Reciprocal effect of Waardenburg syndrome mutations on DNA binding by the Pax-3 paired domain and homeodomain
Reciprocal effect of Waardenburg syndrome mutations on DNA binding by the Pax-3 paired domain and homeodomain Anouk S. Fortin, D. Alan Underhill and Philippe Gros*
Department of Biochemistry, McGill University, Montreal, Quebec, Canada, H3G 1Y6
Received April 30, 1997;Revised and Accepted July 14, 1997
The Pax-3 protein contains two DNA-binding domains, a paired domain and a homeodomain. Mutations in Pax-3 cause Waardenburg syndrome (WS) in humans and the mouse Splotch (Sp) phenotype. In the Sp-delayed mouse, a mutation in the Pax-3 paired domain (G9R) abrogates the DNA-binding activity of both the paired domain and the homeodomain, suggesting that they may functionally interact. To investigate this possibility further, we have analyzed the DNA-binding properties of additional point mutants in the Pax-3 paired domain and homeodomain that occur in WS patients (F12L, N14H, G15S, P17L, R23L, G48A, S51F and G66D in the paired domain, V47F and R53G in the homeodomain), the Pax-1un mutation (G15A) and a substitution associated with Peters' anomaly in the PAX-6 gene (R23G). Within the paired domain, seven of 10 mutations were found to abrogate DNA-binding by the paired domain. Remarkably, these seven mutations also affected DNA binding by the homeodomain, causing either a complete loss (P17L and G66D), a reduction (R23G, R23L, G15S and G15A) or an increase in DNA-binding activity (N14H). In addition, the effect of paired domain mutations occurred at the level of monomer formation by the homeodomain, while the dimerization potential of this domain seemed unaffected in mutants where it could be analyzed. Furthermore, while both homeodomain mutations were found to abolish DNA binding by this domain, the R53G mutation also abrogated DNA binding by the paired domain. The important observation that independent mutations in either domain can affect DNA binding by the other in the intact Pax-3 protein strongly suggests that the two domains are not functionally independent but bind DNA through cooperative interactions. Modeling the deleterious mutations on the three-dimensional structure of the paired domain of Drosophila Prd shows that these mutations cluster at the DNA interface, thus suggesting that a series of DNA contacts are essential for DNA binding by both the paired domain and the homeodomain of Pax-3.
Pax-3 is a member of the mammalian Pax gene family (1 ), a group of nine transcription factors that are structurally defined by the presence of a highly conserved 128 amino acid DNA-binding domain, known as the paired domain and initially identified in the paired segmentation gene of Drosophila (2 ). In addition to the paired domain, certain members of the Pax family, including Pax-3, 4, 6 and 7, harbor a second DNA-binding domain, the paired-type homeodomain (1 ,3). For the most part, Pax genes are expressed in distinct spatial and temporal patterns during embryogenesis, in particular within the developing nervous system (1 ). Over the past several years, the importance of Pax genes in regulating development has been established with the analysis of several mutations in both mice and humans (4 ). In the mouse mutant undulated (un), a point mutation in the Pax-1 gene is responsible for the abnormal development of the vertebral column and sternum (5 ). The human PAX-6 gene is mutated in aniridia (6 -8 )and the mouse Pax-6 gene is allelic with the Small-eye mutant (9 ), with both displaying ocular disturbances and other brain and nasal abnormalities. Mutations in the Caenorhabditis elegansPAX-6 homologs vab-3 and mab-18 result in many defects in head-region and ray (simple sense organs) development respectively (10 -11 ). PAX-2 heterozygous mutations result in eye and kidney abnormalities and sometimes hearing deficits. Homozygous Pax-2 knockout mice have renal agenesis as well as ocular and brain abnormalities (12 ). In the case of Pax-3, loss-of-function mutations cause the Splotch (Sp) phenotype in mice (13 -15 ) and Waardenburg syndrome (WS) in humans (16 ), both of which are semi-dominant mutations expressed as pigmentary disturbances in the heterozygous state. In addition, WS characteristics include dystopia canthorum and sensorineuronal deafness (17 ). Homozygous Sp embryos die in utero and display profound defects in neurogenesis, dysgenesis of neural crest cell-derived structures as well as the absence of certain tissues derived from somitic mesoderm (18 -21 ).
