Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (36)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Carrel, L.
Right arrow Articles by Willard, H. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carrel, L.
Right arrow Articles by Willard, H. F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1361-1367

Tissue and lineage-specific variation in inactive X chromosome expression of the murine Smcx gene
Introduction
Results
   Smcx partially escapes X inactivation
   Levels of Smcx expression from the Xi
   Smcx expression in single-cell clones
Discussion
Materials And Methods
   Mice
   RNA purification
   PCR
   Quantitative PCR analysis
   Single cell subclones
Acknowledgements
    REFERENCES


Tissue and lineage-specific variation in inactive X chromosome expression of the murine Smcx gene

Tissue and lineage-specific variation in inactive X chromosome expression of the murine Smcx gene Laura Carrel, Patricia A. Hunt and Huntington F. Willard*

Department of Genetics and Center for Human Genetics, Case Western Reserve University School of Medicine and University Hospitals of Cleveland, Cleveland, OH, 44106, USA

Received June 19, 1996; Revised and Accepted July 5, 1996

To understand how gene expression patterns are established on the inactive X chromosome during development, we have studied the murine gene Smcx, which is expressed from both the active and inactive mouse X chromosomes. In all tissues assayed, Smcx only partially escapes X inactivation, with expression levels from the inactive X allele ~30-65% that of the active X allele. Additionally, inactive X expression levels differed between extraembryonic and embryonic tissues and among different tissues from newborn and adult mice. Imprinted extraembryonic tissue had the lowest levels of inactive X Smcx expression, whereas the highest levels were in heart. These data suggest that the chromosomal basis of X inactivation differs among tissues, perhaps reflecting differences in the timing or regulation of inactivation in these cell lineages.

INTRODUCTION

X chromosome inactivation silences most genes on one X chromosome in mammalian females to equalize dosage with males who have only a single X chromosome (reviewed in 1 ,2 ). The initiation of X inactivation early during development requires the presence in cis of the X inactivation center (XIC); the XIST gene, which maps to this region and is expressed exclusively from the inactive X chromosome, is required for this process and demonstrates many, but perhaps not all, of the properties expected for the XIC (3 -7 ). Once inactivation has spread across the chromosome and X-linked gene expression patterns are established, this chromosomal state must be propagated and maintained throughout all subsequent somatic cell divisions by an as yet poorly understood process. As one approach to understand the chromosomal basis of X inactivation, genes that `escape' inactivation [i.e. those expressed from both the active (Xa) and inactive X (Xi) chromosomes] have been studied to determine whether they contain or lack specific elements or identify regions involved in the process of X inactivation. At least in humans, some genes that escape inactivation appear to be clustered (8 ,9 ). Nonetheless, the developmental and chromosomal mechanism(s) whereby these genes are expressed from the Xi chromosome remain unknown.

To address these issues, we have studied a gene, Smcx, that is expressed from the Xa and Xi chromosomes in mouse. Smcx (also known as Xe169) (10 ,11 ) has a Y-linked homologue (12 ) that functions as the H-Y minor histocompatability antigen (13 ). Other X-linked genes that have ubiquitously expressed functional Y-linked homologues (e.g. the human genes ZFX and RPS4X) have been demonstrated to be fully expressed from the inactive X chromosome (14 ,15 ). Thus, the X-linked Smcx gene would be predicted to similarly escape inactivation (and be fully expressed from the inactive X) to ensure proper dosage compensation between males and females.

We have analyzed Smcx expression from the Xi in the context of three different systems: non-random inactivation in different tissues from an X;autosome translocation carrier, non-random X inactivation in imprinted extraembryonic tissues, and embryonic tissues from crosses in which X inactivation patterns are determined by different alleles of the X controlling element (Xce) (Fig. 1 a). Unexpectedly, our results indicate that, despite having an expressed Y-linked homologue, Smcx only partially escapes X inactivation. Further, Xi expression levels differ among different tissues and between extraembryonic and embryonic tissues, thus suggesting that the chromosomal basis for X inactivation may differ among tissues, perhaps reflecting the timing of inactivation in these cell lineages.


Figure 1. (a) Mouse crosses used in these experiments. The earliest X inactivation non-randomly inactivates the Xp in extraembryonic membranes at 3.5 to 4.5 d.p.c. Non-random inactivation in T16H translocation carriers differs from the primary non-random inactivation observed in extraembryonic tissues; in balanced translocation females, although either X chromosome carrying the Xic (the normal X or the 16X) can be inactivated initially, cells with an inactive 16X chromosome are dosage imbalanced and are selected against (16-18). In the cross on the right, Xce influences the initial choice of which chromosome is inactivated (31,48). In this cross the CAST allele (Xp) is the Xa in a greater proportion of cells than on the Xi (Xa > Xi), wheras the C57BL/6 allele (Xm) is the Xi in the majority of cells (Xi > Xa). (b) Expression from a 12.5 d.p.c. (T16H * CAST) F1 female embryo. Because primers for each gene amplify an identically sized DNA and cDNA product, the absence of a PCR product in the cDNA samples, in the lane marked -, indicates that there is no amplification without reverse transcription, ensuring that the RNA is not contaminated with DNA. For Hprt, a negative image of the ethidium bromide stained amplification products is shown. To analyze Xist and Smcx, samples were amplified using a 32P end-labeled primer, products resolved on polyacrylamide gels, and autoradiographs are shown. (c) Expression in a chromosomally normal female heterozygous for different Xce alleles. Expression was analyzed in a liver cDNA sample from a [C57BL/6J (Xceb) * CAST] F1 newborn female. For Xist not only are inactivation ratios skewed, but levels of Xist expression are further influenced by Xce effects (21,48), resulting in substantially higher levels of Xist from chromosomes carrying the weaker Xceb allele than from those with the strong XceCAST allele.

