Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (28)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Joehrer, K.
Right arrow Articles by White, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Joehrer, K.
Right arrow Articles by White, P. C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1829-1834

CYP11B1 mutations causing non-classic adrenal hyperplasia due to 11[beta]- hydroxylase deficiency
Introduction
Results
Discussion
   Functional effects of mutations seen in non-classic 11[beta]-hydroxylase deficiency
   Comparisons between non-classic deficiencies of adrenal enzymes
Materials And Methods
   Patients
   Genomic cloning, PCR amplification and sequencing
   Genetic segregation analysis
   Site-directed mutagenesis and in vitro expression studies
Acknowledgements
References

CYP11B1 mutations causing non-classic adrenal hyperplasia due to 11[beta]- hydroxylase deficiency

CYP11B1 mutations causing non-classic adrenal hyperplasia due to 11 [beta]- hydroxylase deficiency Karin Joehrer, Stephan Geley, Elisabeth M.C. Strasser-Wozak, Ricardo Azziz1, Hartmut A. Wollmann2, Klaus Schmitt3, Reinhard Kofler and Perrin C. White4,*

Institute for General and Experimental Pathology, Division of Molecular Pathophysiology, University of Innsbruck, Medical School, Innsbruck, Austria, 1Departments of Obstetrics and Gynecology and of Medicine, The University of Alabama at Birmingham, Birmingham, Alabama, USA, 2Department of Pediatrics, University of Tübingen, Tübingen, Germany, 3Childrens' Hospital, Linz, Austria and 4Department of Pediatrics, University of Texas Southwestern Medical Center, Dallas, TX 75235-9063, USA

Received February 21, 1997; Revised and Accepted July 8, 1997

Steroid 11[beta]-hydroxylase deficiency is the second most common cause of congenital adrenal hyperplasia, the inherited inability to synthesize cortisol. Severely affected patients carry mutations in the CYB11B1 gene that destroy enzymatic activity. Such patients have signs of androgen excess and usually have hypertension. Mild or non-classic 11[beta]-hydroxylase deficiency has been reported previously but not studied genetically. In this study we report analysis of the CYP11B1 genes of three patients thought to suffer from non-classic 11[beta]-hydroxylase deficiency. Mutations were detected in the CYP11B1 genes of two patients. One was a compound heterozygote for missense mutations N133H and T319M, whereas the other carried a nonsense mutation (Y423X) on one allele and a missense mutation (P42S) on the other. All three missense mutations affected enzymatic activity when expressed in vitro. No mutations were detected in the coding regions or intron-exon boundaries of the CYP11B1 genes of the other putative non-classic patient. In addition, we were unable to detect CYP11B1 mutations in two hirsute women with mildly elevated levels of 11[beta]-hydroxylase precursors who had previously been identified in a screening study of patients in a reproductive endocrinology clinic. We conclude that non-classic 11[beta]-hydroxylase deficiency is a rare disorder. It is not a significant cause of hyperandrogenism in women and relatively stringent criteria should be used to prevent its misdiagnosis.

INTRODUCTION

Congenital adrenal hyperplasia (CAH), the inherited inability to synthesize cortisol, is one of the most common inherited endocrine disorders (1 ). Cortisol is normally synthesized in the zona fasciculata of the adrenal cortex in five enzymatic steps: cleavage of the cholesterol side chain to convert cholesterol to pregnenolone, dehydrogenation at the 3[beta] position to yield progesterone and a series of hydroxylations at the 17[alpha], 21 and 11[beta] positions to form 17[alpha]-hydroxyprogesterone, 11-deoxycortisol and cortisol respectively.

Whereas >90% of cases of CAH are caused by 21-hydroxylase deficiency, steroid 11[beta]-hydroxylase (P450c11, EC 1.14.15.4) deficiency accounts for 5-8% of cases and has a frequency of 1/200 000 in the general Caucasian population (2 ). In classic 11[beta]-hydroxylase deficiency decreased or absent cortisol secretion stimulates ACTH secretion which, in turn, leads to accumulation of steroid precursors that are shunted into the androgen synthesis pathway. Typical signs of androgen excess include masculinization of female external genitalia and precocious pseudopuberty in both sexes. Patients undergo rapid somatic growth with premature epiphyseal closure resulting in short adult stature. Moreover, elevated metabolites with mineralocorticoid activity, such as deoxycorticosterone and its derivatives, cause hypertension in about two thirds of patients. Patients are treated with glucocorticoid replacement and with antihypertensive therapy if necessary.