The high resolution three-dimensional structure of the paired domain-DNA complex has been elucidated for the paired (Prd) protein of Drosophila (22 ). The paired domain is structurally divided into two subdomains, each containing three [alpha]-helices that form a classical helix-turn-helix (HTH) motif. In addition, the N-terminal subdomain contains a [beta]-hairpin motif and a type II [beta]-turn that, together with the HTH motif, make important contributions to DNA binding. Although all naturally occurring mammalian point mutations mapping to the paired domain are located within this N-terminal subdomain, recent studies of alternatively spliced isoforms of Pax-6 and Pax-3 suggest that the C-terminal subdomain also contributes to the DNA-binding specificity of the paired domain (23 ,24 ). The paired domain has been shown to bind DNA on its own and target oligonucleotides that are recognized preferentially by the N-terminal subdomain or by both the N- and C-terminal subdomains have been identified (22 ,24 ,25 ). Like the paired domain, the paired-type homeodomain comprises three [alpha]-helices, the last two forming an HTH motif in which helix 3 makes extensive DNA contacts. Despite this similarity, the paired-type homeodomain has distinct sequence preferences and shows a unique ability to dimerize cooperatively on target sequences containing the palindromic TAAT-(N)2/3-ATTA motif (26 ).
The goal of this study was to gain further insight into the structural and functional relationships within the Pax-3 protein. In particular, we wished to investigate possible functional interactions between the two DNA-binding domains of the protein, so we set out to determine to what extent alterations in the paired domain may affect homeodomain DNA binding and, conversely, if mutations in the homeodomain could alter paired domain function. To accomplish this, we investigated the DNA-binding properties of mutant alleles of human PAX-3 found in patients with WS type I (WSI) (16 ) that map within the paired domain (F12L, N14H, G15A, P17L, R23L, G48A, S51F and G66D) or homeodomain (V47F and R53G). In addition, the naturally occurring G15S mutation in the Pax-1 gene of the undulated (un) mouse mutant (32 ) and the R23G mutation found in the human PAX-6 gene associated with Peters' anomaly (8 ) were also studied in the context of the Pax-3 polypeptide.
The position of the mutations within the Pax-3 paired domain is shown in Figure 1 A with respect to the secondary structural elements derived from the crystal structure of Drosophila Prd (22 ). This portion of the paired domain is comprised of three components: a [beta]-hairpin motif made up of two [beta]-strands, a type II [beta]-turn, and a helical domain that contains a classical HTH motif (Fig. 1 A). Each of these structures makes extensive phosphate contacts along the paired domain recognition sequence (summarized in Fig. 1 A). In addition, both the type II [beta]-turn and the C-terminal tail of the N-terminal subdomain make specific contacts in the minor groove, while helix 3 engages the DNA in the major groove (summarized in Fig. 1 A). Importantly, the mutations analyzed in this study are expected to affect all of these structural features. The F12L mutation is located in the second [beta]-strand of the [beta]-hairpin motif, while N14H, G15A, G15S and P17L all affect the type II [beta]-turn (Fig. 1 A). Four mutations map to the helical domain and involve the R23G and R23L substitutions in helix 1, and the G48A and S51F substitutions in helix 3 (Fig. 1 A). Lastly, the G66D mutation is located within the carboxy-terminal tail of the N-terminal subdomain (Fig. 1 A).
The wild-type and mutated Pax-3 variants were expressed by transient transfection in COS-7 cells, and whole cell extracts were prepared from transfectants and analyzed by immunoblotting for the presence of Pax-3 using a polyclonal anti-Pax-3 antibody (28 ). As shown in Figure 1 B, a single polypeptide of the expected Mr (56 kDa) was detected by the antibody in each whole cell extract. In addition, it is clear that the recombinant Pax-3 proteins were expressed at similar levels. As a result, equal amounts of recombinant Pax-3 could be used in our initial analysis of paired domain and homeodomain DNA-binding properties.
The homeodomain found in Drosophila Prd and the mammalian Pax proteins defines a distinct sub-class which includes the Phox1 and S8 proteins (37 ). Crystal structures solved for the homeodomains of the Drosophila engrailed (38 ) and Prd (39 ) proteins reveal a common tertiary structure that is composed of three [alpha]-helices, the last two of which form an HTH motif. The most conserved segment of the 300 homeodomains known to date is helix 3, which makes extensive DNA contacts in the major groove and is important for sequence specificity of individual homeodomain (40 ). The remaining DNA contacts are made by a flexible N-terminal arm that contacts the DNA-phosphate backbone and minor groove (39 ). Notably, the two known WSI mutations in the homeodomain are located in helix 3 at positions 47 [NIH3 (V47F); 41 ] and 53 [NIH8 (R53G); 41 ] (Fig. 4 A). Their relative orientation with respect to each other and to the DNA is summarized in Figure 4 B. Both residues are situated within the DNA major groove and make several phosphate and base-specific contacts that are important for docking of the homeodomain on DNA.