RESULTS

Smcx partially escapes X inactivation

The mouse crosses in these studies are outlined in Figure 1 a. Expression of Smcx was first analyzed in inter-subspecies F1 female offspring resulting from the mating of a female carrying Searle's translocation, T(X;16)16H (T16H), and a Mus musculus castaneus (CAST) male. T16H females demonstrate non-random inactivation of the paternal X (Xp); in balanced translocation females, although either X chromosome carrying the Xic (the normal or the 16X) can be inactivated initially, cells with an inactive 16X chromosome are dosage imbalanced and are selected against (16 -18 ). This interspecific cross provides multiple polymorphisms to distinguish alleles on the active maternal X (Xm) from the inactive Xp (e.g. Fig. 1 b and refs 9 ,19 ,20 ). Two control genes, Hprt and Xist, were analyzed to establish that all samples have complete non-random inactivation, since Xist is expressed exclusively from the Xi chromosome (21 ,22 ) while Hprt is subject to inactivation (23 ) (Fig. 1 b). Therefore, in these experiments, any CAST Smcx expression detected must reflect expression from the Xi. RT-PCR of cDNA from F1 female offspring indicates that both Smcx alleles are transcribed, confirming that Smcx escapes X inactivation (bottom panel, Fig. 1 b) (10 ,11 ). However, the intensity of Xp and Xm amplification products is unequal, suggesting that expression of Smcx from the Xi is reduced relative to the Xa.

Levels of Smcx expression from the Xi

Relative levels of Smcx expression from the Xi were analyzed using a quantitative RT-PCR assay, whereby the ratio of Smcx alleles could be reproduced consistently. Levels were measured in both embryonic and extraembryonic tissues. In mouse, the earliest X inactivation is imprinted with Xp non-randomly inactivated in some extraembryonic tissues at 3.5 to 4.5 days post coitum (d.p.c.) (24 -26 ). Inactivation of embryonic tissues initiates at ~5.5 d.p.c. (25 ,27 ), and recent data suggest that it may be completed in some tissues as late as 10.5 d.p.c. (28 ). In all (T16H * CAST) F1 embryos tested, Smcx partially escaped X inactivation even at the earliest timepoint analyzed, 10.5 d.p.c. (Fig. 2 ). For the three embryos tested, Smcx Xi levels were an average of 42% (+- 1%) of Xa levels, with no significant difference between embryos. Further, in a 12.5 d.p.c. F1 embryo in which expression in yolk sac endoderm and in the embryo proper were compared directly, the level of Xi expression in extraembryonic yolk sac endoderm (31% of Xa) was significantly lower (p <0.001) than levels measured in embryonic tissues. Similar levels of Xi expression in yolk sac endoderm are also reported by Sheardown et al. in the accompanying paper (29 ). These data suggest that Xi expression of Smcx is different in imprinted (non-randomly inactivated) extraembryonic tissues and in randomly inactivated embryonic tissues (Fig. 1 a), although whether these differences have a temporal or an ontological basis remains unknown.


Figure 2. Smcx expression in tissues from (T16H * CAST) F1 females. The level of Xi expression is expressed as a fraction relative to Xa expression in the same sample. cDNA samples were prepared from yolk sac and embryo proper from three embryos (patterned bars). While paired samples were examined for only a single (T16H * CAST) F1 embryo, additional yolk sacs from different crosses showed the same low level of Xi expression (see text). Different tissues were examined from three newborns (patterned bars) and two adults at 2 months (solid bars). The standard deviations for each set of measurements are indicated. The number in parentheses above each sample indicates the number of independent PCR reactions that were performed for each sample. Each embryo was divided in half, and either sample gave similar results. As a control, genomic DNA samples demonstrated an Xi/Xa ratio of ~1 (open bar)

Newborn and adult (T16H * CAST) F1 female mice were assayed to determine whether Smcx is always expressed at low levels from the Xi chromosome. Figure 2 compares the results from differrent tissues from five such females. For the animals assayed, levels of Xi Smcx expression in heart were significantly higher than other tissues tested (p <0.01). Expression levels among other tissues tested were not significantly different and were similar to those measured in embryonic samples.

