Laboratory.
43 Sultana, R., Adler, D. A., Edelhoff, S., Carrel, L., Lee, K., Chapman, V. C., Willard, H. F. and Disteche, C. M. (1995) The mouse Sb1.8 gene located at the distal end of the X chromosome is subject to X inactivation. Hum. Mol. Genet., 4, 257-263.MEDLINE Abstract
44 Takagi, N. and Abe, K. (1990) Detrimental effects of two active X chromosomes on early mouse development. Development, 109, 189-201.MEDLINE Abstract
45 Brown, C. J., Flenniken, A. M., Williams, B. R. G. and Willard, H. F. (1990) X chromosome inactivation of the human TIMP gene. Nucleic Acids Res., 18, 4191-4195.MEDLINE Abstract
46 Melton, D. W., Konecki, D. S., Brennand, J. and Caskey, C. T. (1984) Structure, expression and mutation of the hypoxanthine phosphoribosyltransferase gene. Proc. Natl Acad. Sci. USA, 81, 2147-2151.MEDLINE Abstract
47 Hendrich, B., Brown, C. and Willard, H. (1993) Evolutionary conservation of possible functional domains of the human and murine XIST genes. Hum. Mol. Genet., 2, 663-672.MEDLINE Abstract
48 Buzin, C. H., Mann, J. R. and Singer-Sam, J. (1994) Quantitative RT-PCR assays show Xist RNA levels are low in mouse female adult tissue, embryos, and embryoid bodies. Development, 120, 3529-3536.MEDLINE Abstract
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Thu Oct 31 15:27:05 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