Pax-3 is a member of the Pax family of transcription factors (1 ) which is structurally defined by the presence of a 128 amino acid residue DNA-binding domain, the paired domain (2 ). Pax-3 also contains a DNA-binding homeodomain, and transcription activation and repression domains (35 ). Although the functional consequence of having two DNA-binding domains with distinct sequence specificity in Pax-3 and other Pax proteins is becoming clearer, it remains to be determined whether each domain retains its individual sequence specificity in the intact protein, or if cooperative interactions between the two domains define novel substrate specificities. The essential role of the paired domain and homeodomain for Pax-3 function has been established by the identification of mutations in these segments in human WSI patients and in the mouse neural tube defect mutant Splotch (13 -15 ). Indeed, the similarity in phenotypic expression of independent point mutations or deletions in either the paired domain or homeodomain of Pax-3 in unrelated WSI patients and in distinct Splotch alleles indicates that these mutations cause a complete loss of function. However, the molecular basis of the apparent loss of function in WSI alleles of Pax-3 has not been studied systematically. In the present study, we have introduced in Pax-3 a series of paired and homeodomain WSI mutations as well as other naturally occurring mutations in PAX-6 (8 ) and Pax-1 (32 ), and have tested the functional consequence of these mutations on the DNA-binding properties of the paired domain and homeodomain of Pax-3.
The paired domain and homeodomain bind DNA with high affinity and specificity when expressed separately, and this has allowed the determination of their respective crystal structures complexed to cognate binding sequences (22 ,39 ). Although the paired domain comprises two globular subdomains, N-terminal and C-terminal, all WSI mutations affecting the paired domain are located in the N-terminal subdomain. This subdomain is made up of a [beta]-hairpin structure that clamps the phosphate backbone, a type II [beta]-turn that sits in the DNA minor groove, an HTH motif that lies in the major groove and a C-terminal tail that makes additional contacts in the minor groove. In the present study, the F12L, G48A and S51F mutations had no obvious effect on DNA binding, despite being located at the protein-DNA interface. The F12L mutation occurs in the [beta]-hairpin structure and may disrupt a hydrophobic contact. However, this substitution is not predicted to affect the local secondary structure and suggests that the conservation of this structure may be more important than the DNA contact made by Phe12. This notion is consistent with a second mutation within the [beta]-hairpin (Q7A) that preserves the local secondary structure and DNA-binding activity of the paired domain, despite the loss of a phosphate contact (42 ). Although the G48A mutation has been proposed to cause a disruption of Van der Waal's contacts and possibly affect docking of the HTH motif (22 ), its wild-type DNA-binding activity would suggest either that substitution with alanine does not affect these interactions or that they are not essential for paired domain DNA binding. This also appears to be the case with the S51F mutation which occurs adjacent to G48A in the HTH motif and indicates that the hydrophobic contact made by Ser51 may not be required for DNA binding. This raises the question as to what is responsible for the appearance of WS in these patients? First, a possible DNA-binding defect may be present in these mutants but may have gone undetected in our assay either because it is very subtle or our target oligos do not represent sequences normally bound by Pax-3 in vivo and may not be recognized by the mutants. Relevant to this argument, the S51F mutation was identified initially in a rare WS patient homozygous for the mutation (43 ), suggesting only a partial loss of function in this allele. In addition, the mutations may confer novel sequence specificities, a situation that has been described previously for the un mutationin Pax-1 (32 ). These mutations may also affect homotypic or heterotypic interactions of Pax-3 with other proteins that may be important for proper target site selection by Pax-3 or for assembly of a functional transcriptional complex. It should also be noted that the penetrance of both WS and Sp mutations is affected by modifier loci and that these could act to increase the severity of the F12L, G48A and S51F mutations in these WS patients (44 ).