To confirm these observations, Smcx expression was tested in females heterozygous for alleles at the X controlling element (Xce) locus (Fig. 1 a). Females that are homozygous at the Xce locus have essentially random inactivation of either X chromosome (except in extraembryonic tissues). However, in heterozygotes, these alleles influence the percentage of cells inactivating a particular parental allele (30 ,31 ). The C57BL/6 Xceb allele (31 ) is `weaker' than the allele on the CAST X (32 ). Therefore, (C57BL/6 * CAST) F1 females have a higher percentage of cells with the CAST X active, as seen by analyzing the Hprt gene (Fig. 1 c). If Smcx completely escaped inactivation, the Xp/Xm ratio (reflecting the entire cell population) would be 1:1 because each allele is expressed identically whether it is on the Xa or Xi. However, for Smcx (bottom panel, Fig. 1 c), as for Hprt, amplification of Xp is greater than Xm. These data suggest that Xa and Xi Smcx expression are not equal and that the skewed ratio reflects the higher population of cells with the CAST X active. Because Smcx was not fully expressed from the Xi chromosome in any tissue assayed from (T16H * CAST) F1 females, and because a skewed ratio, reflecting an Xce effect, was seen even in a liver sample from a 6 month (C57BL/6 * CAST) F1 female (data not shown), we conclude that the gene never fully escapes X inactivation within the range of timepoints studied.

Smcx Xi expression was also severely repressed in yolk sac endoderm from (C57BL/6 * CAST) F1 females. Controls confirmed that each yolk sac endoderm sample expressed exclusively Xp Xist and was not contaminated with underlying randomly-inactivated yolk sac mesoderm (data not shown). Similar results were seen for eight yolk sacs analyzed, with no apparent difference between samples from embryos at 11.5, 12.5, or 14.5 d.p.c. Expression levels in (C57BL/6 * CAST) F1 females provide an essential control, because the high ratio of Xp:Xm Smcx products (1.75 +- 0.08) in embryonic tissues establishes that the very low ratio in non-randomly inactivated yolk sac endoderm (0.28 +- 0.06) is due to Xa and Xi expression differences and not simply to Smcx allelic differences between parental mouse strains.

Smcx expression in single-cell clones

The low levels of Smcx Xi expression in embryos and in tissues from newborn and adult mice could represent partial expression in each cell within these tissues or complete reactivation in a small subset of cells. To distinguish these possibilities, a cell line was established from tail fibroblasts from a (C57BL/6 * CAST) F1 newborn female and expression was tested in independent single-cell subclones. Hprt expression data indicate that the CAST X chromosome was the active X in each of the five subclones analyzed in detail (Fig. 3 ), although the C57BL/6 was the active X in one of four other clones not shown in Figure 3 . If Smcx was active in only a subset of cells, subclone expression levels would be predicted to vary. However, the Smcx Xi allele was expressed at similar levels in each clone (notably less than the Xa allele) (Fig. 3 ), suggesting (as the simplest hypothesis) that Xi levels within tissues reflect the reduced expression from each cell within that tissue, rather than cellular heterogeneity.


Figure 3. Expression in five independent single-cell subclones isolated from a fibroblast cell line from a (C57BL/6 *CAST) F1 female. Amplification of Hprt establishes that each subclone studied carries the CAST X on the Xa chromsome. The difference in Xi Smcx expression levels between each clone were not significant.

DISCUSSION

Smcx was previously reported to escape X inactivation based on expression studies in F1 interspecific female mice carrying the T16H translocation (10 ,11 ). However, neither of these earlier studies examined levels of Xi expression. In our work, Smcx expression has been analyzed in translocation females with non-random X inactivation, in extraembryonic tissues in which X inactivation is subject to regulation by imprinting, and in embryos in which the initiation of X inactivation is influenced by the Xce locus. Although Smcx has a constitutively expressed Y-linked homologue, in each of these contexts and at all timepoints tested, the data indicate that Smcx expression from the Xi is reduced significantly relative to Xa levels. Additionally, levels of Xi Smcx expression in different tissues and/or lineages were not equivalent. This suggests that either complete dosage compensation is not necessary or that complete escape from inactivation is not necessary for dosage compensation. If the Y homologue is expressed at similar levels as the X-linked gene, our studies would predict higher levels of Smcx in male cells than in female cells.

The initiation of inactivation in extraembryonic membranes is clearly different than in embryonic tissues, occurring at an earlier timepoint and involving exclusively the Xp chromosome. However, the chromosomal basis of X inactivation in both lineages has been generally assumed to be identical. Extraembryonic tissues show less DNA methylation than embryonic tissues (33 ), a finding that might have predicted relaxed regulation of genes on the inactive X, rather than the more stringent control or silencing that is reported here for Smcx. In mouse, only one other gene, an [alpha]-fetoprotein transgene integrated on the X chromosome, has shown inactivation differences between extraembryonic and embryonic tissues (34 ). However, this effect is opposite to what was seen for Smcx, since the transgene was subject to X inactivation in fetal liver, yet escaped inactivation in extraembryonic tissues.

