Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Sathasivam, K.
Right arrow Articles by Bates, G. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sathasivam, K.
Right arrow Articles by Bates, G. P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 2141-2149  

Aberrant processing of the Fugu HD (FrHD) mRNA in mouse cells and in transgenic mice
Introduction
Results
   Expression profile of the FrHD gene
   The FrHD gene is expressed from its own promoter in mouse cells
   Generation of mice transgenic for FrHD
   Expression of the FrHD gene in mouse in vivo and in vitro
Discussion
Materials And Methods
   Generation and characterisation of L-cell transfectants and transgenic mice
   Expression analysis
   DNA sequencing
Acknowledgements
References

Aberrant processing of the Fugu HD (FrHD) mRNA in mouse cells and in transgenic mice

Aberrant processing of the Fugu HD (FrHD) mRNA in mouse cells and in transgenic mice

Kirupa Sathasivam, Sarah Baxendale1, Laura Mangiarini, Fabien Bertaux, Colin Hetherington2, Ichiro Kanazawa3, Hans Lehrach4, Gillian P. Bates*

Division of Medical and Molecular Genetics, UMDS, Guy's Hospital, London SE1 9RT, UK, 1CRC Research Centre, Paterson Institute for Cancer Research, Manchester M20 9BX, UK, 2Biomedical Services, John Radcliffe Hospital, University of Oxford, Oxford OX3 9DU, UK, 3Institute for Brain Research, University of Tokyo, Tokyo 113, Japan and 4Max Planck Institut fur Molekulare Genetik, Berlin (Dahlem), Germany

Received July 21, 1997; Accepted September 3, 1997

The puffer fish (Fugu rubripes) has a compact genome of 400 Mbp which is ~7.5-fold smaller than the human genome. It contains a similar number of genes but is deficient in intergenic, intronic and dispersed repetitive sequences. Fugu is becoming established as the model vertebrate genome for the identification and characterisation of novel human genes and conserved regulatory sequences. It has also been proposed that Fugu genes may provide natural mini-genes for the production of transgenic mice. We have used the Fugu homologue of the Huntington's disease (HD) gene to test this possibility. The human and Fugu HD genes cover 170 kb and 23 kb respectively and have previously been sequenced in their entirety. In Fugu tissue, the Fugu HD gene was found to be expressed as predicted from the gene sequence but three differentially spliced forms were also detected. Despite the absence of conserved promoter sequences, the Fugu promoter was found to be functional in mouse cells. We have generated mice transgenic for the Fugu HD gene and conducted a detailed expression analysis across the entire 10 kb transcript. This revealed the presence of many aberrant splice forms which would be incompatible with the production of the Fugu huntingtin protein. The Fugu HD gene is incorrectly processed in mouse cells both in vitro and in vivo which sheds doubt on the usefulness of Fugu genes for transgenesis.

INTRODUCTION

Brenner et al. have recently proposed that the pufferfish (Fugu rubripes) provides an ideal model vertebrate for the discovery of human genes (1). A random sequencing approach combined with gene probing was used to demonstrate that the organism has a compact genome with a haploid content of 400 Mb (7.5-fold smaller than the human genome). This analysis predicted an equivalent amount of coding DNA (corresponding to a similar number of genes), implying that the smaller size is due to a reduction in intronic and intergenic sequences. All forms of repetitive DNA make up <10% of the Fugu genome and there are no abundant classes of dispersed repeats. It is anticipated that a comparison of the Fugu and human genomes would maximise the evolutionary distance between two vertebrate genomes and that conserved sequences are likely to have a functional or structural importance (1).