Our study of paired domain mutations revealed that a large proportion (7/10) caused a complete loss of DNA binding by the paired domain and provides a molecular basis for the loss-of-function phenotype observed in these WSI and Peter's anomaly patients. Four of these mutations, N14H, G15A, G15S and P17L, affect conserved residues in the type II [beta]-turn that lies in the DNA minor groove and clearly underline the importance of this structure in paired domain DNA binding. At position 15, glycine is the only residue that would allow the [beta]-turn to approach the minor groove, and substitutions here would most likely affect other contacts made by the [beta]-turn (22 ); our analysis is therefore consistent with the loss of paired domain DNA binding attributed to this mutation in the Pax-1 protein (32 ). Likewise, substitution of Asn14 and Pro17 would affect hydrogen bonding and interactions with the DNA backbone that are necessary to place the [beta]-turn in the minor groove, and this would account for their effect on DNA binding. Immediately following the [beta]-turn, helix 1 Arg23 makes a phosphate contact that helps anchor the HTH motif and may contribute to stabilizing the [beta]-turn in the minor groove. Given that this residue also participates in hydrogen bonding with residues in the C-terminal tail of the N-terminal subdomain, it is understandable why the presence of leucine or alanine at this position would abrogate DNA binding by the paired domain. Parallel studies of the PAX-6 protein indicate that a mutation at this glycine residue (R26G) severely diminishes DNA binding to certain paired domain target sites such as CD19-2A (45 ). Lastly, Gly66 is located in the C-terminal tail and interacts with the DNA backbone in a region that is adjacent to that contacted by the [beta]-hairpin and the [beta]-turn. The substitution by aspartate would most likely lead to electrostatic repulsion that reduces DNA binding of the N-terminal subdomain. Therefore, this analysis emphasizes the critical role of multiple paired domain structural elements in stabilizing the interaction of the paired domain with its DNA target.
Like the paired domain, the homeodomain also comprises three [alpha]-helices that contribute to an HTH motif (38 ,39 ), and binding of the homeodomain to DNA is mediated principally by helix 3, which sits in the major groove, and by a flexible N-terminal arm that makes phosphate and minor groove contacts (Fig. 4 A). The loss of homeodomain DNA binding activity attributed to the V47F and R53G WSI mutations indicates the requirement for this domain for Pax-3 function and is consistent with the fact that both mutations affect residues within helix 3 that participate directly in docking of the homeodomain on DNA. The arginine at position 53 represents one of the most highly conserved residues in the homeodomain superfamily, playing a general role in homeodomain DNA binding through the establishment of two phosphate contacts (Fig. 4 B; 39 ,40 ). In addition to disrupting these contacts, the glycine substitution may also destabilize the [alpha]-helix and could, therefore, affect DNA contacts made by other residues within helix 3. In contrast, position 47 is more variable and is involved in conferring sequence specificity to a given homeodomain (40 ). Homeodomains of the paired-class contain a valine at this position, and this residue makes a hydrophobic contact with the core TAAT motif in the homeodomain crystal structure of Drosophila paired (Fig. 4 B, 39 ). Our analysis would therefore indicate that this contact is essential to DNA binding by the Pax-3 homeodomain.
A construct containing a portion of the Pax-3 cDNA (positions 297-1801) in the eukaryotic expression vector pMT2 has been described previously (28 ). The pMT2Pax-3 construct encodes the full-length, 479 amino acid Pax-3 polypeptide. For mutagenesis, a 1.3 kb PstI Pax-3 restriction fragment that encodes the paired domain and the homeodomain was excised from pMT2Pax-3 and inserted into the corresponding site of the filamentous phage plasmid vector M13mp19 to make M13mp19Pax-3. The PstI restriction fragment is derived from a pMT2-based PstI site located 5' of the Pax-3 AUG and a second site within the Pax-3 cDNA at position 1581. Single-stranded DNA was prepared from M13mp19Pax-3 after infection of Escherichia coli TG-1 cells and was used as a template for site-directed mutagenesis using a commercially available kit (Amersham, Arlington Heights, IL). Several independent mutations were introduced in the Pax-3 cDNA using the mutagenic oligonucleotides shown in Table 1 .
The presence of the desired mutation and the integrity of the mutagenized Pax-3 cDNA cassette were verified by dideoxy nucleotide sequencing (51 ). Subsequently, Pax-3 cDNA segments containing mutations in the paired domain were excised from M13mp19Pax-3 as a SmaI fragment (Pax-3; pst 342-672), while fragments containing homeodomain mutations were released with KpnI (Pax-3, pst 563-1500) and then inserted into the homologous sites of the pMT2Pax-3 expression construct.
Pax-3 was expressed in COS-7 cells by transient transfection. Briefly, 106 COS-7 cells were grown in Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum and transfected by CaPO4 co-precipitation using 15 [mu]g of supercoiled plasmid DNA prepared by CsCl density centrifugation. Transfections proceeded for 5 h, at which time the cells were treated for 1 min with HBS (0.14 M NaCl, 5 mM KCl, 0.75 mM Na2HPO4.2H2O, 6 mM dextrose, 25 mM HEPES, pH 7.05) containing 15% glycerol before placing in complete DMEM. Whole cell extracts were prepared 24 h later by sonication in a buffer containing 20 mM HEPES (pH 7.6), 0.15 M NaCl, 0.5 mM dithiothreitol (DTT), 0.2 mM EDTA, 0.2 mM EGTA and protease inhibitors [aprotinin, pepstatin, phenylmethylsulfonyl fluoride (PMSF) and leupeptin at 1[mu]g/ml) and stored frozen at -80oC until use. The level of Pax-3 protein expression in these whole cell extracts was monitored by immunoblotting using a rabbit anti-Pax-3 polyclonal antiserum (28 ) at a 1:5000 dilution and was visualized by enhanced chemiluminescence using an anti-rabbit antibody coupled to horseradish peroxidase (Amersham). Autoradiograms were scanned for quantitation, and the level of Pax-3 expression was normalized for subsequent DNA-binding studies. Mock transfections refers to cells exposed to transfection buffer devoid of DNA.