Tissue-specific variation and age-related reactivation in inactive X expression has been reported for the G6pd gene in the Virginia opossum (35 ). X inactivation in marsupials preferentially silences the Xp chromosome, yet this inactivation has been thought to be less stable than eutherian X inactivation (reviewed in 36 ). While its homologous loci in mouse and human are subject to inactivation, the tissue-variable expression pattern observed for G6pd in this marsupial is similar to that reported here for Smcx. This may suggest that the developmental and/or chromosomal mechanisms of inactivation in marsupials and eutherian mammals are more similar than previously thought and that it is the differences for particular genes in their chromosomal location, heterochromatin context, or other gene-specific features that explain variability in expression levels and in their stability. The analysis of many more genes in marsupials, mice, and in humans will be required to examine this hypothesis.

These results add complexity to the study of X inactivation by demonstrating that Xi expression, at least at the Smcx locus, is influenced in a tissue-specific manner (see model, Fig. 4 ). Although more complex models involving stochastic control of gene expression are formally possible (37 ), the lack of variability among single-cell subclones argues that the observed tissue-specific differences reflect the early establishment of inactivation patterns within each tissue, and not long-term maintenance of these patterns. Such heterochromatin-induced differences could reflect the local chromatin context at Smcx, established during development as a function of the timing of X inactivation in specific tissues. Extraembryonic tissues, which initiate inactivation early, have the lowest levels of Xi Smcx expression. Studies of an X-linked lacZ trangene indicate that X inactivation is completed at different times in different embryonic tissues (28 ). Of the tissues reported to complete inactivation late, only heart has been examined for Smcx expression and has the highest levels of Xi expression reported here. A temporal model posits that the establishment of inactive chromatin differs between tissues in a time-dependent fashion and is more complete the earlier inactivation occurs. Such a model need not apply to all genes and/or all regions on the chromosome; indeed, a recent study (38 ) demonstrated that two X-linked genes do not show differences in inactivation rates. Alternatively, tissue-specific control elements may influence the extent of X inactivation independent of the timing of inactivation by altering heterochromatin formationin specific tissues or by regulating the ability to activate Smcx transcription within heterochromatin. Such a putative effect might be specific to Smcx or might relate to X inactivation generally.


Figure 4.Model for regulation of Smcx from the Xi chromosome. At the top, prior to X inactivation, all expressed genes are indicated as ON. At the time X inactivation initiates, inactivation may spread throughout the whole chromosome and shut off all genes (left). Alternatively, it is possible that some genes are always expressed from the Xi chromosome (right). The low levels of Smcx expression from the Xi might represent, therefore, either a receding (left) or spreading (right) of the Xi heterochromatin over time, which would establish a stable state of partial Xi expression. The heterochromatin-induced reduction in Xi expression may be dependent on the time of inactivation in a particular tissue or cell lineage. Alternatively (or additionally), these differences could be due to tissue-specific binding factors, that influence the extent that inactive chromatin spreads or the ability to activate transcription within a heterochromatic environment.

The Smcx data we describe are similar to that reported by Sheardown et al. using a different quantitative approach and different mouse crosses (29 ). Our data, in addition, suggest significant differences between embryonic and extraembryonic lineages. Taken together, the combined data, in conjunction with the earlier studies by Penny et al. in embryonic stem cells (7 ), indicate that Smcx shows progressive escape from X inactivation during early development; this conclusion suggests that Smcx Xi expression levels may be determined both by the age of the animal and by the timing of inactivation in different cell lineages. Thus, Smcx Xi expression may represent reactivation with age, as reported for other mouse genes (39 ,40 ), but occurring at a much earlier timepoint in a higher percentage of cells.

It will be important to determine whether the expression differences seen for Smcx are characteristic of other genes that escape inactivation, such as the recently cloned Sts gene (41 ). Such data are important for understanding the developmental consequences of X inactivation and the possible clinical or phenotypic effects of genes that escape inactivation, both in normal development and in individuals with numerical or structural abnormalities of the X chromosome.

MATERIALS AND METHODS

Mice

Females carrying the T16H translocation and CAST males were obtained from the Jackson Laboratory (Bar Harbor, ME). Additional T16H females, C57BL/6 females and F1 interspecific animals were bred in house. For timed matings plug day was counted as day 0. Yolk sac endoderm was isolated by dissociation with pancreatin/ trypsin or glycine (42 ). Embryos were separated into two parts, and all samples were snap frozen in liquid nitrogen prior to RNA and DNA isolation. Embryos in this study were analyzed at 10.5 and 12.5 d.p.c., timepoints when X inactivation is complete (27 ,28 ) as well ascell selection in T16H females (16 -18 ). One 12.5 d.p.c. embryo was the progeny of a T16H female mated to a second generation backcross [or N(2)] male derived from the backcross of a (C57BL/6 * CAST) F1 female to a C57BL/6 male. This N(2) male carries the CAST alleles of Hprt, Xist and Smcx.

