Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (54)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Breschel, T. S.
Right arrow Articles by Ross, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Breschel, T. S.
Right arrow Articles by Ross, C. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 1855-1863


A novel, heritable, expanding CTG repeat in an intron of the SEF2-1 gene on chromosome 18q21.1
Introduction
Results
   Clone 7,6A sequence analysis
   Genetic analyses
   Bipolar disorder and CTG18.1
   Allele frequencies of CTG18.1
   Southern blots of genomic digests
Discussion
Materials And Methods
   Cloning
   PCR conditions and Southern blotting
   Expression analysis
   Detection of very enlarged alleles
Acknowledgements
References


A novel, heritable, expanding CTG repeat in an intron of the SEF2-1 gene on chromosome 18q21.1

A novel, heritable, expanding CTG repeat in an intron of the SEF2-1 gene on chromosome 18q21.1 T.S. Breschel1, M.G. McInnis1,*, R.L. Margolis1, G. Sirugo4, B. Corneliussen5, S.G. Simpson1, F.J. McMahon1, D.F. MacKinnon1, J.F. Xu1, N. Pleasant1, Y. Huo1, R.G. Ashworth1, C. Grundstrom5, T. Grundstrom5, K.K. Kidd4, J.R. DePaulo1 and C.A. Ross1,2,3

1George Browne Genetics Laboratory, Department of Psychiatry and Behavioral Sciences, 2Department of Neuroscience, 3Program in Cellular and Molecular Medicine, Johns Hopkins University School of Medicine, Baltimore, MD, USA, 4Department of Genetics, Yale University, New Haven, CT, USA and 5University of Umea, Umea, Sweden

Received May 6, 1997; Revised and Accepted August 5, 1997

There are currently 13 diseases known to be caused by unstable triplet repeat mutations; however, there are some instances (as with FRAXF and FRA16) when these mutations appear to be asymptomatic. In a search for polymorphic CTG repeats as candidate genes for bipolar disorder, we screened a genomic human chromosome 18-specific library and identified a 1.6 kb clone (7,6A) with a CTG24 repeat that maps to 18q21.1. The CTG repeat locus, termed CTG18.1, is located within an intron of human SEF2-1, a gene encoding a basic helix-loop-helix DNA binding protein involved in transcriptional regulation. The CTGn repeat is highly polymorphic and very enlarged alleles, consistent with expansions of up to CTG2100, were identified. PCR and Southern blot analysis in pedigrees ascertained for a Johns Hopkins University bipolar disorder linkage study and in CEPH reference pedigrees revealed a tripartite distribution of CTG18.1 alleles with stable alleles (CTG10-CTG37), moderately enlarged and unstable alleles (CTG53-CTG250), and very enlarged, unstable alleles (CTG800-CTG2100). Moderately enlarged alleles were not associated with an abnormal phenotype and have a combined enlarged allele frequency of 3% in the CEPH and bipolar populations. Very enlarged alleles, detectable only by Southern blot analysis of genomic digests, have thus far been found in only three individuals from our bipolar pedigrees, and to date, have not been found in any of the CEPH reference pedigrees. These enlarged alleles may arise, at least in part, via somatic mutation.

INTRODUCTION

Loci with unstable, expanding trinucleotide repeats are recognized sites of genetic mutation, particularly in illnesses that show clinical anticipation (1 ). At least 13 diseases are known to be caused by unstable expanding triplet repeat mutations. The majority of these are CAG/glutamine repeat diseases-Huntington's disease, spinal and bulbar muscular atrophy, spinocerebellar ataxia (SCA) type 1, SCA2, SCA6, dentatorubral-pallidoluysian atrophy (DRPLA), and Machado-Joseph disease (SCA3)-which are characterized by expansions within coding regions of exons and gain-of-function mechanisms (2 ,3 ). In myotonic dystrophy and in Fragile X (A and E forms), trinucleotide repeats within 5' or 3' untranslated regions of exons expand and interfere with transcriptional processes, resulting in loss-of-function or abnormal RNA processing (3 -5 ). By contrast, Friedreich's ataxia is caused by an expanding GAA mutation within an intron, resulting in a loss-of-function mutation. (6 ).

Due to the association of trinucleotide repeat expansions with disease, our group (7 -9 ) and others (10 -12 ) have screened cDNA and genomic libraries for unstable TNR-containing loci. These efforts have successfully led to the identification of disease genes including the DRPLA gene (atrophin1) (7 ,9 ,13 ,14 ), SCA2 (15 ), and SCA6 (16 ). Genomic libraries have also been successfully screened for trinucleotide repeats (12 ). This approach has particular value in detecting trinucleotide repeats in untranscribed regions or in the 5' ends of transcripts that are either absent or under-represented in cDNA libraries.

Trinucleotide repeats are widely dispersed through the genome (9 ,17 ,18 ) and polymorphisms containing trinucleotide repeats, as well as di and tetranucleotide repeats, have become the backbone of genetic linkage mapping. The repeat expansion detection (RED) has been used to search for enlarged trinucleotide repeats, particularly in diseases with clinical anticipation. Several investigators have found evidence of an increased number of individuals with longer CTG arrays using the RED technique among affected members of pedigrees ascertained for bipolar disorder and schizophrenia (19 -21 ). However, the presence of an abnormally long CTG array identified by the RED technique does not indicate what locus has expanded. There is evidence that in some cases RED may amplify multiple loci and no illness loci have yet been identified with this technique. Moreover, the distribution of normal maximum array sizes vary among populations with arrays as long as CTG85-CTG92 being common in East Asian populations, but rare in Europeans (21 ).


Figure 1. (A) Double stranded sequence of clone 7,6A human genomic DNA. Underlined uppercase bp 988-1061 are 100% identical to a 73 bp sequence from bp 271 to 344 of human SEF2-1 cDNA. Underlined lowercase bp 114-185 highlight the CTG24 repeat. Not underlined, but flanking the CTG24 repeat is a CTC13 repeat. (B) Transcriptional map of 7,6A, human SEF2-1 cDNA, and segment of the mouse SEF2-1 gene. Clone 7,6A shares a 73 bp region of 100% identity with human SEF2-1 cDNA. The region of identity is from 988 to 1061 bp in 7,6A, corresponding to 271-344 bp of SEF2-1 cDNA. Primer set 1a and 1b define the CTG18.1 locus and have a 190 bp product in the clone that spans the stable CTC13 and polymorphic CTG24 repeat. The 7,6A sequence from bp 1 to 988 shows 77% identity to intron 3 of the mouse SEF2-1 gene. A CTG rich 54 bp sequence in intron 3 of the mouse SEF2-1 at the position analogous to the CTG24 repeat of 7,6A is indicated.