A non-classic form of 11[beta]-hydroxylase deficiency has been reported that causes milder androgen excess than the classic form. This may produce menstrual cycle abnormalities, hirsutism and acne in previously asymptomatic women. These problems resemble those found in women suffering from polycystic ovary syndrome (3 ,4 ). Whereas the frequency of non-classic 11[beta]- hydroxylase deficiency is not known, it has been hypothesized that some women thought to have polycystic ovary syndrome might in fact have non-classic 11[beta]-hydroxylase deficiency (5 ).

CYP11B1, the gene encoding 11[beta]-hydroxylase, is located on chromosome 8q21-22, tandemly arranged with the CYP11B2 gene encoding aldosterone synthase (P450aldo) (6 ). These enzymes are 93% identical in their amino acid sequences but differ in their expression patterns and catalytic activities (7 ). Mutations in CYP11B1 causing classic 11[beta]-hydroxylase deficiency have been identified (8 -14 ), but no molecular investigations of the non-classic disorder have been performed thus far. Therefore, we sequenced the CYP11B1 genes of three putative non-classic 11[beta]-hydroxylase deficiency patients and expressed the identified mutations in vitro. We also attempted to identify CYP11B1 mutations in selected hirsute women seen in a reproductive endocrinology clinic.

RESULTS

Genomic cloning of the CYP11B1 genes of patient 1 followed by sequence analysis revealed compound heterozygosity for missense mutations N133H (exon 3, AAT -> CAT) and T319M (exon 6, ACG -> ATG). Her father was heterozygous for N133H, her mother and a brother carried T319M on one allele and a sister was homozygous normal (Fig. 1 ). Complete sequence analysis of the genomically cloned CYP11B1 genes of patient 1 led to identification of the hitherto unknown nucleotide sequences of intron 2 and intron 8, with a total length of 1798 and 469 bp respectively (EMBL Databank accession nos X85218 and X85219).


Figure 1. Dot blot analysis of the family of patient 1. Dot blot hybridizations are aligned below a pedigree diagram. In the diagram alleles carrying N133H are in black and those carrying T319M are hatched. The genotype of each individual is shown (wt, wild-type). Control indicates a PCR fragment of a normal control DNA. Columns labeled N133H and T319M represent hybridization to genomic clones harboring the respective mutations. Each row is labeled with the oligonucleotide used for that hybridization; the first two rows are for the wild-type and mutant alleles of codon 133 and the last two rows for alleles of codon 319 (the numbers in parentheses permit reference to Table 4).

Sequence analyses of PCR-amplified DNA fragments from patient 2 also revealed two mutations, one missense (exon 1, CCC -> TCC, P42S) and the other nonsense (exon 8, TAT -> TAG, Y423X). Dot blot analysis showed that the patient and her mother were heterozygous for P42S, whereas the patient inherited Y423X from her father, as demonstrated by sequence analysis (data not shown). Y423X leads to a premature stop in exon 8 yielding a truncated enzyme lacking the essential cysteine residue (C450) that interacts with the heme prosthetic group (9 ).

To demonstrate that the missense mutations in patients 1 and 2 affected enzymatic activity, normal and mutant cDNAs were expressed in cultured COS-1 cells. P42S, N133H and T319M reduced 11[beta]-hydroxylase activity in standard in vitro enzyme assays to 15, 17 and 37% of wild-type activity respectively (Fig. 2 ).


Figure 2. TLC analysis of the activity of CYP11B1 wild-type and mutated enzymes causing non-classic 11[beta]-hydroxylase-deficient CAH (autoradiogram). This is a representative experiment out of seven (P42S and N133H) or four (T319M). The appearance of cortisone is due to an intrinsic 11-hydroxysteroid dehydrogenase activity of COS cells.

Sequence analysis of the PCR-amplified CYP11B1 genes of patient 3 did not reveal any deviations from the normal sequence. The possibility of CYP11B1 deletions was ruled out by Southern blotting (not shown).

Patients 4 and 5 were adult women with signs of androgen excess who had levels of 11-deoxycortisol greater than three times the 95th percentile of normal after ACTH stimulation (5 ). No mutations were detected in samples from either patient. Based on the negative molecular findings, the hormonal status of each patient was re-evaluated by repeated ACTH testing. Whereas the stimulated 11-deoxycortisol levels remained above normal for both patients (11 [mu]g/l for both patients), the levels were markedly less than initially measured (Table 1 ).

Table 1 . Biochemical characterization of patients with suspected non-classic 11[beta]-hydroxylase deficiency
  Patient Controls
  1 2 3 4 5  
THS - 1690 4421 - - <50
17[alpha]-OHP 2.2/6.7 - - -/4.2 -/1.4 <2/<3
11-deoxycortisol 12/41 - 84/171 6/24 5/22 <5/<8
Cortisol 151/101 - 121/141 180/234 55/246 <190/<300
THS, urinary tetrahydro-11-deoxycortisol excretion ([mu]g/24 h). Other steroid levels are measured in plasma in [mu]g/l. Two values separated by a slash (/) represent basal and ACTH-stimulated levels. 17[alpha]-OHP, 17[alpha]-hydroxyprogesterone. Control values represent upper 95th percentile limits.