Balanced T16H female embryos were distinguished from unbalanced and normal littermates by fluorescence in situ hybridization (43 ) using probes proximal (DXWas70) and distal (YAC B2-4, that includes Xist) to the T16H breakpoint, together with a chromosome count [to exclude the few animals with an unbalanced karyotype that may survive to 10.5 d.p.c. (44 )]. Alternatively, embryos were scored as females if DNA analysis showed two Hprt and Xist alleles and translocation carriers were further identified by complete non-random paternal Xist and maternal Hprt expression.

RNA purification

RNA and DNA were isolated using TRIzol (GibcoBRL) according to the manufacturer's recommendations except that RNA samples were extracted twice with TRIzol to remove residual DNA. Yolk sac endoderm samples were isopropanol precipitated overnight at -80oC in the presence of 1 [mu]g of yeast tRNA as a carrier. RNA from yolk sac endoderm samples was dissolved in 10 [mu]l H2O, and 3 [mu]l used for subsequent reverse transcription steps. For embryos or tissues, 1-5 [mu]g of RNA was used. Reverse transcription was essentially as described (45 ), except that 10 pg of oligo dT was added in addition to an equivalent concentration of random hexamers. From a final reverse transcription reaction volume of 20 [mu]l, 1 [mu]l or 1 [mu]l of a 1:10 dilution was used for subsequent PCR analysis.

PCR

Standard PCR conditions have been described (45 ) and all primers were annealed at 55oC. For Hprt, a G -> C change at nucleotide 1143 was identified in CAST (sequence from ref. 46 ). Alleles were differentiated by HinfI digestion of amplification products generated with Hprt-a: GCCTAAGATGAGCGCAAGTT and b: GTGGGAAAATACAGCCAACACT. The highly polymorphic 5' repeat region of Xist (47 ) revealed several sequence changes and a net 3 bp size difference in CAST. The entire 503 bp repeat region was amplified with primers Xist mp2: GTGTGTATGGTGGACTTACCT and mp7: ACACGCAAATTAGAGGCATAG (47 ), and the products were digested with NcoI, which recognizes a single non-polymorphic restriction site. Using the end-labeled primer Xist-mp2, the smaller 227 and 230 bp labeled products could easily be separated on 5% polyacrylamide sequencing gels. Sequence from a Smcx cDNA clone (43 ) in different mouse strains identified several polymorphisms, including a stretch of ten cytosines in the 3' UTR in M. domesticus strains that is reduced to eight cytosines in CAST. A 446 bp product was amplified with primers Smcx 1: CAAGCCTGCTTCTTAGAGGTG and 7: GGACAGCTATGTGAAGTTTCCT, and subsequently all products were digested with the non-polymorphic restriction enzyme EcoO109. Amplification with the labeled primer Smcx-1 generates labeled 182 and 180 bp fragments in the different mouse strains.

Quantitative PCR analysis

Dried acrylamide gels were exposed to phosphor screens and radioactivity was directly measured with a PhosphorImager 445 SI (Molecular Dynamics). Band intensity was determined by measuring counts for each band within a fixed area and subtracting lane background across that same area. Because the polymorphic size difference is small, Smcx alleles that are present in equimolar ratios should amplify equally. Any deviation from this 1:1 (Xp:Xm) ratio should reflect differences in the starting concentration (i.e., in cDNA samples, expression differences) of either allele. Further, since both alleles are co-amplified and compared in relation to each other, samples are internally controlled and the ratios will not be affected by possible variation in sample loading or initial concentration differences. A series of control experiments was performed to establish the number of amplification cycles within linear range of the amplification profile conditions in which the relative ratio of Smcx alleles could be reproduced consistently. For each sample tested, the Xp/Xm ratio was constant (data not shown). In subsequent experiments, 26 or 28 cycles of amplification were performed and each sample was repeated multiple times as a measure of consistency.

Single cell subclones

A polyclonal cell line was established from tail fibroblasts from a (C57BL/6 * CAST) F1 newborn female. This line was maintained in culture and then plated at very low density (no more than 5 cells/ 100 mm dish) to isolate independent single cells, which were subsequently expanded. FISH with an X chromosome probe, DXWas70, indicated that although all subcloned lines were tetraploid, each line demonstrated the presence of four X chromosomes in each cell (>20 cells counted). Exclusive expression of the C57BL/6 allele of Xist and the CAST allele of Hprt demonstrated that in each cell line shown in Figure 3 the CAST X chromosomes were active and C57BL/6 X chromosomes were inactive.

ACKNOWLEDGEMENTS

We thank C. Brown for helpful discussions and are grateful to K. Gustashaw, K. Mroz, and R. LeMaire for technical assistance. This work was supported by NIH research grants GM45441 (to HFW) and HD27393 (to PAH).

REFERENCES

1 Brown, C. J. and Willard, H. F. (1993) Molecular and genetic studies of human X chromosome inactivation. Adv. Dev. Biol., 2, 37-72.