A more detailed characterisation of the Fugu genome is emerging from the initial comparative sequencing projects (2,3). Sequence comparison has been possible across the entire gene in the case of Huntington's disease (HD) (4), glucose-6-phosphate dehydrogenase (G6PD) (5) and tuberous sclerosis 2 (TSC2) (6). The intron-exon organisation was found to be very well conserved with a complete conservation of intron-exon boundaries. In the case of TSC2 the intron-exon structure as predicted in Fugu helped to identify the novel alternatively spliced exon 31 in humans and the same pattern of alternative splicing was observed for exons 25 and 31 between the human and Fugu TSC2 genes (6). The Fugu gene was smaller in all cases: by 2.5-fold for TSC2, 4-fold for G6PD and 7.5-fold for HD as a consequence of smaller intron size. However, there are notable exceptions to this rule, e.g., the dopamine receptor homologues in which the intron sizes are comparable between human and Fugu, the significance of which is unknown (7). The Fugu genome is amenable to the study of gene families, which because of the small intron size can be isolated readily from genomic DNA by PCR, e.g. the actin genes (8) and Hox clusters (9). Although the size of the conserved linkage groups between Fugu and human have not yet been determined, short-range conserved synteny has been established for a number of adjacent Fugu genes (2). With a predicted gene density of one gene per 7 kb, the Fugu genome will clearly be important in the identification of novel genes.

Comparative sequence analysis between the Fugu and mammalian genomes should also be useful in pinpointing the position of sequences important in the control of gene expression. This approach has been successful in the discovery of poorly mapped enhancers in the Hox-b cluster (10). The hox genes are tightly regulated and it is not surprising that the control elements are highly conserved. It is difficult to predict the degree of similarity between the factors that control ubiquitously expressed genes, and indeed Fugu housekeeping genes do not possess classical CpG islands. The CpG content of the Fugu genome (0.5 of that expected) lies between human (0.2 of that expected) and Drosophila (expected CpG content). Generally, the CpG content does not appear to be raised at the 5[prime] end of Fugu genes, and, although there are isolated regions throughout genes that have raised CpG values, these may reflect the codon bias in the GC rich exons (2,11).


Figure 1 Expression analysis of the FrHD gene. (a) Northern blot showing the presence of FrHD mRNA in a range of tissues. The RT-PCR product containing exons 8-13 was used as a probe. In all tissues other than muscle, there was evidence of a doublet of ~10 kb. We did not have a Fugu gene probe to control for the amount of RNA loaded into each lane. However, ethidium bromide staining suggests an equivalent amount per lane. The mouse GAPDH probe gave strong signals in muscle, skin and gut and very weak signals in brain, liver and testis (data not shown). (b) RT-PCR products amplified with primers located in exons 8-13 from Fugu RNA. Upper panel: 2.5% agarose gel showing two products of 869 and 840 bp obtained in all tissues. This corresponds to the predicted fragment of 840 bp and an additional larger fragment. Lower panel: Southern blot of the agarose gel probed with an oligonucleotide from exon 12. (c) 3[prime] RACE products fractionated on a 3% agarose gel demonstrating the use of polyadenylation signals at positions 26080 and 27410 in the genomic sequence in all Fugu tissues tested. An additional 3[prime] RACE product was also consistently identified in brain corresponding to the presence of a further signal downstream of 26080. B, brain; G, gut; L, liver; M, muscle; S, skin; T, testis; W, water; P, [phis]X HaeIII size markers.


The HD gene was one of the first genes for which a sequence comparison between human and Fugu homologues has been conducted (4). The human gene covers 170 kb and contains 67 exons (12). The HD mutation is a CAG/polyglutamine expansion located in exon 1 (13) with normal and expanded allele sizes of 6-39 and 35-180 respectively. Two ubiquitously expressed transcripts of 10 366 bp and 13 711 bp have been identified arising through differential polyadenylation (14) and there is no hard evidence for alternative splicing. The transcript is expressed in every foetal and adult tissue examined (15-17) and Western analysis has shown the expanded CAG repeats to be translated (18-20). The normal function of the protein is not known although, within neurons, immunocytochemistry suggests a cytoplasmic localisation and a possible association with synaptic vesicles (19,21,22). The mutation causes a late onset neurodegenerative disease and is thought to act by a dominant gain of function. This is supported by the isolation of a monoclonal antibody (1C2) that specifically recognises polyglutamine expansions, consistent with a conformational change occurring once the expansion has crossed a size threshold (23). Similarly, mice that are transgenic for the HD mutation (24) develop a progressive neurological phenotype, the cellular basis of which has been shown to be the formation of novel neuronal intranuclear inclusions that are immunoreactive for antibodies directed against the transgene protein (25).