Table 2 . Homology alignments between members of the CYP11 family (taken from the EMBL Databank)
  Sequences framing P42 Sequences framing N133 Sequences framing T319
Human P450c11 PFEAMPRRPGN GVFLLNGPEWR GSVDTTVFPLL
Human P450aldo PFEAMPQHPGN GVFLLNGPEWR GSVDTTAFPLL
Bovine P450c11 PFEAMPRCPGN GVFLLNGPQWR GSVDTTAFPLL
Rat P450c11 PFEAIPQYSRN GVFLLNGADWR GSVDTTAISLV
Mouse P450c11 PFEAIPQYSRN GVFLLNGPEWR GSVDTTAIPLV
Rat P450aldo PFEAIPQYSRN GVFLLNGAEWR GSVDTTAIPLV
Human P450scc PFNEIPSPGDN GVFLKKSAAWK GGVDTTSMTLQ
Bovine P450scc PYSEIPSPGDN GVFLKKSGTWK GGVNTTSMTLQ
Pig P450scc PFSEIPSPGDN GVLLKKSGAWK GGVDTTSMTLQ
Rat P450scc SFNEIPSPGDN GVLFKSSDAWR GGVDTTSMTLQ
Trout P450scc NFSEIPGLWRN GVLLKNGEDWR GGVDTTSITLL
Aligned portions of amino acid sequences are listed in single letter code and amino acid residues homologous to mutated residues found in non-classic CAH patients are bold and underlined.

DISCUSSION

Functional effects of mutations seen in non-classic 11[beta]-hydroxylase deficiency

We aligned the predicted amino acid sequence of human CYP11B1 with related P450 enzymes, particularly bovine CYP11A (P450scc), for which a 3-dimensional model exists (19 ). One of the mutated amino acid residues, N133, is conserved in all CYP11B isozymes but not in CYP11A (Table 2 ). This residue is thought to lie within a region that may form part of the access route for the substrate; point mutations in this region significantly alter substrate specificity in different P450s (20 ,21 ).

T319 is conserved in all CYP11B and CYP11A isozymes and in many but not all other P450s. It is situated within a region that may be critical for binding of molecular oxygen and/or proton transfer (21 ,22 ). The adjacent residue, T318, is completely conserved in P450s and the analogous T318M mutation of CYP11B1 destroys enzymatic activity and causes classic 11[beta]-hydroxylase deficiency (9 ). However, there is an intron in CYP11B1 between T318 and T319 (6 ) and it is also possible that the T319M mutation interferes with proper splicing of pre-mRNA. Expression of minigene constructs would be required to assess this possibility.

P42 is conserved in all CYP11B isozymes and in rather distantly related enzymes such as P450cam. Several proline residues are found in most P450 enzymes in this region (23 ). They may be essential for proper orientation of the enzyme with respect to the membrane, as is the case for microsomal P450s (24 ). A mutation of proline to leucine in the corresponding region of CYP21 (P30L) causes mild 21-hydroxylase deficiency, consistent with this hypothesis (25 ).

Comparisons between non-classic deficiencies of adrenal enzymes

The most common cause of classic CAH is steroid 21-hydroxylase deficiency. Non-classic 21-hydroxylase deficiency occurs even more frequently than the classic form of the disease, being found in >1% of certain populations such as Jews of central or eastern European origin (26 ). This disorder can be asymptomatic or can cause signs of androgen excess during childhood or at puberty.

Non-classic 11[beta]-hydroxylase deficiency has been described on the basis of clinical investigations (27 ), although no molecular studies have been reported. It appears to cause similar clinical symptoms to those seen in non-classic 21-hydroxylase deficiency but differs in the accumulated precursors that are detected and in the possible appearance of mildly elevated blood pressure in some 11[beta]-hydroxylase-deficient patients. Because this disorder causes relatively mild signs and symptoms of androgen excess, it is possible that its apparent rarity reflects problems of ascertainment. Consistent with this, the two patients in whom we found mutations were compound heterozygotes. Because the degree of compound heterozygosity in recessive genetic disorders that do not have stereotypic mutations is roughly proportional to the frequency of mutant alleles in the general population, this suggests that there may be a relatively high frequency of non-classic 11[beta]-hydroxylase deficiency alleles in the population. We found that the degree of enzymatic compromise associated with the non-classic form of 11[beta]-hydroxylase deficiency is similar to that seen in non-classic 21-hydroxylase deficiency. The less affected alleles in two of our patients encode enzymes that have ~15 and 40% of the 11[beta]-hydroxylase activity of the wild-type enzyme respectively, whereas mutations in CYP21 that cause non-classic 21-hydroxylase deficiency decrease 21-hydroxylase activity to 20-60% of normal (25 ,28 -30 ). Thus, the non-classic form of 11[beta]-hydroxylase deficiency is a true allelic variant of this disorder in at least some individuals.