Bipolar affective disorder is a severe psychiatric disorder characterized by prominent mood swings ranging from mania to depression. There are reports of linkage of bipolar disorder to chromosome 18 (22 -25 ). In addition, evidence for anticipation in bipolar disorder has been reported (26 ,27 ). Therefore, in searching for candidate genes for bipolar disorder we sought to identify CTG repeats on chromosome 18. We report the isolation of a 1.6 kb clone (termed 7,6A) located on 18q21.1 that consists of exonic and intronic portions of human SEF2-1, a gene encoding a transcriptional factor protein (35 ). Clone 7,6A contains an intronic CTG24 repeat (termed CTG18.1) that is highly polymorphic in both bipolar and control subjects with an observed heterozygosity of 84%. The CTG18.1 locus can contain long restriction fragments, consistent with expansions of up to CTG2100, but is not associated with an obvious abnormal phenotype.

RESULTS

Clone 7,6A sequence analysis

A CAG15 probe was used to isolate genomic clones containing polymorphic CTG repeats in a human chromosome 18 library. The double stranded 1570 bp sequence of 7,6A is shown in Figure 1 A (Accession U75701). Figure 1 B highlights the CTG24 repeat that is 114 bp from the beginning of the clone and is flanked by a stable CTC13 repeat. A BLASTN search of the dBest and non-redundant (nr) databases of GenBank revealed the 73 bp match with human SEF2-1 cDNA (Fig. 1 B). The 73 bp region of 7,6A (base pairs 988-1061) shares 100% identity with the 271-344 bp region of human SEF2-1 cDNA and is located 803 bp from the CTG24 repeat.

Analysis of the mouse SEF2-1 gene has shown that the 73 bp sequence of the human SEF2-1 cDNA (bp 271-344) found in 7,6A is 95% identical to exon 4 of the mouse SEF2-1 gene (Corneliussen et al., unpublished data). To further compare the 7,6A sequence and the mouse SEF2-1 gene, also denoted as E2-2 (28 ), we determined the nucleotide sequence of the mouse intron 3. The 988 bp sequence 5' to the shared identity with exon 4 showed 77% sequence identity to corresponding intron 3 sequences of the mouse SEF2-1 gene. The two introns differ at three repeated sequences (Fig. 1 B). The GA repeat of 7,6A (bp 433-479) was much longer in the mouse gene, and the CTC13 of 7,6A (bp 186-224) was absent in the mouse gene. The CTG24 repeat (bp 114-185) was much shorter in the mouse intron and was interrupted by nucleotide substitutions, deletions and additions. Nevertheless, 40 of 54 nucleotides at the corresponding position of the mouse gene were homologous to the human CTG repeat. BLASTN and BLASTX searches of Genbank indicated no identity with any other known proteins or transcripts.

Expression analyses using clone 7,6A sequence flanking the CTG24/CTC13 repeat were negative. RT-PCR and Northern analyses were performed on total RNA from human adult and fetal whole brain, frontal cortex, amygdala, liver and poly(A)+ mRNA. Two sets of sense and anti-sense 45mer oligonucleotide probes (bp 69-113 and bp 474-518) directly flanking the CTG24/CTC13 repeat were used for the Northern analyses. RT-PCR using primers 1a and 1b (Fig. 1 B) was performed on cDNA made from all the RNA species listed above. There were no bands detected with either the sense or anti-sense probes on Northern blots, and the RT-PCR was consistently negative (data not shown).

Genetic analyses

Clone 7,6A was localized to chromosome 18q21.1. PCR spanning the CTGn/CTCn repeat (locus CTG18.1) was performed with primers 1a: AATCCAAACCGCCTTCCAAGT and 1b: CCAAAACTTCCGAAAGCCATTTCT (Fig. 1 B) to give a 190 bp product when containing a CTG24/CTC13 repeat. The allele lengths were highly polymorphic, with an observed heterozygosity of 84% in 56 unrelated individuals from 15 Centre d'Etude du Polymorphisme Humain (CEPH) pedigrees. The CTG18.1 locus of clone 7,6A was mapped in 48 families ascertained for bipolar disorder by two-point linkage analysis using LINKAGE (29 ) near marker D18S69 (LOD= 22.9, [theta] = 0.025). Physical mapping of 7,6A using radiation hybrid panels (Genebridge 4 panel, Research Genetics) confirmed this location, placing 7,6A 37.4 cR (~10 mb) centromeric from D18S69 and 7.69 cR (~2 mb) telomeric from WI-6206, corresponding to cytogenetic location 18q21.1 (Fig. 2 ).


Figure 2. Cartoon map of chromosome 18 with CTG18.1 localization. Physical map location of CTG18.1 was determined using primers 1a and 1b (B) on the Genebridge 4 radiation hybrid panel (Research Genetics); 3.7 cR = 1 megabase. Genetic distances (centiMorgans) are based on 48 JHU bipolar pedigrees.

Using the RED technique, Schalling et al. (30 ), reported an enlarged CAG/CTG repeat termed RED1 that mapped by linkage to 18q in three CEPH pedigrees: 1334, 1420 and 1344. CTG18.1 was amplified by PCR in these three CEPH pedigrees. CEPH 1334 pedigree showed stable, Mendelian inheritance of the four parental alleles in the range of CTG11 to CTG29 with no evidence of enlarged alleles (Fig. 3 ). In CEPH pedigrees 1420 and 1344 (data not shown), there were enlarged (>CTG86) alleles inherited in a Mendelian manner. This illustrates that the RED technique may identify multiple loci in that CTG18.1 is likely to account for the RED1 findings in CEPH 1344 and 1420, but does not define the expanded repeat locus detected by RED in CEPH 1334.


Figure 3. CTG18.1 PCR of CEPH Pedigree 1334. The primers used in this PCR span the CTG18.1 locus indicated between primers 1a and 1b (Fig. 1B). The numbers on the vertical axis represent the number of CTG repeats per allele. This figure shows both the polymorphic nature of clone 7,6A at the CTG18.1 locus and that it is not RED1 due to a lack of expanded CTG repeats previously reported in this pedigree (30). L = sequamark size ladder.