The Fugu homologue of the HD gene (FrHD) covers 23 kb, which is 7.4-fold smaller than the human gene (170 kb) and is consistent with the relative genome sizes. All 67 exons and the exon-intron boundaries are conserved and the coding region is 69% identical at the nucleotide level (4). The exons are of a comparable size to the human exons but the intronic regions are considerably smaller, ranging from 47 to 1476 bp in Fugu compared with 131 to 12 286 bp in human. In four cases the Fugu introns were larger than the corresponding human introns which may imply an unknown functional constraint. The glutamine repeat is also conserved and encoded by (CAG)2(CAA)2 compared with (CAG)2CAA(CAG)4 in mouse (26,27), (CAG)2CAA(CAG)5 in the rat (28) and (CAG)6-39CAACAG in humans (13). Comparison of the coding sequences uncovered five regions with >80% identity at the nucleotide level, including the N-terminus containing the polyglutamine repeat. However, this degree of homology was insufficient to pinpoint functional domains. The 5[prime] and 3[prime] untranslated regions were less well conserved. The Fugu gene has three potential polyadenylation signals suggesting that, as in humans, differential polyadenylation could generate more than one transcript.

One possible further application of Fugu genes is their use in transgenic mouse assays (11). DNA for transgenesis can be introduced either as a cDNA construct under the control of an appropriate promoter, or as a genomic fragment including endogenous control elements. Transgenes introduced as cDNAs are often poorly expressed or inappropriately regulated and lack sequences needed to generate alternatively spliced or differentially polyadenylated transcripts. However, the large size of many human genes necessitates that they be manipulated and introduced into the mouse germ line in the form of a YAC clone (29). Preparation of these constructs often requires a number of sequential homologous recombination steps and care must be taken in handling these large DNA molecules. Fugu genes may provide natural minigenes which could be introduced in the form of a cosmid clone making the preparation and manipulation of the constructs correspondingly more straightforward whilst retaining many of the advantages of working with a genomic clone. We set out to use the well characterised Fugu HD gene (FrHD) to test the use of Fugu genes for murine transgenesis.