We were unable to detect mutations in three of the individuals that we analyzed. Patient 3 was a male who presented at 8 years of age with signs of androgen excess and clear hormonal evidence of 11[beta]-hydroxylase deficiency. Possibly this patient carries mutations in introns or in transcriptional regulatory regions that affect expression of the intact enzyme. The other two patients were adult women who were the only subjects identified as possibly having 11[beta]-hydroxylase deficiency upon consecutively screening 260 women with hyperandrogenism (5 ). Since subsequent genotyping did not identify mutations in CYP11B1 and since repeated ACTH stimulation produced less marked elevation of 11-deoxycortisol levels than those originally obtained, our results suggest that non-classic 11[beta]-hydroxylase deficiency is a very uncommon cause of hyperandrogenism in women. We also conclude that the diagnostic criterion for 11[beta]-hydroxylase deficiency used in screening the hyperandrogenic women, an 11-deoxycortisol level three times the 95th percentile of normal, is not sufficiently stringent. Considering that patient 1, who actually had 11[beta]-hydroxylase deficiency, had an ACTH-stimulated 11-deoxycortisol level of 41 [mu]g/l (approximately five times the 95th percentile of normal), a threshold value of five times the upper limit of normal would increase the specificity of diagnosing this disorder.

The failure to detect any actual cases of non-classic 11[beta]-hydroxylase deficiency among women with hyperandrogenism is consistent with other studies that suggest that a related but more frequent defect in adrenal steroidogenesis, non-classic 21-hydroxylase deficiency, accounts for at most a small minority of cases of hyperandrogenism in women (31 ). Moreover, studies of putative non-classic 3[beta]-hydroxysteroid dehydrogenase deficiencies failed to detect any mutations in the gene encoding this enzyme, suggesting that this disease, too, is not a significant cause of hyperandrogenism (32 ).

We conclude that non-classic 11[beta]-hydroxylase deficiency is a rare but actual allelic variant of 11[beta]-hydroxylase deficiency causing signs of androgen excess.

MATERIALS AND METHODS

Patients

We analyzed the CYP11B1 genes of three unrelated patients, two female (patients 1 and 2) and one male (patient 3), with a clinical diagnosis of non-classic 11[beta]-hydroxylase deficiency. They were all diagnosed in childhood because of advanced bone age, accelerated growth, acne and precocious adrenarche (see Table 3 ). In addition, we studied two participants (patients 4 and 5) from a study screening for 11[beta]-hydroxylase deficiency in women with signs of androgen excess (patients 229 and 506 in ref. 5 ). Both demonstrated 11-deoxycortisol levels 60 min after administration of 1.0 mg ACTH (1 -24 ) (Cortrosyn; Organon, Orange, NJ) that were greater than three times the upper limit of normal.

Table 1 summarizes the steroid hormone analyses supporting the diagnosis of 11[beta]-hydroxylase deficiency in these patients. Patients 1 and 3 had increased basal and ACTH-stimulated levels of 11-deoxycortisol in serum. The diagnoses of patients 2 and 3 were supported by measuring elevated 11-deoxycortisol metabolites in urine.

Genomic cloning, PCR amplification and sequencing

DNA was prepared from peripheral blood samples following standard or phenol-free protocols (15 ,16 ). The CYP11B1 genes of patient 1 were isolated from a genomic DNA library constructed in bacteriophage [lambda]GEM12 (Promega, Madison, WI) by standard methods and screened in duplicate with a radiolabeled 900 bp PstI fragment of CYP11B2 (Helmberg et al., 1992) and oligonucleotide probes 74 and 76 specific for CYP11B1 (see Table 4 ). Plasmid subclones were then sequenced.