Bipolar disorder and CTG18.1

Forty-eight bipolar disorder families were analyzed at the CTG18.1 locus. These families were ascertained for one treated bipolar I patient and at least two affected first degree relatives (31 ). Diagnoses were made according to the Research Diagnostic Criteria (32 ) using the SADS-L interview instrument (33 ). A subset of these families show linkage to chromosome 18q21 (24 ). There was no evidence for linkage between CTG18.1 and bipolar disorder. Sib-pair analysis revealed a weighted proportion of 35.8 sharing to 38.5 not sharing sib-pairs ([chi]2 = -0.7, p = 0.64). However, in six families there was evidence of moderately enlarged (>CTG86) alleles at the CTG18.1 locus. The presence of moderately enlarged alleles was confirmed by using a CAG15 radiolabeled oligonucleotide to probe Southern blots of CTG18.1 PCR products subjected to 6% PAGE. Allele sizes detected via PCR at the CTG18.1 locus ranged between CTG10 and ~CTG250. Alleles between CTG10 and CTG37 were inherited with no change in size from parent to offspring in 261 of 262 cases, while larger alleles were inherited with size variation between generations in all 18 cases in which moderately enlarged alleles were transmitted. There is random segregation of enlarged alleles with bipolar disorder. This is demonstrated in Figure 4 where three families are shown. Pedigree JHU-132 represents the majority (42 of 48) pedigrees wherein only stable size (CTG10 to CTG37) alleles segregate from parents to offspring. Pedigrees JHU-118 and JHU-217 show inheritance of the larger and unstable alleles independent of the bipolar phenotype.


Figure 4. Inheritance of stable and unstable CTG18.1 alleles in bipolar pedigrees. The moderately expanded CTG18.1 allele of 7,6A shows clear Mendelian inheritance but segregates randomly with the bipolar phenotype. In JHU pedigree 118 the father (Lane 5) has an unstable expansion (CTG104, CTG120)* inherited from the grandfather (CTG104, Lane 8) that is transmitted to offspring in lanes 2 and 4. (Lane 1 leaked to the left). JHU pedigree 132: segregation of stable CTG alleles without expansions. JHU pedigree 217: expanded, unstable alleles are present in the mother (Lane 6, CTG110, 125 ,250)** and transmitted to three offspring (lanes 1, 3 and 4). Lanes `L' and `C' are the sequamark ladder and 7,6A clone, respectively. *Note: The size of alleles >CTG86 may not all be exact due to limited resolution of the size ladder above 350 bp. **Note: the bands in JHU pedigree 217, lane 6 are visible at a higher light/dark setting on this phosphoimage (see `blowup' image), but are not as visible at the current resolution. (These alleles were reproduced on several other gels). This image is from a Southern blot of cold CTG18.1 PCR products loaded onto a 6% acrylamide gel, transferred onto Genescreen+ nylon paper (NEN, Dupont) and probed with a CAG15 oligonucleotide radiolabeled with [[gamma]-32P]ATP.

To verify that moderately enlarged alleles resulted from expanded CTG repeats, we performed PCR across the CTG18.1 locus in four individuals, then subcloned and sequenced the enlarged alleles from excised agarose gel fragments. Sequence data from one individual (JHU 117-001) homozygous for enlarged alleles revealed one enlarged allele with 93 CTG repeats flanked by a CTC13 repeat (sequence data not shown, Southern blot of individuals homozygous for enlarged alleles shown in Fig. 6 ). In all four individuals, the CTC13 repeat at the CTG18.1 locus remained stable.

Allele frequencies of CTG18.1

Allele frequencies were compared among the bipolar and CEPH pedigrees. There were 96 unrelated individuals from the 48 bipolar disorder families and 56 unaffected individuals from the CEPH pedigrees. There was no significant difference between the distribution of enlarged alleles in affected and unaffected individuals from the bipolar disorder pedigrees (Fig. 5 ). The majority (185 of 192) of chromosomes had alleles within the stable CTG10 to CTG37 range and seven of 192 chromosomes had alleles >CTG86. The CTG18.1 allele distribution in 56 unrelated CEPH individuals is similar to that of the bipolar population, where stable alleles are within the CTG11 to CTG37 range and all alleles >CTG53 are unstable. Among the CTG53 and CTG48 alleles, we only observed transmission of the CTG53 allele (the CTG48 was not transmitted) and it was unstable in two of six transmissions. There was no difference in overall allele frequencies between CEPH reference pedigrees and our pedigrees ascertained for bipolar disorder. In addition, the frequency of moderately expanded alleles (CTG53-CTG250) was not statistically significant between CEPH and JHU bipolar disorder pedigrees (2.7 and 3.6%, respectively). The observed heterozygosity (84%) at the CTG18.1 locus was the same in both populations.


Figure 5. 7,6A allele frequency in CEPH and bipolar pedigrees. Allele distribution is based on CTG18.1 PCR data from 96 unrelated individuals (192 chromosomes) from 48 families ascertained for a JHU linkage study on bipolar disorder. There are seven chromosomes with >CTG86 repeats (four with bipolar disorder and three from unaffected individuals). Allele frequency data in CEPH pedigrees is based on CTG18.1 PCR data from 58 unrelated CEPH individuals (116 chromosomes). The broken line indicates non-linearity between CTG120 and CTG250.


Figure 6. Very enlarged CTG18.1 alleles in bipolar pedigrees. Southern blot of genomic digests probed with a random labeled 1.3 kb 7,6A fragment excluding the CTG18.1 locus. Stable alleles (~1.6 kb), moderately enlarged alleles (~1.9 kb), and very enlarged alleles (~4-8 kb), correspond in these pedigrees to putative CTGn of CTG11-24, CTG87-250, and CTG800-2100, respectively. This blot reveals a very enlarged allele in 117-001 that is not transmitted, plus a very enlarged allele that is transmitted from grandfather (118-008) to son (118-005). These very enlarged alleles were not detected in PCR based assays. Both 117-002 and 117-001 are homozygous for moderately expanded alleles (~1.9 kb) and 117-001 transmits this allele to all four offspring in lanes 013, 014, 015, and 016. The restriction digest in the grandmother (117-007) was incomplete, and there was no DNA available from the grandfather. Mosaicism of enlarged alleles is seen in 117-002, 117-003, 117-013, and 118-005.