2 Willard, H. F. (1995) Sex chromosomes and X chromosome inactivation. In C. R. Scriver, A. L. Beaudet, W. S. Sly and D. Valle (eds.), The Metabolic Basis of Inherited Disease. McGraw-Hill Publishing Co., New York, pp 719-735.

3 Brown, C. J., Ballabio, A., Rupert, J. L., Lafreniere, R. G., Grompe, M., Tonlorenzi, R. and Willard, H. F. (1991) A gene from the region of the human X inactivation centre is expressed exclusively from the inactive X chromosome. Nature, 349, 38-44. MEDLINE Abstract

4 Brown, C. J., Hendrich, B. D., Rupert, J. L., Lafreniere, R. G., Xing, Y., Lawrence, J. and Willard, H. F. (1992) The human XIST gene: analysis of a 17 kb inactive X-specific RNA that contains conserved repeats and is highly localized within the nucleus. Cell, 71, 527-542. MEDLINE Abstract

5 Kay, G. F., Penny, G. D., Patel, D., Ashworth, A., Brockdorff, N. and Rastan, S. (1993) Expression of Xist during mouse development suggests a role in the initiation of X chromosome inactivation. Cell, 72, 171-182. MEDLINE Abstract

6 Kay, G. F., Barton, S. C., Surani, M. A. and Rastan, S. (1994) Imprinting and X chromosome counting mechanisms determine Xist expression in early mouse development. Cell, 77, 639-650. MEDLINE Abstract

7 Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S. and Brockdorff, N. (1996) The Xist gene is required in cis for X chromosome inactivation. Nature, 379, 131-137. MEDLINE Abstract

8 Miller, A. P., Gustashaw, K., Wolff, D. J., Rider, S. H., Monaco, A. P., Eble, B., Schlessinger, D., Gorski, J. L., van Ommen, G. J., Weissenbach, J. and Willard, H. F. (1995) Three genes that escape X chromosome inactivation are clustered within a 6 Mb YAC contig and STS map in Xp11.21-p11.22. Hum. Mol. Genet., 4, 731-739. MEDLINE Abstract

9 Carrel, L., Clemson, C. M., Dunn, J. M., Miller, A. P., Hunt, P. A., Lawrence, J. B. and Willard, H. F. (1996) X inactivation analysis and DNA methylation studies of the ubiquitin activating enzyme E1 and PCTAIRE-1 genes in human and mouse. Hum. Mol. Genet., 5, 391-401. MEDLINE Abstract

10 Wu, J., Salido, E. C., Yen, P. H., Mohandas, T. K., Heng, H. H. Q., Tsui, L.-C., Park, J., Chapman, V. M. and Shapiro, L. J. (1994) The murine Xe169 gene escapes X-inactivation like its human homologue. Nature Genet., 7, 491-496. MEDLINE Abstract

11 Agulnik, A. I., Mitchell, M. J., Mattei, M.-G., Borsani, G., Avner, P. A., Lerner, J. L. and Bishop, C. E. (1994) A novel X gene with a widely transcribed Y-linked homologue escapes X-inactivation in mouse and human. Hum. Mol. Genet., 3, 879-884. MEDLINE Abstract

12 Agulnik, A. I., Mitchell, M. J., Lerner, J. L., Woods, D. R. and Bishop, C. E. (1994) A mouse Y chromosome gene encoded by a region essential for spermatogenesis and expression of male-specific minor histocompatibility antigens. Hum. Mol. Genet., 3, 873-878. MEDLINE Abstract

13 Wang, W., Meadows, L. R., den Haan, J. M. M., Sherman, N. E., Chen, Y., Blokland, E., Hendrickson, R. C., Bishop, C. E., Hunt, D. F., Goulmy, E. and Engelhard, V. H. (1995) Human H-Y: A male-specific histocompatibility antigen derived from the SMCY protein. Science, 269, 1588-1590. MEDLINE Abstract

14 Fisher, E. M. C., Beer-Romero, P., Brown, L. G., Ridley, A., McNeil, J. A., Lawrence, J. B., Willard, H. F., Bieber, F. R. and Page, D. C. (1990) Homologous ribosomal protein genes on the human X and Y chromosomes: escape from X inactivation and implications for Turner syndrome. Cell, 63, 1205-1218.

15 Schneider-Gadicke, A., Beer-Romero, P., Brown, L. G., Nussbaum, R. and Page, D. C. (1989) The ZFX gene on the human X chromosome escapes X inactivation and is closely related to ZFY, the putative sex determinant on the Y chromosome. Cell, 57, 1247-1258. MEDLINE Abstract

16 Takagi, N. (1980) Primary and secondary nonrandom X chromosome inactivation in early female mouse embryos carrying Searle's translocation T(X;16)16H. Chromosoma, 81, 439-459. MEDLINE Abstract

17 Disteche, C. M., Eicher, E. M. and Latt, S. A. (1981) Late replication patterns in adult and embryonic mice carrying Searle's X-autosome translocation. Exp. Cell Res., 133, 357-362. MEDLINE Abstract

18 McMahon, A. and Monk, M. (1983) X-chromosome activity in female mouse embryos heterozygous for PGK-1 and Searles translocation, T(X;16) 16H. Genet. Res., Cambridge., 41, 69-83.