In order to analyze the CYP11B1 genes of the other patients, 100 ng genomic DNA were amplified in three PCR reactions using each of three sets of primers amplifying exons 1 and 2 (primers 209/210), exons 3-5 (primers 211/212) and exons 5-9 (primers 213/214) respectively. Primers 210, 212 and 213 were 5'-biotinylated, allowing coupling of each fragment to streptavidin-coated paramagnetic beads (Dynabeads, Dynal M-280). PCR was carried out in a volume of 100 [mu]l, containing 50 mM KCl, 10 mM Tris-HCl, 0.1% Triton X-100, 200 [mu]M deoxy-NTPs, 0.2 [mu]M each primer, 100 ng genomic DNA and 3 U Taq DNA polymerase at pH 9. MgCl2 concentrations used were 1.0 mM for fragments A and B and 0.8 mM for fragment C. After initial denaturation at 94oC for 2 min, 35 cycles (94oC 1 min, 64oC 2 min and 72oC 3 min) were performed in an OmniGene Temperature Cycler (Hybaid Ltd, Teddington, UK). After amplification the reaction mix was purified using the Wizardtm PCR Purification System (Promega) following the producer's instructions. The samples were coupled to an equal volume of streptavidin-coated paramagnetic beads (6-7 * 108 beads/ml) (17 ). After washing in water the DNA strands were separated by denaturation using 0.2 N NaOH. Both strands served as templates in subsequent chain termination reactions.

Table 3 . Clinical features of patients 1-3, who were diagnosed as children
  Patient 1 Patient 2 Patient 3
Sex F F M
Chronologic age at diagnosis (years) 8 5/12 5 10/12 8 5/12
Bone age at diagnosis (years) 11 12a 13
Height percentile >95 75 95
Acne No Yes Yes
Pubic hair stageb 2 2 2
aBone age at a chronologic age of 10 3/12 years.
bStages of pubic hair development (33).

Table 4 . Oligonucleotides and primers
Oligonucleotide Sequence Localizationa Purpose Comment
209 (s) CCCATGACGTGATCCCTCTCGAAGG 555-579 PCR  
210 (as) AAACACAGGCCCTGACCCGTATCCC 3138-3163 PCR Biotinylated
211 (s) TCAGCACCTGTGGGCAGAAGCTACCA 2965-2990 PCR  
212 (as) AGCGTCATCAGCAAGGGAAACACCG 4548-4572 PCR Biotinylated
213 (s) CGCCCTCAACAGTACACCAGCATCG 4069-4093 PCR Biotinylated
214 (as) AAACCACAGCACCCTTGCATGGCCA 6344-6368 PCR  
322 (s) TTTGGATCCACCATGGCACTCAGGGCAAAGGCA CYP11B1-5'-UT PCR 5' PCR
323 (as) GAATCTAGAGACGTGATTAGTTGATG CYP11B1-3'-UT PCR 3' PCR
74 (s) GAAGGCAAGGCACCAGG 575-591 Screen CYP11B1
76 (s) TCAACTAATCACGTCTC 5730-5746 Screen CYP11B1
262mut (s) GAAGCCATGTCCCGGCGTCC Codon 42 mut  
281wt (s) GAAGCCATGCCCCGG Codon 42 hyb TH 58oC
282mut (s) GAAGCCATGTCCCGG Codon 42 hyb TH 57oC
345mut (s) TCTTGCTGCATGGGCCTGAATGGCG Codon 133 PCR-mut  
344mut (as) AGGCCCATGCAGCAAGAACACGCCA Codon 133 PCR-mut  
71wt TCTGTAGGAATGGGCCTGAA Codon 133 hyb TH 61oC
117mut TCTGTAGGCATGGGCCT Codon 133 hyb TH 50oC
316mut (as) GAAAGACCATCGTGTCCACGCTCCC Codon 319 PCR-mut  
317mut (s) GGACACGATGGTGTTTCCCTTGCTG Codon 319 PCR-mut  
177wt (s) CCTGCAGACGGTGTTTC Codon 319 hyb TH 50oC
178mut (s) CCTGCAGATGGTGTTTC Codon 319 hyb TH 51oC
252 CTGGTGAGTATTCAACCAAGTC [beta]-Lactamase mut Selection
aPosition numbers are based on CYP11B1 sequences published in the EMBL Databank (GenBanktm accession no. J05140: M32863, M32878 and M32179). The missing sequences of intron 2 and 8 were determined in the course of our studies and submitted to the EMBL Sequence Database (accession nos X85218 and X85219). The fragments were merged at positions 1482 (M32863 and X85218) and 2834 (X85218 and M32878), in order to include the missing intron 2 sequence, and at positions 5467 (M32878 and X85219) and 5751 (X85219 and M32179), closing the gap in intron 8. The orientation of each oligonucleotide is indicated as sense (s) or antisense (as). Oligonucleotides were used for PCR (PCR), site-directed mutagenesis according to the method of Deng et al. (mut) or PCR (PCR-mut) and dot blot analysis (hyb). Mutated bases are underlined in the respective primer. TH, high stringency washing temperature.