Southern blots of genomic digests

A very large (~3.3 kb) polymorphic CTGn RED expansion was reported in one affected individual from a Danish schizophrenia pedigree and mapped by FISH to chromosome 18 (34 ; Sirugo et al., submitted). This locus was subsequently found to be CTG18.1 via hybridization of a random labeled 1.3 kb fragment (bp 249-1546 of 7,6A) that did not include the CTG24 repeat region of 7,6A to Southern blots of genomic digests used by Sirugo et al. (unpublished data). Based on data indicating the CTG18.1 locus of 7,6A was greatly expanded in this individual, we performed Southern blots of genomic DNA from 31 individuals from pedigrees with moderately expanded alleles that had been detected via PCR, and found very enlarged alleles in three of these individuals from our bipolar pedigrees. These very large CTG18.1 alleles were not visible on PCR gels, and could only be detected by Southern blot analysis of genomic digests. Attempts to subclone the very enlarged alleles have been unsuccessful; thus, it is not possible to state with certainty that they result entirely from CTG expansions. However, the unstable, vertical transmission of very enlarged alleles is consistent with CTG repeat expansions at this locus.

Southern blots of genomic digests from JHU bipolar pedigrees 117 and 118 are shown in Figure 6 . The very large alleles ranged from ~4 to 8 kb, corresponding to putative CTG repeat lengths of CTG800-CTG2100 segregated independently of the bipolar phenotype. There was no DNA available from the grandfather for performing a restriction digest and the digest for the grandmother (117-007) was incomplete. Individuals 117-002 and 117-001 were homozygous for moderately expanded alleles (~1.9 kb), which were transmitted to all four offspring of 117-001 in lanes 013, 014, 015 and 016. In addition, 117-001 has a very enlarged allele (~6 kb), corresponding to a putative allele of ~CTG1500 that was not transmitted to his offspring. The genomic digest in JHU BP 118 confirms the stable and moderately large, unstable allele data obtained from southern blots of the CTG18.1 PCR products described in Figure 4 . The genomic digest also revealed very enlarged alleles (~4-8 kb) that were transmitted from grandfather (118-008) to son (118-005). Considerable mosaicism of enlarged alleles is seen in 117-002, 117-003, 117-013 and 118-005 (Fig. 6 ).

DISCUSSION

The CTG18.1 locus of clone 7,6A is the second very large expanded CTG repeat (after the myotonic dystrophy repeat) to be identified and the first very large CTG repeat without an obvious abnormal phenotype. The CTG18.1 repeat is located 803 bp 5' from a 73 bp region of clone 7,6A that shares 100% identity with bp 271-344 of the human SEF2-1 cDNA. The SEF2-1 gene encodes a protein belonging to a family of basic helix-loop-helix (b-HLH) transcriptional activator nuclear proteins (35 ). These proteins enhance transcription by recognizing and binding to promoters containing the E box motif CANNTG (35 -38 ). The SEF2-1 gene has homologues in dog and mouse, and is expressed in a wide variety of tissue including muscle, brain, hematopoietic cells and liver (37 ).

SEF2-1 (E2-2), together with E2A (E12/E47) and HEB, belong to the E protein class of bHLH proteins. Most tissue-specific bHLH proteins that control various differentiation events bind preferentially to DNA as heterodimers with an E protein. The E proteins show a large functional overlap, but mice with a null mutation of any one of these genes show postnatal lethality and defective B lymphocyte development (39 ). Analysis of the mouse SEF2-1 gene has shown that it contains 22 exons and many of the introns are >10 kb long (Corneliussen et al., unpublished data).

Instability is a hallmark of trinucleotide repeat mutations and is characterized by an expansion or contraction in the number of repeats at a particular locus during vertical transmission from one generation to the next (2 ,3 ). While the mechanisms of triplet repeat instability remain unclear, possible contributions include polymerase slippage, DNA secondary structure, chromatin structure and triplex DNA formations (2 ,45 ,46 ). There are cases, however, when triplet repeat expansion is not associated with disease. For example, loci have been described (such as in FRAXF and FRA16) with polymorphic CGGn sequences that cytogenetically demonstrate fragile sites but are not associated with a clinical phenotype (47 ,48 ). Several hypotheses can be generated to explain why the CTG18.1 expansion mutation is tolerated in the pedigrees we characterized. It is possible that the intronically located CTG18.1 expansion mutation may not interfere with intron/exon splice junctions, and therefore may not have any effect on SEF2-1 expression or function. Alternatively, the expansion mutation may be responsible for one of the functional splice variant forms of SEF2-1 already known to exist. Lastly, there may be an as yet undiscovered phenotype for this mutation.

In clone 7,6A there is a stable CTC13 motif flanking the CTG24 repeat. Similar small repeat motifs flanking unstable CAG glutamine encoding repeats have been found in the HD and DRPLA genes and encode proline and proline-serine repeats, respectively (2 ). The significance of the intronically located CTC13 motif of clone 7,6A, if any, remains to be determined. Determination of the nucleotide sequence of intron 3 of the mouse SEF2-1 gene showed that the CTG24 repeat was much shorter in the mouse intron; however, the fact that a CTG repeat exists in the mouse indicates that the presence of the CTG rich region in this gene is old evolutionarily, despite the high polymorphism of the human CTG repeat.

The CTG24 repeat (locus CTG18.1) found in clone 7,6A is highly polymorphic and has moderately enlarged, unstable alleles in ~3% of the CEPH and bipolar populations we studied. Our data show a wide CTG18.1 allelic distribution ranging from stable alleles (CTG10-CTG37), moderately large and unstable alleles (CTG53-CTG250), to very enlarged alleles (CTG800-CTG2100). Preliminary data suggest that CTG18.1 identifies one of the multiple polymorphic CTGn loci that are identified by RED. Two of three CEPH pedigrees initially described with enlarged RED products (30 ) show moderately enlarged CTG18.1 alleles, while the third one does not. The high frequency of moderately enlarged alleles in the population suggests that CTG18.1 may account for a significant number of enlarged CTG repeat loci previously identified by RED. There are no data in our bipolar families to suggest that CTG18.1 is responsible for a phenotype, nor is there linkage between bipolar disorder and CTG18.1. Enlarged CTG18.1 alleles segregate independently of the bipolar disorder phenotype and the individuals with enlarged alleles are in good physical health according to medical history.