The DNA-binding properties of wild-type and mutant Pax-3 were analyzed by EMSA, according to a protocol we have previously described (28 ).The DNA-binding properties of the paired domain and the homeodomain were analyzed using the oligonucleotides listed in Table 2 .
Oligonucleotides used to analyze the DNA-binding properties of the paired domain and the homeodomain
Probe
Sequence (5'-3')
Reference
Nf3'
CTAGTGTGTGTCACGTTATTTTCCTGTACTTATTGCTAG
(33)
H2A2.1
CAACTATTTCTTCAAGCGTGTCAACAAA
(25)
P2
GATCCTGAGTCTAATTGATTACTGTACAGG
(26)
P1/2
GATCCTGAGTCTAATTGAGCGTCTGTAC
(26)
Double-stranded oligonucleotides with 3' recessed ends were end labeled with [[alpha]-32P]dATP (3000 Ci/mmol, New England Nuclear) using the Klenow fragment of DNA polymerase I. Whole cell extracts were added to 5 fmol of radiolabeled oligonucleotide in a 20 [mu]l volume containing 10 mM Tris (pH 7.5), 50 mM NaCl, 1 mM DTT, 2 mM MgCl2, 1 mM EDTA and 5% glycerol. To prevent non-specific binding, 1 [mu]g of poly(dI-dC)[middot]poly(dI-dC) was included when using the Nf3' and H2A2.1 oligonucleotides, while 2 [mu]g of salmon sperm DNA was added when the P2 and P1/2 oligonucleotides were used. After a 30 min incubation at 20oC, samples were electrophoresed at 12 V/cm in 5% acrylamide:bis-acrylamide (29:1) gels containing 0.5* TBE (1* TBE is 0.18 M Tris-HCl, 0.18 M boric acid, 4 mM EDTA, pH 8.3). Gels were dried and exposed to a phosphor imaging plate for quantitation with a Fuji BAS 2000 phosphorimaging station and then to Kodak XAR film.
We would like to thank Kyle Vogan for helpful discussion and critical reading of the manuscript. This work was supported by a grant to P.G. from the Medical Research Council of Canada. A.S.F. is a Medical Research Council predoctoral fellow. P.G. is a recipient of a scientist award from the Medical Research Council of Canada.
1 Stuart, E.T., Kioussi, C. and Gruss, P. (1994) Mammalian Pax genes. Annu. Rev. Genet.,28,219-236.MEDLINE Abstract
2 Bopp, D., Burri, M., Baumgartner, S., Frigerio, G. and Noll, M. (1986) Conservation of a large protein domain in the segmentation gene paired and in functionally related genes of Drosophila. Cell,47,1033-1040.MEDLINE Abstract
3 Noll, M. (1993) Evolution and role of Pax genes. Curr. Opin .Genet. Dev.3, 595-605.Mansouri, A., Hallonet, M. and Gruss, P. (1996) Pax genes and their roles in cell differentiation and development. Curr. Opin. Cell Biol.,8, 851-857.