19 Ashworth, A., Rastan, S., Lovell-Badge, R. and Kay, G. (1991) X-chromosome inactivation may explain the difference in viability of XO humans and mice. Nature, 351, 406-408. MEDLINE Abstract

20 Adler, D. A., Bressler, S. L., Chapman, V. M., Page, D. C. and Disteche, C. M. (1991) Inactivation of the Zfx gene on the mouse X chromosome. Proc. Natl Acad. Sci. USA, 88, 4592-4595. MEDLINE Abstract

21 Brockdorff, N., Ashworth, A., Kay, G. F., Cooper, P., Smith, S., McCabe, V. M., Norris, D. P., Penny, G. D., Patel, D. and Rastan, S. (1991) Conservation of position and exclusive expression of mouse Xist from the inactive X chromosome. Nature, 351, 329-331. MEDLINE Abstract

22 Borsani, G., Tonlorenzi, R., Simmler, M. C., Dandalo, L., Arnaud, D., Capra, V., Grompe, M., Pizzati, A., Muzay, D., Lawrence, C., Willard, H. F., Avner, P. and Ballabio, A. (1991) Characterisation of a murine gene expressed from the inactive X chromosome. Nature, 351, 325-329. MEDLINE Abstract

23 Chapman, V. M. and Shows, T. B. (1976) Somatic cell genetic evidence for X-chromosome linkage of three enzymes in the mouse. Nature, 259, 665-667. MEDLINE Abstract

24 Takagi, N. and Sasaki, M. (1975) Preferential inactivation of the paternally derived X chromosome in the extraembryonic membranes of the mouse. Nature, 256, 640-642. MEDLINE Abstract

25 Monk, M. and Harper, M. I. (1979) Sequential X chromosome inactivation coupled with cellular differentiation in early mouse embryos. Nature, 281, 311-313. MEDLINE Abstract

26 Harper, M. I., Fosten, M. and Monk, M. (1982) Preferential paternal X inactivation in extraembryonic tissues of early mouse embryos. J. Embryol. Exp. Morph., 67, 127-135. MEDLINE Abstract

27 Rastan, S. (1982) Timing of X-chromosome inactivation in postimplantation mouse embryos. J. Embryol. Exp. Morph., 71, 11-24. MEDLINE Abstract

28 Tan, S.-S., Williams, E. A. and Tam, P. P. L. (1993) X-chromosome inactivation occurs at different times in different tissues of the post-implantation mouse embryo. Nature Genet., 3, 170-174. MEDLINE Abstract

29 Sheardown, S., Norris, D., Fisher, A. and Brockdorff, N. (1996) The Smcx gene shows progressive escape from inactivation through ontogeny. Hum. Mol. Genet., 5, 1355-1360. MEDLINE Abstract

30 Cattanach, B. M., Pollard, C. E. and Perez, J. N. (1969) Controlling elements in the mouse X-chromosome 1. Interaction with the X-linked genes. Genet. Res., 14, 223-235. MEDLINE Abstract

31 Johnston, P. G. and Cattanach, B. M. (1981) Controlling elements in the mouse IV. Evidence of non-random X-inactivation. Genet. Res., 37, 151-160. MEDLINE Abstract

32 Cattanach, B. (1993) `News out of Harwell' Identification of the Mus castaneus Xce allele. Mouse Genome, 91

33 Kratzer, P. G., Chapman, V. M., Lambert, H., Evans, R. E. and Liskay, R. M. (1983) Differences in the DNA of the inactive X chromosomes of fetal and extraembryonic tissues of mice. Cell, 33, 37-42. MEDLINE Abstract

34 Krumlauf, R., Chapman, V. M., Hammer, R. E., Brinster, R. L. and Tilghman, S. M. (1986) Differential expression of [alpha]-fetoprotein genes on the inactive X chromosome in extraembryonic and somatic tissues of a transgenic mouse line. Nature, 319, 224-226. MEDLINE Abstract

35 Samollow, P. B., Robinson, E. S., Ford, A. L. and Vandenberg, J. L. (1995) Developmental progression of Gpd expression from the inactive X chromosome of the Virginia opossum. Dev. Genet., 16, 367-378. MEDLINE Abstract

36 Cooper, D. W., Johnston, P. G., Watson, J. M. and Graves, J. A. M. (1993) X-inactivation in marsupials and monotremes. Sem. Dev. Biol., 4, 117-128.