Southern blot analysis of CTG18.1 PCR products and genomic digests of DNA derived from lymphoblastoid cell lines and from whole blood lymphocytes revealed diffuse or multiple bands in many of the moderately large and very large polymorphic CTG18.1 alleles-an observation consistent with somatic mosaicism. Somatic mosaicism is characterized by variable repeat lengths between different tissues or between distinct cells of the same tissue and both germline and somatic instability have been proposed as mechanisms of intergenerational triplet repeat length variability (40 ). Two cases of mosaicism were observed out of 262 individuals having the stable CTG repeat (CTG10-CTG37) alleles (data not shown). In one family, the mother had three alleles (CTG24, CTG34, CTG35), but only transmitted the CTG34 allele to her daughter. In the other pedigree, mosaicism was found in monozygotic twins. Twin one had three alleles (CTG15, CTG16, CTG17) while twin two had two alleles CTG15 and CTG17. Both results were found repeatedly with no evidence of DNA sample contamination. Sperm has not yet been examined in the male pedigree members with enlarged alleles in the populations we studied; however, such analyses would help determine the contribution of meiotic instability at this locus.

Meiotic instability has been characterized in HD and in myotonic dystrophy as evidenced by variable number of repeat lengths among sperm cells of HD and myotonic dystrophy patients (41 ,42 ). Takano et al. (43 ) found tissue-specific differences in CAG repeat lengths when comparing somatic mosaicism of polymorphic CAGn expansions in neuronal and non-neuronal tissues of patients with DRPLA and MJD. In myotonic dystrophy, polymorphic CTGn expansions found in leukocytes were often not predictive of expansions in other tissues (46 ). We currently have data only on DNA isolated from lymphoblastoid cell lines and lymphocytes derived from whole blood; therefore, it is not known if the CTG18.1 locus is expanded in other tissues.

CTG18.1 is the first reported polymorphic CTG repeat locus to show significant enlargement across generations without an obvious abnormal phenotype. Although preliminary data suggest the intronically located CTG24 repeat of 7,6A is capable of expanding up to CTG800-CTG2100, it is not yet known if this expansion causes a phenotype or to what effect, if any, these very large expansions have on SEF2-1 function and expression. Should a phenotype become associated with expansions of the polymorphic CTG24 at the CTG18.1 locus, it is unlikely to be severe given the degree of expansion found in individuals with and without the bipolar phenotype who are otherwise in good physical health.

In conclusion, the locus identified by CTG18.1 represents an unstable polymorphic CTG repeat that maps to chromosome 18q21.1 and is located within an intron of the SEF2-1 gene. The frequency of the moderately enlarged CTGn allele is ~3% in populations of northern European ancestry. It is not linked to bipolar disorder, nor are the enlarged alleles associated with illness. Further study of CTG18.1 has the potential to improve our understanding of how trinucleotide repeats influence neighboring genes and may ultimately provide clues as to the mechanisms by which they enlarge.

MATERIALS AND METHODS

Cloning

A human genomic library from a male skin fibroblast HSF7 cell line specific for chromosome 18 was procured from American Type Culture Collection (ATCC 57742). The library, housed in the phage vector Charon 21A with an EcoRI restriction site, contained ~85% chromosome 18 fragments, with an average insert size of 4 kb. The library was probed with a CAG15 oligonucleotide end labeled by T4 kinase with [[gamma]-32P]ATP. Once the 7,6A 1.6 kb insert was identified it was amplified via PCR using primers flanking the Charon 21A EcoRI restriction site (49 ). A total of 50-100 ng of the Charon 21A clone 7,6A was amplified in a 25 [mu]l reaction with a final concentration of 1.5 mM MgCl2, 520 [mu]M dNTPs, 0.8 [mu]M of each primer, and 1 U Taq polymerase (Boehringer Mannheim). The cycling conditions were as follows: a 3 min denaturation at 95oC, followed by 35 cycles of 95oC denaturation for 1 min, 50oC annealing for 1 min, and a 72oC extension for 9 min. The 7,6A insert was subcloned into the T/A cloning PCRII vector (Invitrogen) and subsequently sequenced at the Johns Hopkins Genetics CORE Facility.

PCR conditions and Southern blotting

PCR spanning the CTG18.1 locus of 7,6A (Fig. 1 B, primers 1a and 1b) was carried out in 25 [mu]l reaction volume with 80 ng genomic DNA, 0.8 mM MgCl2, 200 [mu]M dNTPs, 1.2 [mu]M of each primer, with one primer labeled with [[gamma]-32P]ATP, and 1.0 U Taq polymerase (Boehringer Mannheim). To better detect enlarged (>CTG86) alleles not readily visible after labeled PCR products were subjected to 6% PAGE, unlabeled PCR products were subjected to 6% PAGE, transferred by capillary action overnight onto Genescreen Plus nylon filter paper (NEN DuPont) and probed with a CAG15 oligonucleotide radiolabeled with [[gamma]-32P]ATP. Probe hybridization was carried out in Rapid Hyb Buffer (Amersham) at 56oC, washed initially in 2* SSC/0.05% SDS at room temperature and 56oC, then washed in 0.2* SSC/0.05% SDS at 65oC.

Expression analysis

To determine if 7,6A was in a coding region of 18q.21, we employed standard Northern analysis, RT-PCR, standard open reading frame (ORF) analysis, and BLAST and Grail searches of GenBank. Northern analysis was carried out on total RNA isolated from human amygdala, frontal cortex, and liver as well as commercially purchased (Clontech) total and Poly(A)+ mRNA isolated from adult and fetal whole brains. Approximately 20 [mu]g of total RNA [and 2.5 [mu]g of Poly(A)+ mRNA] was electrophoretically separated on a 1% formaldehyde gel, blotted onto Genescreen Plus nylon filter paper (NEN DuPont), and probed with sense and anti-sense 45mer oligonucleotides (bp 69-113 and bp 474-518) flanking the CTG24 repeat of 7,6A. Northern blots were hybridized at 48oC, washed in 2* SSC/0.05% SDS at room temperature, 42oC, and then washed in 0.2* SSC/0.05% SDS at 56oC. RT-PCR was performed on cDNA derived from whole brain, frontal cortex, amygdala, and liver total RNA with a combination of oligo-dt and random hexamer priming to generate the cDNA (Gibco-BRL). Comparison with the mouse SEF2-1 gene was performed with the GCG program GAP.