Table 1 Summary of the PCR primers used in the RT PCR and polyadenylation analysis
Position Name Primer sequence Direction
Exon 1 43567 5[prime] CCACCAACCGCCGAGGAAATC 3[prime] Forward
Exon 3 43566 5[prime] TCCAGAATTTCAGAAACTGCTCGG 3[prime] Forward
Exon 6 43568 5[prime] GTGTCCCAGAGCAGCCATGATC 3[prime] Reverse
Exon 8 45292 5[prime] GTCAACACCATCAGCCTGAAAGG 3[prime] Forward
Exon 8 45293 5[prime] GGCCTCCTTCTGCATGACGCC 3[prime] Reverse
Exon 10 45294 5[prime] GGTCTACCTGCAGTCCACTCCT 3[prime] Forward
Exon 12 40022 5[prime] AACATCACTCCAGAAACGGTCGAA 3[prime] Forward
Intron 12 40028 5[prime] TAGAACGTAACCCACGGTTACGGT 3[prime] Reverse
Exon 13 45295 5[prime] CGATCTGCATCCCAGAATACTGG 3[prime] Reverse
Exon 14 40023 5[prime] AGGTTCGTCTTTGGGTATGAAACG 3[prime] Reverse
Exon 16 45296 5[prime] TGCTGACAGGACAGAAGAATGGG 3[prime] Forward
Exon 16 45297 5[prime] CACGCGCACGTCCCTGTCCG 3' Reverse
Exon 19 44555 5[prime] TGGTGGACCTGTTCGCGCTCAAGGACT 3[prime] Forward
Exon 19 40069 5[prime] TGCTGCCACACAGCGACATGATG 3[prime] Reverse
Exon 22 40070 5[prime] CTCGTCTCCAGGTTGTTCTTTGAT 3[prime] Forward
Exon 22 40071 5[prime] TCAACTGCGAGGGAGGTTGTGTT 3[prime] Reverse
Exon 25 40024 5[prime] GCACTCCGGCCTCTTCTACA 3[prime] Forward
Exon 25 44554 5[prime] GAGTAATGACAGCACCATATTAGCCGT 3[prime] Reverse
Exon 26 45298 5[prime] CTGGGCCGGGGAAGATGACAG 3[prime] Forward
Exon 26 45299 5[prime] GGTTCCTCCATTTTATGGGTGCC 3[prime] Reverse
Exon 27 40025 5[prime] GCAGAGCTGGAATCAACCGCA 3[prime] Reverse
Exon 28 40073 5[prime] GCCAACAGAAAGCACAGGATCAAC 3[prime] Forward
Exon 28 40072 5[prime] GCCAAGGGTGGTAGATTTATGCAC 3[prime] Reverse
Exon 30 40043 5[prime] GTTTCTCCAGAGAACCGACCAT 3[prime] Forward
Exon 30 40074 5[prime] TAGCCATGGTCGGTTCTCTGGAG 3[prime] Reverse
Exon 31 40044 5[prime] GCCAGATTGGTACCAAACAGGG 3[prime] Reverse
Exon 35 45300 5[prime] CCGAAGCAATCATTCCCAACATCT 3[prime] Forward
Exon 35 45301 5[prime] TTGCTTGGAGTGGTAACGCTCATA 3[prime] Reverse
Exon 39 45302 5[prime] GAGCTGTCCCTCTCCCCACATC 3[prime] Forward
Exon 40 40075 5[prime] GGAAGAGATGTCATCCAACAGGAC 3[prime] Reverse
Exon 47 45304 5[prime] CTGACCTCTTGAGCGTCATGAGT 3[prime] Forward
Exon 48 45305 5[prime] GGAGACTTAGGTTGAATTCCTTGC 3[prime] Reverse
Exon 50 40077 5[prime] GCACCTACTCCAGGACCAGTTG 3[prime] Forward
Exon 50 40076 5[prime] TGCAGGGCCAAACACAGACATGAC 3[prime] Reverse
Exon 52 40045 5[prime] AAGGTCTTCAGAGCGTCCTTTC 3[prime] Forward
Exon 52 40046 5[prime] GATGATATTGCGTAAAGTCGGTG 3[prime] Reverse
Exon 55 40078 5[prime] CTTGAGCGTACCCAGCTGAACGT 3[prime] Forward
Exon 55 40079 5[prime] GTGTTTCCAGGGCCTTGAGGCT 3[prime] Reverse
Exon 59 45306 5[prime] CATACTCATCAGTGAAGTCGTTCG 3[prime] Forward
Exon 59 40054 5[prime] CGAACGACTTCACTGATGAGTATG 3[prime] Reverse
Exon 63 40108 5[prime] TTGTCTCGTGTTGACGGGGAA 3[prime] Forward
Exon 63 40109 5[prime] CGATGGCATGTTCACTCTGT 3[prime] Reverse
Exon 65 47293 5[prime] CAGGATATCATGAACAAGGTCATCG 3[prime] Forward
Exon 66 47295 5[prime] GTCCCTGTCCAACTTCACTCAG 3[prime] Forward
Exon 67 46852 5[prime] GGAGCTGGACCGCAGGGCTT 3[prime] Forward
Exon 67 46853 5[prime] TCTTCGAGACCGTGGCCTCGC 3[prime] Forward
Exon 67 45308 5[prime] AGCATCTAGAGCGGCCGCTTAGAGCGATTTATCCTGATGGATC 3[prime] Reverse
3[prime]UTR 40051 5[prime] CGTTACTCGCACATACACTTGCCT 3[prime] Forward
3[prime]UTR 40058 5[prime] CGCATGCTTAGCATTACTGCTTAG 3[prime] Forward
3[prime]UTR 40050 5[prime] TCAGCTCCATCCGCTGTGAAT 3[prime] Forward
3[prime]UTR 40059 5[prime] AAGCAGCAGAAGGTTCAGTGAGAA 3[prime] Forward
3[prime]RACE RT Qt 5[prime] CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGC(T)17 -3[prime]  
3[prime]RACE PCR1 Qo 5[prime] CCAGTGAGCAGAGTGACG 3[prime] Reverse
3[prime]RACE PCR2 Qi 5[prime] GAGGACTCGAGCTCAAGC 3[prime] Reverse