4 Balling, R., Deutsch, U. and Gruss, P. (1988) undulated, a mutation affecting the development of the mouse skeleton, has a point mutation in the paired box of Pax-1. Cell, 55, 531-535.MEDLINE Abstract
5 Glaser, T., Walton, D.S. and Maas, R.L. (1992) Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nature Genet., 2, 232-239.MEDLINE Abstract
6 Jordan, T., Hanson, I., Zaletayev, D., Hodgson, S., Prosser, J., Seawright, A.,Hastie, N. and van Heyningen, V. (1992) The human PAX6 gene is mutated in two patients with aniridia. Nature Genet., 1, 328-332.MEDLINE Abstract
7 Hanson, I.M., Fletcher, J.M., Jordan, T., Brown, A., Taylor, D., Adams, R.J., Punnett, H.H. and van Heyningen, V. (1994) Mutations at the PAX6 locus are found in heterogeneous anterior segment malformations including Peters' anomaly. Nature Genet., 6,168-173.MEDLINE Abstract
8 Hill, R.E., Favor, J., Hogan, B.L., Ton, C.C., Saunders, G.F., Hanson , I.M., Prosser, J., Jordan, T., Hastie, N.D. and van Heyningen, V. (1991) Mouse Small eye results from mutations in a paired-like homeobox-containing gene. Nature,354,522-525.MEDLINE Abstract
9 Chisholm, A.D. and Horuitz, H.R. (1995) Paterning of Caenorhabditis elegans head region by the Pax-6 family member vab-3. Nature, 377, 52-55.MEDLINE Abstract
11 Zhang, Y. and Emmons, S.W. (1995) Specification of the sense-organ identity by a Caenorhabditis elegans Pax-6 homologue. Nature, 377, 55-59.MEDLINE Abstract
12 Torres, M., Gomez-Pardo, E., Dressler, G.R. and Gruss, P. (1995) Pax-2 controls multiple steps of urogenital development. Development, 121, 4057-4065.MEDLINE Abstract
13 Epstein, D.J., Vekemans, M. and Gros, P. (1991) Splotch (Sp2H), a mutation affecting development of the mouse neural tube, shows a deletion within the paired homeodomain of Pax-3. Cell, 67,767-774.MEDLINE Abstract
14 Epstein, D.J.,Vogan, K.J.,Trasler, D.G. and Gros, P. (1993) A mutation within intron 3 of the Pax-3 gene produces aberrantly spliced mRNA transcripts in the splotch (Sp) mouse mutant. Proc. Natl Acad. Sci. USA, 90,532-536.MEDLINE Abstract
15 Vogan, K.J., Epstein, D.J., Trasler, D.G. and Gros, P. (1993) The splotch-delayed (Spd) mouse mutant carries a point mutation within the paired box of the Pax-3 gene. Genomics,17, 364-369.MEDLINE Abstract
16 Baldwin, C. T., Hoth, C. F., Macina, R. A. and Milunsky, A. (1995) Mutations in PAX3 that cause Waardenburg syndrome type I: ten new mutations and review of the literature. Am. J. Med. Genet., 58, 115-122.
17 Waardenburg, P.J. (1951) A new syndrome combining developmental anomalities of the eyelids, eyebrows and nose root with pigmentary defects of the iris and head hair with congenital deafness. Am. J. Hum. Genet., 3, 195-253.
18 Auerbach R. (1954) Analysis of the developmental effects of a lethal mutation in the house mouse. J. Exp. Zool., 127,305-329.
19 Beechey, C.V. and Searle, A.G. (1986) Mutations at the Sp locus. Mouse News Lett., 75, 28.
20 Franz T. (1990) Defective ensheathment of motoric nerves in the Splotch mutant mouse. Acta. Anat., 138,246-253.
21 Bober, E., Franz, T., Arnold, H.H., Gruss, P. and Tremblay, P. (1994) Pax-3 is required for the development of limb muscles: a possible role for the migration of dermomyotomal muscle progenitor cells. Development,120,603-612.MEDLINE Abstract
22 Xu, W., Rould, M.A., Jun, S., Desplan, C. and Pabo, C.O. (1995) Crystal structure of a paired domain-DNA complex at 2.5 Å resolution reveals structural basis for Pax developmental mutations. Cell, 80, 639-650.MEDLINE Abstract
23 Epstein, J.A., Glaser, T., Cai, J., Jepeal, L., Walton, D.S. and Maas, R.L. (1994) Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing. Genes Dev., 8, 2022-2034.MEDLINE Abstract
24 Vogan, K.J., Underhill, D.A. and Gros, P. (1996) An alternative splicing event in the Pax-3 paired domain identifies the linker region as a key determinant of paired domain DNA-binding activity. Mol. Cell. Biol., 16, 6677-6686.MEDLINE Abstract