Detection of very enlarged alleles

Restriction digests of genomic DNA from JHU bipolar disorder pedigrees were performed in 70 [mu]l reaction volumes with 15 [mu]g of genomic DNA and 40 U EcoRI (Gibco-BRL) incubated at 37oC overnight. Genomic digests were electrophoretically separated on 1% agarose gels, transferred onto Genescreen Plus nylon filter paper (NEN DuPont), and probed with a random labeled [[alpha]-32P]dCTP 1.3 kb fragment of 7,6A (bp 249-1546) that did not include the polymorphic CTG24 repeat (Fig. 1 B). Probe hybridization was carried out in Rapid Hyb Buffer (Amersham) at 60oC, washed initially in 2* SSC/0.05% SDS at room temperature and 60oC, then washed in 0.2* SSC/0.05% SDS at 60oC.

ACKNOWLEDGEMENTS

We wish to thank the staff and research assistants of the bipolar affective disorders study for their contributions in pedigree ascertainment and data collection. We are grateful to the cell culture and DNA extraction group and to Robert Morreale of the JHU Path Photo facility. This work was funded by NIMH MH01088 to M. G. McInnis. The Charles A. Dana Foundation and NIH MH54701 to J.R. DePaulo funded the ascertainment of the bipolar families and DNA collection. Other support was provided by MH50763 to C.A. Ross, MH02175 to R.L. Margolis, MH50390 to K.K. Kidd, and by the Swedish Cancer Society (2235-B96-11XCC) to T. Grundstrom.

REFERENCES

1 McInnis,M.G. (1996) Anticipation-an old idea in new genes. Am. J. Hum. Genet., 59, 973-979. MEDLINE Abstract

2 Ross,C.A. (1995) When more is less: pathenogenesis of glutamine repeat neurodegenerative diseases. Neuron, 15, 493-496. MEDLINE Abstract

3 Warren,S.T. (1996) The expanding world of trinucleotide repeats. Science, 271, 1374-1375. MEDLINE Abstract

4 Taneja,K.L., McCurrach,M., Schalling,M., Housman,D., Singer,R.H. (1995) Foci of trinucleotide repeat transcripts in nuclei of myotonic dystrophy cells and tissues. J. Cell Biol., 128, 995-1002. MEDLINE Abstract

5 Fu,Y.H., Pizzuti,A., Fenwick,R.G.J., King,J., Rajnarayan,S., Dunne,P.W., Dubel,J., Nasser,G.A., Ashizawa,T., de Jong,P., Wieringa,B., Korneluk,R., Perryman,M.B., Epstein,H.F., Caskey,C.T. (1992) An unstable triplet repeat in a gene related to myotonic muscular dystrophy. Science, 255, 1256-1258. MEDLINE Abstract

6 Campuzano,V., Montermini,L., Molto,M.D., Pianese,L., Cossee,M., CavalcantiF, Monros,E., Rodius,F., Duclos,F., Monticelli,A., et al. (1996) Friedreich's ataxia: autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science, 271, 1423-1427. MEDLINE Abstract

7 Margolis,R.L., Stine,O.C., McInnis,M.G., Ranen,N.G., Rubinsztein,D.C., Leggo,J., Jones Brando,L.V., Kidwai,A.S., Loev,S.J., Breschel,T.S., Callahan,C., Simpson,S.G., DePaulo,J.R., McMahon,F.J., Jain,S., Paykel,E.S., Walsh,C., DeLisi,L.E., Crow,T.J., Torrey,E.F., Ashworth,R.G., Macke,J.P., Nathans,J., Ross,C.A. (1996) A human homologue of the C. elegans cell fate-determining gene mab-21 that contains a highly polymorphic (CAG)n trinucleotide repeat: cDNA cloning, expression, and mapping to chromosome 13q13. Hum. Mol. Genet., 21, 607-616.

8 Margolis,R.L., Breschel,T.S., Li,S.H., Kidwai,A.S., Antonarakis, SE, McInnis,M.G., Ross,C.A. (1995) Characterization of cDNA clones containing CCA trinucleotide repeats derived from human brain. Somatic Cell Mol. Genet., 21, 279-284. MEDLINE Abstract

9 Li,S.H., McInnis,M.G., Margolis,R.L., Antonarakis,S.E., Ross,C.A. (1993) Novel triplet repeat containing genes in human brain: cloning, expression, and length polymorphisms. Genomics, 16, 572-579. MEDLINE Abstract

10 Neri,C., Albanese,V., Lebre,A.S., Holbert,S., Saada,C., Bougueleret,L., Meier-Ewert,S., Le Gall,I., Millasseau,P., Bui,H., Giudicelli,C., Massart, C, Guillou,S., Gervy,P., Poullier,E., Rigault,P., Weissenbach,J., Lennon, G, Chumakov,I., Dausset,J., Lehrach,H., Cohen,D., Cann,H.M. (1996) Survey of CAG/CTG repeats in human cDNAs representing new genes: candidates for inherited neurological disorders. Hum. Mol. Genet., 5, 1001-1009. MEDLINE Abstract

11 Yamagata,H., Miki,T., Nakagawa,M., Johnson,K., Deka,R., Ogihara,T. (1996) Association of CTG repeats and the 1 kb Alu insertion/deletion polymorphism at the myotonin protein kinase gene in the Japanese population suggests a common Eurasian origin of the myotonic dystrophy mutation. Hum. Genet., 97, 145-147. MEDLINE Abstract

12 Gastier,J.M., Pulido,J.C., Sunden,S., Brody,T., Buetow,K.H., Murray,J.C., Weber,J.L., Hudson,T.J., Sheffield,V.C., Duyk,G.M. (1995) Survey of trinucleotide repeats in the human genome: assessment of their utility as genetic markers. Hum. Mol. Genet., 4, 1829-1836. MEDLINE Abstract

13 Koide,R., Ikeuchi,T., Onorodera,O., Tanaka,H., Igarashi,S., Endo,E., Takahashi,H., Kondo,R., Ishikawa,A., Hayashi,T., Saito,M., Tomoda,A., Miike,T., Naito,H., Ikuta,F., Tsuji,S. (1994) Unstable expansion of CAG repeat in hereditary dentatorubral pallidoluysian atrophy (DRPLA). Nature Genet., 6, 9-12. MEDLINE Abstract