Genetic segregation analysis

Allele-specific oligonucleotide hybridization of dot blots was performed using wild-type and mutant-specific oligonucleotides (see Table 4 ). PCR-amplified DNA fragments of patients and parents were purified as above and dotted onto nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany). Dot blots were denatured in 0.5 N NaOH, 1.5 M NaCl, neutralized in 0.5 M Tris-HCl, pH 8.0, 3 M NaCl and 6* SSC (2 min each step; 1* SSC = 150 mM NaCl, 15 mM sodium citrate, pH 7.0) and baked for 2 h in a vacuum oven at 80oC. Filters were hybridized with 32P-labeled oligonucleotides at 37oC in 5* Denhardt's solution, 6* SSC and 0.05% SDS to analyze the inheritance patterns of the respective mutations. Blots were washed in 2* SSC, 0.1% SDS at high stringency washing temperatures (see Table 4 ) and autoradiographed on Agfa RP-1 film (Agfa, Vienna, Austria) with intensifying screens at -90oC for 12 h. Genetic segregation analysis for the Y423X allele was performed by sequencing the parental CYP11B1 genes.

Site-directed mutagenesis and in vitro expression studies

Mutation P42S was introduced into the CYP11B1 expression vector pCMV4-11B1 wild-type by means of mutation-specific primer 262 and by eliminating the unique ScaI site in the [beta]-lactamase gene of pCMV4-11B1 using primer 252 as described (18 ). Site-directed mutagenesis of mutations N133H and T319M were performed using a PCR-based protocol (9 ). Oligonucleotides used to introduce the respective mutations are listed in Table 4 .

For in vitro expression analysis COS-1 cells were transiently co-transfected with pCMV4-11B1 wild-type or mutated construct and human adrenodoxin and adrenodoxin reductase expression vectors pCMV4-Adx and pCMV4-AR (gifts from Dr W.L.Miller), using Lipofectamin (Gibco BRL, Gaithersburg, MD) as described (7 ,9 ). Approximately 105 cells at 80% confluence in 35 mm wells were incubated with 20 [mu]g Lipofectamin, 1-2 [mu]g pCMV4-AR and pCMV4-Adx alone or together with 5 [mu]g pCMV4-11B1 wild-type or pCMV4-11B1 mutated vector. Cells were allowed to recover for 18 h in Dulbecco's modified Eagle's medium supplemented with 10% bovine calf serum.

Enzyme activities were analyzed by incubating the transfected cells with 0.1-1.0 [mu]M [3H]11-deoxycortisol (New England Nuclear, Boston, MA) for 15-24 h and resolving the extracted steroids by thin layer chromatography on silica-coated plates (Merck, Darmstadt, Germany) in methylene chloride, methanol, H2O (300:20:1). Plates were treated with En3Hancetm spray (NEN, Boston, MA) and autoradiographed for at least 12 h at -90oC. The portion of the plate corresponding to each spot was scraped off and counted using a liquid scintillation counter.

ACKNOWLEDGEMENTS

We thank Dr M.I.New (New York) for providing blood samples of patients, Dr W.L.Miller for expression plasmids for adrenodoxin and adrenodoxin reductase, Drs W.Sippell (Kiel) and J.Homoki (Ulm) for hormonal analysis data and Prof. S.Schwarz (Innsbruck) for stimulating discussions. This work was supported by the Austrian Fonds zur Förderung Wissenschaftlicher Forschung (grants P10110 Med and P8751 Med) and by the National Institutes of Health (grant DK37867).

REFERENCES

1 White,P.C. (1994) Genetic diseases of steroid metabolism. Vitam. Hormones, 49, 131-195.

2 White,P.C., Curnow,K.M. and Pascoe,L. (1994) Disorders of steroid 11 beta hydroxylase isozymes. Endocr. Rev., 15, 421-438. MEDLINE Abstract

3 Balen,A.H., Conway,G.S., Kaltsas,G., Techatrasak,K., Manning,P.J., West,C. and Jacobs,H.S. (1995) Polycystic ovary syndrome: the spectrum of the disorder in 1741 patients. Hum. Reprod., 10, 2107-2111. MEDLINE Abstract

4 Knochenhauer,E.S. and Azziz,R. (1995) Advances in the diagnosis and treatment of the hirsute patient. Curr. Opin. Obstet. Gynecol., 7, 344-350. MEDLINE Abstract

5 Azziz,R., Boots,L.R., Parker,C.R.,Jr., Bradley,E.,Jr and Zacur,H.A. (1991) 11 Beta-hydroxylase deficiency in hyperandrogenism. Fertil. Steril., 55, 733-741. MEDLINE Abstract

6 Mornet,E., Dupont,J., Vitek,A. and White,P.C. (1989) Characterization of two genes encoding human steroid 11 beta-hydroxylase (P-450(11) beta). J. Biol. Chem., 264, 20961-20967.