25 Czerny, T., Schaffner, G. and Busslinger, M. (1993) DNA sequence recognition by Pax proteins: bipartite structure of the paired domain and its binding site. Genes Dev., 7, 2048-2061MEDLINE Abstract
26 Wilson, D., Sheng, G., Lecuit, T., Dostatni, N. and Desplan, C. (1993) Cooperative dimerization of paired class homeo domains on DNA. Genes Dev., 7, 2120-2134.MEDLINE Abstract
27 Schafer, B.W., Czerny, T., Bernasconi, M., Genini, M. and Busslinger, M. (1994) Molecular cloning and characterization of a human PAX-7 cDNA expressed in normal and neoplastic myocytes. Nucleic Acids Res., 22,4574-4582.MEDLINE Abstract
28 Underhill, D.A., Vogan, K.J. and Gros,P. (1995) Analysis of the mouse Splotch-delayed mutation indicates that the Pax-3 paired domain can influence homeodomain DNA-binding activity. Proc. Natl Acad. Sci. USA, 92, 3692-3696.MEDLINE Abstract
29 Miskiewicz, P., Morrissey, D., Lan, Y., Raj, L., Kessler, S., Fujioka, M., Goto, T. and Weir, M. (1996) Both the paired domain and homeodomain are required for in vivo function of Drosophila Paired. Development,122, 2709-2718.MEDLINE Abstract
30 Bertuccioli, C., Fasano, L., Jun, S., Wang, S., Sheng, G. and Desplan, C. (1996) In vivo requirement for the paired domain and homeodomain of the paired segmentation gene product. Development, 122, 2673-2685.MEDLINE Abstract
31 Jun, S. and Desplan, C. (1996) Cooperative interactions between paired domain and homeodomain. Development,122, 2639-2650.MEDLINE Abstract
32 Chalepakis, G., Fritsch, R., Fickenscher, H., Deutsch, U., Goulding, M. and Gruss, P. (1991) The molecular basis of the undulated/Pax-1 mutation. Cell, 66, 873-884.MEDLINE Abstract
33 Epstein, J.A., Lam, P., Japeal, L., Maas, R.L. and Shapiro, D.N. (1995) Pax3 inhibits myogenic differentiation of cultured myoblast cells. J. Biol. Chem., 270, 11719-11722.MEDLINE Abstract
34 Epstein, J.A., Glaser, T., Cai, T., Jepeal,L., Walton, D.S. and Maas, R.L. (1994) Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing. Genes Dev., 17,2022-2034.
35 Chalepakis, G., Jones, F.S., Edelman, G.M. and Gruss, P. (1994) Pax-3 contains domains for transcription activation and transcription inhibition. Proc. Natl Acad. Sci. USA, 91,12745-12749.MEDLINE Abstract
36 Treisman, J., Harris, E. and Desplan, C. (1991) The paired box encodes a second DNA-binding domain in the paired homeo domain protein. Genes Dev., 5,594-604.MEDLINE Abstract
37 Kappen, C., Schughart, K. and Ruddle, F.H. (1993) Early evolutionary origin of major homeodomain sequence classes. Genomics, 18,54-70.MEDLINE Abstract
38 Kissinger, C.R., Liu, B.S., Martin-Blanco, E., Kornberg, T.B. and Pabo, C.O. (1990) Crystal structure of an engrailed homeodomain-DNA complex at 2.8 Å resolution: a framework for understanding homeodomain-DNA interactions. Cell, 63,579-590.MEDLINE Abstract
39 Wilson, D.S., Guenther, B., Desplan, C.and Kuriyan, J. (1995) High resolution crystal structure of a paired (Pax) class cooperative homeodomain dimer on DNA. Cell,82, 709-719.MEDLINE Abstract
40 Gehring, W.J., Qian, Y.Q., Billeter, M., Furukubo-Tokunaga, K., Schier, A.F., Resendez-Perez, D., Affolter, M., Otting, G. and Wuthrich, K. (1994) Homeodomain-DNA recognition. Cell, 78, 211-223.MEDLINE Abstract
41 Lalwani, A.K., Brister, J.R., Fex, J., Grundfast, K.M., Ploplis, B., San Agustin, T.B. and Wilcox, E.R. (1995) Further elucidation of the genomic structure of PAX3 and identification of two different point mutations within the PAX3 homeobox that cause Waardenburg syndrome type 1 in two families. Am. J. Hum. Genet., 56,75-83. MEDLINE Abstract
42 Underhill, D.A. and Gros, P. (1997) The paired domain regulates DNA-binding by the homeodomain within the intact Pax-3 protein. J. Biol. Chem., 272, 14775-14782.