14 Nagafuchi,S., Yanagisawa,H., Ohsaki,E., Shirayama,T., Tadokoro,K., Inoue, T, Yamada,M. (1994) Structure and expression of the gene responsible for the triplet repeat disorder, dentatorubral and pallidoluysian atrophy (DRPLA). Nature Genet., 8, 177-182. MEDLINE Abstract

15 Imbert,G., Saudou,F., Yvert,G., Devys,D., Trottier,Y., Garnier,J.M., Weber, C, Mandel,J.L., Cancel,G., Abbas,N., Durr,A., Didierjean,O., Stevanin,G., Agid,Y., Brice,A. (1996) Cloning of the gene for spinocerebellar ataxia 2 reveals a locus with high sensitivity to expanded CAG/glutamine repeats. Nature Genet., 14, 285-291. MEDLINE Abstract

16 Zhuchenko,O., Bailey,J., Bonnen,P., Ashizawa,T., Stockton,D.W., Amos,C., Dobyns,W.B., Subramony,S.H., Zoghbi,H.Y., Lee,C.C. (1997) Autosomal dominant cerebellar ataxia (SCA6) associated with small polyglutamine expansions in the alpha 1A-voltage-dependent calcium channel. Nature Genet., 15, 62-69. MEDLINE Abstract

17 Riggins,G.J., Lokey,L.K., Chastain,J.L., Leiner,H.A., Sherman,S.L., Wilkinson,K.D., Warren,S.T. (1992) Human genes containing polymorphic trinucleotide repeats. Nature Genet., 2, 186-191. MEDLINE Abstract

18 Gastier,J.M., Brody,T., Pulido,J.C., Businga,T., Sunden,S., Hu,X., Maitra,S., Buetow,K.H., Murray,J.C., Sheffield,V.C., Boguski,M., Duyk,G.M., Hudson,T.J. (1996) Development of a screening set for new (CAG/CTG)n dynamic mutations. Genomics, 32, 75-85. MEDLINE Abstract

19 O'Donovan,M.C., Guy,C., Craddock,N., Murphy,K.C., Cardno,A.G., Jones,L.A., Owen,M.J., McGuffin,P. (1995) Expanded CAG repeats in schizophrenia and bipolar disorder. Nature Genet., 10, 380-381. MEDLINE Abstract

20 Lindblad,K., Nylander,P.O., DeBruyn,A., Souery,D., Zander,C., Engstrom,C., Holmgren,G., Hudson,T., Chotai,J., Mendlewicz,J., Van Broeckhoven,C., Schalling,M., Adolfsson,R. (1995) Detection of expanded CAG repeats in Bipolar Affective Disorder using the repeat exapnsion detection (RED) method. Neurobiol. Disease, 2, 55-62.

21 Sirugo,G., Deinhard,A.S., Kidd,J.R., Kidd,K.K. (1997) Survey of maximum CTG/CAG repeat lengths in humans and non-human primates: total genome scan in populations using the Repeat Expansion Detection Method. Hum. Mol. Genet., 6, 403-408. MEDLINE Abstract

22 Risch,N., Botstein,D. (1996) A manic depressive history. Nature Genet., 12, 351-353. MEDLINE Abstract

23 Berrettini,W.H., Ferraro,T.N., Goldin,L.R., Weeks,D.E., Detera-Wadleigh,S., Nurnberger,J.I.,Jr., Gershon,E.S. (1994) Chromosome 18 DNA markers and manic-depressive illness: evidence for a susceptibility gene. Proc. Natl. Acad. Sci. USA, 91, 5918-5921. MEDLINE Abstract

24 Stine,O.C., Xu,J., Koskela,R., McMahon,F.J., Gschwend,M., Friddle,C., Clark,C.D., McInnis,M.G., Simpson,S.G., Breschel,T.S., Vishio,E., Riskin,K., Feilotter,H., Chen,E., Chen,S., Folstein,S.E., Meyers,D.A., Botstein,D., Marr,T.G., DePaulo,J.R. (1995) Evidence for linkage of bipolar disorder to chromsome 18 with a parent-of-origin effect. Am. J. Hum. Genet., 57, 1384-1394. MEDLINE Abstract

25 Freimer,N.B., Reus,V.I., Escamilla,M.A., McInnes,L.A., Spesny,M., Leon,P., Service,S.K., Smith,L.B., Silva,S., Rojas,E., Gallegos,A., Meza,L., Fournier,E., Baharloo,S., Blankenship,K., Tyler,D.J., Batki,S., Vinogradov,S., Weissenbach,J., Barondes,S.H., Sandkuijl,L.A. (1996) Genetic mapping using haplotype, association and linkage methods suggests a locus for severe bipolar disorder (BPI) at 18q22-q23. Nature Genet., 12, 436-441. MEDLINE Abstract

26 McInnis,M.G., McMahon,F.J., Chase,G., Simpson,S.G., Ross,C.A., DePaulo,J.R.,Jr. (1993) Anticipation in bipolar affective disorder. Am. J. Hum. Genet., 53, 385-390. MEDLINE Abstract

27 Ross,C.A., McInnis,M.G., Margolis,R.L., Li,S.H. (1993) Genes with triplet repeats: candidate mediators of neuropsychiatric disorders. Trends Neurosci., 16, 254-260. MEDLINE Abstract

28 Henthorn,P., Kiledjian,M., Kadesch,T. (1990) Two distinct transcription factors that bind the immunoglobulin enhancer microE5/kappa 2 motif. Science, 247, 467-470. MEDLINE Abstract

29 Lathrop,G.M., Lalouel,J.M., Julier,C., Ott,J. (1984) Strategies for multilocus linkage analysis in humans. Proc. Natl. Acad. Sci. USA, 81, 3443-3446. MEDLINE Abstract

30 Schalling,M., Hudson,T.J., Buetow,K., Housman,D.E. (1993) Direct detection of novel expanded trinucleotide repeats in the human genome. Nature Genet., 4, 135-139. MEDLINE Abstract

31 Simpson,S.G., Folstein,S.E., Meyers,D.A., DePaulo,J.R. (1992) Assessment of lineality in bipolar I linkage studies. Am. J. Psychiatry, 149, 1660-1665. MEDLINE Abstract

32 Spitzer,R.L., Endicott,J., Robins,E. (1975) Research Diagnostic Criteria for a Selected Group of Functional Disorders. New York, Biometrics Research.