7 Curnow,K.M., Tusie-Luna,M.T., Pascoe,L., Natarajan,R., Gu,J.L., Nadler,J.L. and White,P.C. (1991) The product of the CYP11B2 gene is required for aldosterone biosynthesis in the human adrenal cortex. Mol. Endocrinol., 5, 1513-1522. MEDLINE Abstract

8 White,P.C., Dupont,J., New,M.I., Leiberman,E., Hochberg,Z. and Rosler,A. (1991) A mutation in CYP11B1 (Arg-448----His) associated with steroid 11 beta-hydroxylase deficiency in Jews of Moroccan origin. J. Clin. Invest., 87, 1664-1667. MEDLINE Abstract

9 Curnow,K.M., Slutsker,L., Vitek,J., Cole,T., Speiser,P.W., New,M.I., White,P.C. and Pascoe,L. (1993) Mutations in the CYP11B1 gene causing congenital adrenal hyperplasia and hypertension cluster in exons 6, 7, and 8. Proc. Natl. Acad. Sci. USA., 90, 4552-4556. MEDLINE Abstract

10 Helmberg,A., Ausserer,B. and Kofler,R. (1992) Frame shift by insertion of 2 basepairs in codon 394 of CYP11B1 causes congenital adrenal hyperplasia due to steroid 11 beta-hydroxylase deficiency. J. Clin. Endocrinol. Metab., 75, 1278-1281. MEDLINE Abstract

11 Naiki,Y., Kawamoto,T., Mitsuuchi,Y., Miyahara,K., Toda,K., Orii,T., Imura,H. and Shizuta,Y. (1993) A nonsense mutation (TGG [Trp116]--TAG [Stop]) in CYP11B1 causes steroid 11beta-hydroxylase deficiency. J. Clin. Endocrinol. Metab., 77, 1677-1682. MEDLINE Abstract

12 Skinner,C. and Rumsby,G. (1994) Steroid 11[beta]-hydroxylase deficiency caused by a five basepair duplication in the CYP11B1 gene. Hum. Mol. Genet., 3, 377-378. MEDLINE Abstract

13 Nakagawa,Y. et al. (1995) Missense mutation in CYP11B1 (CGA (Arg-384)--GGA (Gly)) causes steroid 11[beta]-hydroxylase deficiency. Eur. J. Endocrinol., 132, 286-289. MEDLINE Abstract

14 Geley,S., Kapelari,K., Johrer,K., Peter,M., Glatzl,J., Vierhapper,H., Sippell,W.G., White,P.C. and Kofler,R. (1996) CYP11B1 mutations causing congenital adrenal hyperplasia due to 11[beta]-hydroxylase deficiency. J. Clin. Endocrinol. Metab., 81, 2896-2901. MEDLINE Abstract

15 Miller,S.A., Dykes,D.D. and Polesky,H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res., 16, 1215. MEDLINE Abstract

16 Woodhead,J.L., Fallon,R., Figuieredo,H., Longdale,J. and Malcolm,A.D.B. (1986) In Davies,K.E. (ed.), Human Genetic Diseases-A Practical Approach. IRL Press, Oxford, UK, pp. 66-67.

17 Uhlen,M. (1989) Magnetic separation of DNA. Nature, 340, 733-734. MEDLINE Abstract

18 Deng,W.P. and Nickoloff,J.A. (1991) Site-directed mutagenesis of virtually any plasmid by eliminating a unique site. Anal. Biochem., 200, 81-88.

19 Vijayakumar,S. and Salerno,J.C. (1992) Molecular modeling of the 3-D structure of cytochrome P-450scc. Biochim. Biophys. Acta, 1160, 281-286. MEDLINE Abstract

20 Lindberg,R.L. and Negishi,M. (1989) Alteration of the mouse cytochrome P450coh substrate specificity by mutation of a single amino-acid residue. Nature, 339, 632-634. MEDLINE Abstract

21 Poulos,T.L. (1995) Cytochrome P450. Curr. Opin. Struct. Biol., 5, 767-774. MEDLINE Abstract

22 Ravichandran,K.G., Boddupalli,S.S., Hasemann,C.A., Peterson,J.A. and Deisenhofer,J. (1993) Crystal structure of hemoprotein domain of P450BM-3, a prototype for microsomal P450's. Science, 261, 731-736. MEDLINE Abstract

23 Nelson,D.R. and Strobel,H.W. (1988) On the membrane topology of vertebrate cytochrome P-450 proteins. J. Biol. Chem., 263, 6038-6050. MEDLINE Abstract

24 Yamazaki,S., Sato,K., Sakaguchi,M., Mihara,K. and Omura,T. (1993) Importance of the proline-rich region following the signal-anchor sequence in the formation of the correct conformation of microsomal cytochrome P-450s. J. Biochem. (Tokyo), 114, 652-657. MEDLINE Abstract

25 Tusie-Luna,M.T., Speiser,P.W., Dumic,M., New,M.I. and White,P.C. (1991) A mutation (Pro-30 to Leu) in CYP21 represents a potential nonclassic steroid 21-hydroxylase deficiency allele. Mol. Endocrinol., 5, 685-692.