43 Zlotogora, J., Lerer, I., Bar-David, S., Ergaz, Z. and Abeliovich, D. (1995) Homozygosity for Waardenburg syndrome. Am. J. Hum. Genet., 56,1173-1178.MEDLINE Abstract
44 Asher, J.H., Jr, Harrison, R.W., Morell, R., Carey, M.L. and Freidman, T.B. (1996) Effects of Pax3 modifier genes on craniofacial morphology, pigmentation and viability: a murine model of Waardenburg syndrome variation. Genomics, 34, 285-298.MEDLINE Abstract
45 Tang, H.K., Chao, L.-Y. and Saunders, G.F. (1997) Functional analysis of paired box missense mutation in the PAX-6 gene. Hum. Mol. Genet., 6, 381-386.MEDLINE Abstract
46 Hoth, C.F., Milunsky, A., Lipsky, N., Sheffer, R., Clarren, S.K. and Baldwin, C.T. (1993) Mutations in the paired domain of the human PAX3 gene cause Klein-Waardenburg syndrome (WS-III) as well as Waardenburg syndrome type I (WS-I). Am. J. Hum. Genet., 52,455-462.MEDLINE Abstract
47 Tassabehji, M., Read, A.P., Newton, V.E., Patton, M., Gruss, P., Harris, R. and Strachan, T. (1993) Mutations in the PAX3 gene causing Waardenburg syndrome type 1 and type 2. Nature Genet., 3,26-30.MEDLINE Abstract
48 Fujioka, M., Mieskiewicz, P., Gulledge, A.A., Weir, M.and Tadaatsu, G. (1996) Drosophila Paired regulates late even-skipped expression through a composite binding site for the paired domain and the homeodomain. Development, 122, 2697-2707.MEDLINE Abstract
49 Chalepakis, G., Goulding, M., Read, A., Strachan, T. and Gruss, P. (1994) Molecular basis of splotch and Waardenburg Pax-3 mutations. Proc. Natl Acad. Sci. USA, 91,3685-3689.MEDLINE Abstract
50 Tassabehji, M., Newton, V.E., Leverton, K., Turnbull, K., Seemanova, E., Kunze, J., Sperling, K., Strachan, T. and Read, A.P. (1994) PAX3 gene structure and mutations: close analogies between Waardenburg syndrome and the Splotch mouse. Hum. Mol. Genet., 3,1069-1074.MEDLINE Abstract
51 Sanger, F., Nicklen, S. and Coulson, A.R. (1977)DNA sequencing with chain-terminating inhibitors. Proc. Natl Acad. Sci. USA,74,5463-5467.MEDLINE Abstract
*To whom correspondence should be addressed. Tel: +1 514 398 7291; Fax: +1 514 398 2603; Email: gros@medcor.mcgill.ca
G. N. Corry, M. J. Hendzel, and D. A. Underhill Subnuclear localization and mobility are key indicators of PAX3 dysfunction in Waardenburg syndrome
Hum. Mol. Genet.,
June 15, 2008;
17(12):
1825 - 1837.
[Abstract][Full Text][PDF]
S. Apuzzo, A. Abdelhakim, A. S. Fortin, and P. Gros Cross-talk between the Paired Domain and the Homeodomain of Pax3: DNA BINDING BY EACH DOMAIN CAUSES A STRUCTURAL CHANGE IN THE OTHER DOMAIN, SUPPORTING INTERDEPENDENCE FOR DNA BINDING
J. Biol. Chem.,
August 6, 2004;
279(32):
33601 - 33612.
[Abstract][Full Text][PDF]
E. Wingender, X. Chen, R. Hehl, H. Karas, I. Liebich, V. Matys, T. Meinhardt, M. Pru{beta}, I. Reuter, and F. Schacherer TRANSFAC: an integrated system for gene expression regulation
Nucleic Acids Res.,
January 1, 2000;
28(1):
316 - 319.
[Abstract][Full Text][PDF]
I. Mikkola, J.-A. Bruun, G. Bjorkoy, T. Holm, and T. Johansen Phosphorylation of the Transactivation Domain of Pax6 by Extracellular Signal-regulated Kinase and p38 Mitogen-activated Protein Kinase
J. Biol. Chem.,
May 21, 1999;
274(21):
15115 - 15126.
[Abstract][Full Text][PDF]
H. E. Xu, M. A. Rould, W. Xu, J. A. Epstein, R. L. Maas, and C. O. Pabo Crystal structure of the human Pax6 paired domain-DNA complex reveals specific roles for the linker region and carboxy-terminal subdomain in DNA binding
Genes & Dev.,
May 15, 1999;
13(10):
1263 - 1275.
[Abstract][Full Text]
K. J. Vogan and P. Gros The C-terminal Subdomain Makes an Important Contribution to the DNA Binding Activity of the Pax-3 Paired Domain
J. Biol. Chem.,
November 7, 1997;
272(45):
28289 - 28295.
[Abstract][Full Text][PDF]
I. Mikkola, J.-A. Bruun, T. Holm, and T. Johansen Superactivation of Pax6-mediated Transactivation from Paired Domain-binding Sites by DNA-independent Recruitment of Different Homeodomain Proteins
J. Biol. Chem.,
February 2, 2001;
276(6):
4109 - 4118.
[Abstract][Full Text][PDF]
CiteULike 
Connotea 
Del.icio.us What's this?