33 Endicott,J., Spitzer,R.L. (1978) A diagnostic interview: The schedule for affective disorders and schizophrenia. Arch. Gen. Psychiatry, 35, 837-844.

34 Haaf,T., Sirugo,G., Kidd,K.K., Ward,D.C. (1996) Chromosomal localization of long trinucleotide repeats in the human genome by fluorescence in situ hybridization. Nature Genet., 12, 183-185. MEDLINE Abstract

35 Corneliussen,B., Thornell,A., Hallberg,B., Grundstrom,T. (1991) Helix-loop-helix transcriptional activators bind to a sequence in glucocorticoid response elements of retrovirus enhancers. J. Virol., 65, 6084-6093. MEDLINE Abstract

36 Javaux,F., Donda,A., Vassart,G., Christophe,D. (1991) Cloning and sequence analysis of TFE, a helix-loop-helix transcription factor able to recognize the thyroglobulin gene promoter in vitro. Nucleic Acids Res., 19, 1121-1127. MEDLINE Abstract

37 Skerjanc,I.S., Truong,J., Filion,P., Mcburney,M.W. (1996) A splice variant of the ITF-2 transcript encodes a transcription factor that inhibits MyoD activity. J. Biol. Chem., 271, 3555-3561. MEDLINE Abstract

38 Murre,C., McCaw,P.S., Baltimore,D. (1989) A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myoC proteins. Cell, 56, 777-783. MEDLINE Abstract

39 Zhuang,Y., Cheng,P., Weintraub,H. (1996) B-lymphocyte development is regulated by the combined dosage of three basic helix-loop-helix genes, E2A, E2-2, and HEB. Mol. Cell. Biol., 16, 2898-2905. MEDLINE Abstract

40 Wong,L.J., Ashizawa,T., Monckton,D.G., Caskey,C.T., Richards,C.S. (1995) Somatic heterogeneity of the CTG repeat in myotonic dystrophy is age and size dependent. Am. J. Hum. Genet., 56, 114-122. MEDLINE Abstract

41 Jansen,G., Willems,P., Coerwinkel,M., Nillesen,W., Smeets,H., Vits,L., Howeler,C., Brunner,H., Wieringa,B. (1994) Gonosomal mosaicism in myotonic dystrophy patients: involvement of mitotic events in (CTG)n repeat variation and selection against extreme expansion in sperm. Am. J. Hum. Genet., 54, 575-585. MEDLINE Abstract

42 Leeflang,E.P., Zhang,L., Tavare,S., Hubert,R., Srinidhi,J., MacDonald,M.E., Myers,R.H., de Young,M., Wexler,N.S., Gusella,J.F., et al. (1995) Single sperm analysis of the trinucleotide repeats in the Huntington's disease gene: quantification of the mutation frequency spectrum. Hum. Mol. Genet., 4, 1519-1526. MEDLINE Abstract

43 Takano,H., Onodera,O., Takahashi,H., Igarashi,S., Yamada,M., Oyake,M., Ikeuchi,T., Koide,R., Tanaka,H., Iwabuchi,K., Tsuji,S. (1996) Somatic mosaicism of expanded CAG repeats in brains of patients with dentatorubral-pallidoluysian atrophy: cellular population-dependent dynamics of mitotic instability. Am. J. Hum. Genet., 58, 1212-1222. MEDLINE Abstract

44 Thornton,C.A., Johnson,K., Moxley,R.T. (1994) Myotonic dystrophy patients have larger CTG expansions in skeletal muscle than in leukocytes. Ann. Neurol., 35, 104-107. MEDLINE Abstract

45 Longshore,J.W., Tarleton,J. (1996) Dynamic mutations, trinucleotide repeats, microsatellite instability. Dynamic mutations in human genes-A review of trinucleotide repeat diseases. J. Genet., 75, 193-217.

46 Tsuji,S. (1997) Molecular genetics of triplet repeats - Unstable expansion of triplet repeats as a new mechanism for neurodegenerative diseases. Intern. Med., 36, 3-8. MEDLINE Abstract

47 Parrish,J.E., Oostra,B.A., Verkerk,A.J., Richards,C.S., Reynolds,J., Spikes,A.S., Shaffer,L.G., Nelson,D.L. (1994) Isolation of a GCC repeat showing expansion in FRAXF, a fragile site distal to FRAXA and FRAXE. Nature Genet., 8, 229-235. MEDLINE Abstract

48 Jones,C., Slijepcevic,P., Marsh,S., Baker,E., Langdon,W.Y., Richards,R.I., Tunnacliffe,A. (1994) Physical linkage of the fragile site FRA11B and a Jacobsen syndrome chromosome deletion breakpoint in 11q23.3. Hum. Mol. Genet., 3, 2123-2130. MEDLINE Abstract

49 Burde,S., Leary,J.F. (1992) Detection of individual human chromosomes by chromosome in situ suppression hybridization using PCR-amplified bacteriophage library probes. Genet. Anal. Tech. Appl., 9, 64-67. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +1 410 614 0991; Fax: +1 410 614 1530; Email: mmcinnis@jhu.edu
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Arch NeurolHome page
A. Brusco, C. Gellera, C. Cagnoli, A. Saluto, A. Castucci, C. Michielotto, V. Fetoni, C. Mariotti, N. Migone, S. Di Donato, et al.
Molecular Genetics of Hereditary Spinocerebellar Ataxia: Mutation Analysis of Spinocerebellar Ataxia Genes and CAG/CTG Repeat Expansion Detection in 225 Italian Families
Arch Neurol, May 1, 2004; 61(5): 727 - 733.
[Abstract] [Full Text] [PDF]


Home page
J. Neurol. Neurosurg. PsychiatryHome page
I Vuillaume, P Meynieu, S Schraen-Maschke, A Destée, and B Sablonnière
Absence of unidentified CAG repeat expansion in patients with Huntington's disease-like phenotype
J. Neurol. Neurosurg. Psychiatry, May 1, 2000; 68(5): 672 - 675.
[Abstract] [Full Text]


Home page
Arch Gen PsychiatryHome page
R. L. Margolis, M. G. McInnis, A. Rosenblatt, and C. A. Ross
Trinucleotide Repeat Expansion and Neuropsychiatric Disease
Arch Gen Psychiatry, November 1, 1999; 56(11): 1019 - 1031.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (54)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Breschel, T. S.
Right arrow Articles by Ross, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Breschel, T. S.
Right arrow Articles by Ross, C. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?