26 Speiser,P.W., New,M.I. and White,P.C. (1988) Molecular genetic analysis of non-classic steroid 21-hydroxylase deficiency associated with HLA-B14,DR1. New Engl. J. Med., 319, 19-23. MEDLINE Abstract

27 Zachmann,M., Tassinari,D. and Prader,A. (1983) Clinical and biochemical variability of congenital adrenal hyperplasia due to 11 beta-hydroxylase deficiency. A study of 25 patients. J. Clin. Endocrinol. Metab., 56, 222-229. MEDLINE Abstract

28 Helmberg,A., Tusie-Luna,M.T., Tabarelli,M., Kofler,R. and White,P.C. (1992) R339H and P453S: CYP21 mutations associated with nonclassic steroid 21-hydroxylase deficiency that are not apparent gene conversions. Mol. Endocrinol., 6, 1318-1322. MEDLINE Abstract

29 Speiser,P.W., Dupont,J., Zhu,D., Serrat,J., Buegeleisen,M., Tusie-Luna,M.T., Lesser,M., New,M.I. and White,P.C. (1992) Disease expression and molecular genotype in congenital adrenal hyperplasia due to 21-hydroxylase deficiency. J. Clin. Invest., 90, 584-595. MEDLINE Abstract

30 Tusie-Luna,M.T., Traktman,P. and White,P.C. (1990) Determination of functional effects of mutations in the steroid 21-hydroxylase gene (CYP21) using recombinant vaccinia virus. J. Biol. Chem., 265, 20916-20922. MEDLINE Abstract

31 Azziz,R. and Zacur,H.A. (1989) 21-Hydroxylase deficiency in female hyperandrogenism: screening and diagnosis. J. Clin. Endocrinol. Metab., 69, 577-584. MEDLINE Abstract

32 Simard,J. et al. (1993) Molecular basis of congenital adrenal hyperplasia due to 3 beta-hydroxysteroid dehydrogenase deficiency. Mol. Endocrinol., 7, 716-728. MEDLINE Abstract

33 Tanner,J.M. and Whitehouse,R.H. (1976) Clinical longitudinal standards for height, weight, height velocity, weight velocity, and stages of puberty. Arch. Dis. Child, 51, 170-179. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +1 214 648 3501; Fax: +1 214 648 9772; Email: pwhit2@mednet.swmed.edu
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Clin. Endocrinol. Metab.Home page
S. Parajes, L. Loidi, N. Reisch, V. Dhir, I. T. Rose, R. Hampel, M. Quinkler, G. S. Conway, L. Castro-Feijoo, D. Araujo-Vilar, et al.
Functional Consequences of Seven Novel Mutations in the CYP11B1 Gene: Four Mutations Associated with Nonclassic and Three Mutations Causing Classic 11{beta}-Hydroxylase Deficiency
J. Clin. Endocrinol. Metab., February 1, 2010; 95(2): 779 - 788.
[Abstract] [Full Text] [PDF]

Home page
 Drug Metab. Dispos.Home page
L.-L. Wang, Y. Li, and S.-F. Zhou
A Bioinformatics Approach for the Phenotype Prediction of Nonsynonymous Single Nucleotide Polymorphisms in Human Cytochromes P450
Drug Metab. Dispos., May 1, 2009; 37(5): 977 - 991.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
L. J. Mullins, M. A. Bailey, and J. J. Mullins
Hypertension, Kidney, and Transgenics: A Fresh Perspective
Physiol Rev, April 1, 2006; 86(2): 709 - 746.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
N. Krone, F. G. Riepe, D. Gotze, E. Korsch, M. Rister, J. Commentz, C.-J. Partsch, J. Grotzinger, M. Peter, and W. G. Sippell
Congenital Adrenal Hyperplasia Due to 11-Hydroxylase Deficiency: Functional Characterization of Two Novel Point Mutations and a Three-Base Pair Deletion in the CYP11B1 Gene
J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3724 - 3730.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
P. C. White and W. E. Rainey
Polymorphisms in CYP11B Genes and 11-Hydroxylase Activity
J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1252 - 1255.
[Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
M. Hampf, N. T. N. Dao, N. T. Hoan, and R. Bernhardt
Unequal Crossing-Over between Aldosterone Synthase and 11{beta}-Hydroxylase Genes Causes Congenital Adrenal Hyperplasia
J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4445 - 4452.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (28)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Joehrer, K.
Right arrow Articles by White, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Joehrer, K.
Right arrow Articles by White, P. C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?