37 Walters, M. C., Fiering, S., Eidemiller, J., Magis, W., Groudine, M. and Martin, D. I. K. (1995) Enhancers increase the probability but not the level of gene expression. Proc. Natl Acad. Sci. USA, 92, 7125-7129. MEDLINE Abstract

38 LeBon, J. M., Tam, P. P. L., Singer-Sam, J., Riggs, A. D. and Tan, S. S. (1995) Mouse endogenous X-linked genes do not show lineage-specific delayed inactivation during development. Genet. Res., 65, 223-227. MEDLINE Abstract

39 Wareham, K. A., Lyon, M. F., Glenister, P. H. and Williams, E. D. (1987) Age related reactivation of an X-linked gene. Nature, 327, 725-727. MEDLINE Abstract

40 Brown, S. and Rastan, S. (1988) Age-related reactivation of an X-linked gene close to the inactivation centre in the mouse. Genet. Res., 52, 151-154. MEDLINE Abstract

41 Salido, E. C., Li, X. M., Yen, P. H., Martin, N., Mohandas, T. K. and Shapiro, L. J. (1996) Cloning and expression of the mouse pseudoautosomal steroid sulphatase gene (Sts). Nature Genet., 13, 83-86. MEDLINE Abstract

42 Hogan, B., Costantini, F. and Lacy, E. (1986) Manipulating the mouse embryo. Cold Spring Harbor Laboratory.

43 Sultana, R., Adler, D. A., Edelhoff, S., Carrel, L., Lee, K., Chapman, V. C., Willard, H. F. and Disteche, C. M. (1995) The mouse Sb1.8 gene located at the distal end of the X chromosome is subject to X inactivation. Hum. Mol. Genet., 4, 257-263. MEDLINE Abstract

44 Takagi, N. and Abe, K. (1990) Detrimental effects of two active X chromosomes on early mouse development. Development, 109, 189-201. MEDLINE Abstract

45 Brown, C. J., Flenniken, A. M., Williams, B. R. G. and Willard, H. F. (1990) X chromosome inactivation of the human TIMP gene. Nucleic Acids Res., 18, 4191-4195. MEDLINE Abstract

46 Melton, D. W., Konecki, D. S., Brennand, J. and Caskey, C. T. (1984) Structure, expression and mutation of the hypoxanthine phosphoribosyltransferase gene. Proc. Natl Acad. Sci. USA, 81, 2147-2151. MEDLINE Abstract

47 Hendrich, B., Brown, C. and Willard, H. (1993) Evolutionary conservation of possible functional domains of the human and murine XIST genes. Hum. Mol. Genet., 2, 663-672. MEDLINE Abstract

48 Buzin, C. H., Mann, J. R. and Singer-Sam, J. (1994) Quantitative RT-PCR assays show Xist RNA levels are low in mouse female adult tissue, embryos, and embryoid bodies. Development, 120, 3529-3536. MEDLINE Abstract


*To whom correspondence should be addressed


This page is maintained by OUP admin. Last updated Thu Oct 31 15:27:05 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Li and L. Carrel
Escape from X chromosome inactivation is an intrinsic property of the Jarid1c locus
PNAS, November 4, 2008; 105(44): 17055 - 17060.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
B.-G. Jeon, G. Coppola, S. D Perrault, G.-J. Rho, D. H Betts, and W A. King
S-adenosylhomocysteine treatment of adult female fibroblasts alters X-chromosome inactivation and improves in vitro embryo development after somatic cell nuclear transfer
Reproduction, June 1, 2008; 135(6): 815 - 828.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
P. J. Wang, D. C. Page, and J. R. McCarrey
Differential expression of sex-linked and autosomal germ-cell-specific genes during spermatogenesis in the mouse
Hum. Mol. Genet., October 1, 2005; 14(19): 2911 - 2918.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
S. P. Cordes
N-Ethyl-N-Nitrosourea Mutagenesis: Boarding the Mouse Mutant Express
Microbiol. Mol. Biol. Rev., September 1, 2005; 69(3): 426 - 439.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Gomez and N. Brockdorff
Heterochromatin on the inactive X chromosome delays replication timing without affecting origin usage
PNAS, May 4, 2004; 101(18): 6923 - 6928.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
I. Chowers, D. Liu, R. H. Farkas, T. L. Gunatilaka, A. S. Hackam, S. L. Bernstein, P. A. Campochiaro, G. Parmigiani, and D. J. Zack
Gene expression variation in the adult human retina
Hum. Mol. Genet., November 15, 2003; 12(22): 2881 - 2893.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Carrel and H. F. Willard
Heterogeneous gene expression from the inactive X chromosome: An X-linked gene that escapes X inactivation in some human cell lines but is inactivated in others
PNAS, June 22, 1999; 96(13): 7364 - 7369.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. P. Miller and H. F. Willard
Chromosomal basis of X chromosome inactivation: Identification of a multigene domain in Xp11.21-p11.22 that escapes X inactivation
PNAS, July 21, 1998; 95(15): 8709 - 8714.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (36)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Carrel, L.
Right arrow Articles by Willard, H. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carrel, L.
Right arrow Articles by Willard, H. F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?