RESULTS

Expression profile of the FrHD gene

The human and mouse HD genes are both widely expressed in brain and peripheral tissues. Prior to the analysis of the FrHD gene in mouse we set out to ensure that the processed mRNA in Fugu tissues was as predicted from the sequence comparison of the genomic Fugu sequence with that of the human and mouse cDNAs. By Northern analysis, the gene was found to be expressed in all tissues tested except muscle (Fig. 1a), although a transcript could be identified in muscle by the more sensitive RT-PCR (see below). The Northern signal appeared as a somewhat diffuse doublet of ~10 kb. To carry out a more detailed analysis of the FrHD mRNA, we designed primer sets along the entire length of the coding sequence (Table 1). RT-PCR amplification generated a product of the size predicted by the genomic sequence and conserved splice junctions for all but three regions of the mRNA. Aberrant products were obtained with primers that amplified exons 1-8, 8-13 and 63-67. Amplification of exons 1-8 generated two products, one of the expected size (803 bp) and a second 81 bp larger. Amplification of exons 8-13 produced a 840 bp product of the expected size and an additional larger product of 869 bp. Amplification of exons 63-67 produced two products in brain, one of the predicted size (779 bp) and a larger product of 890 bp, with only the larger product being detected in the other tissues. As an initial approach to determine whether aberrant bands were artifactual, the PCR products were hybridised with an appropriate internal oligonucleotide (Fig. 1b). The additional splice products were sequenced and the alternatively spliced isoforms were found to include: the retention of intron 7 (81 bp), the removal of exon 10 (48 bp) and retention of intron 11 (77 bp), and the use of an internal acceptor site in intron 63 to `splice in' 111 bp of intron 63. Correspondingly, a branch site sequence (CGCTGAC) was identified 28 nt before the internal splice acceptor sequence. The addition of intron 7 and the 3[prime] end of intron 63 maintains the open reading frame of the mRNA. However, splicing of exon 9 to exon 11 shifts the reading frame leading to two termination codons in the retained intron 11 sequence.

The genomic sequence of the FrHD gene predicted that there were three possible polyadenylation signals. We performed 3[prime] RACE to identify the presence of different polyadenylated mRNA forms in Fugu RNA prepared from a number of Fugu tissues. In all cases, PCR products corresponding to the use of the polyadenylation signals predicted at positions 26080 (AGTAAA) and 27410 (ATTAAA) were present, but that corresponding to 26884 (AGTAAA) was not found (Fig. 1c). This would suggest two alternative 3[prime] untranslated regions of 191 and 1521 bp respectively. In brain an additional 3[prime] RACE product was consistently observed which could be explained if the sequence AACAAA acts as a polyadenylation signal 165 bp 3[prime] to 26080. The use of two major polyadenylation sites is consistent with the observation of a doublet on the Northern blot. The diffuse nature of the Northern blot signals could be explained further by the alternative splice forms described above.

The FrHD gene is expressed from its own promoter in mouse cells

Comparative sequence analysis of the promoter regions of the Fugu and human HD genes did not reveal any similar sequence motifs. In addition, the GC content was not raised. Therefore, before generating constructs for transgenesis it was important to determine whether the Fugu promoter was functional in mouse cells. To test this, a 30 kb EagI fragment (Fig. 2), was co-transfected into mouse L cells with pKJ1 plasmid containing a neo resistance gene. More than 27 kb of this fragment has been sequenced and it contains the entire coding region with 2.84 kb of upstream and 4 kb of downstream sequences. Approximately 80 neo resistant colonies were established as stable transformants, all of which were found also to contain the FrHD gene. Southern analysis identified those cell lines containing an intact gene and promoter region (data not shown). Ten lines were chosen for expression analysis. Using primers specific to exons 12 and 14 that discriminate between the mouse and Fugu RNA, RT-PCR indicated the presence of a correctly spliced mRNA product in all lines (data not shown). It was therefore clear that the Fugu promoter is functional in mouse cells.


Figure 2 Restriction map of the EagI fragment containing the FrHD gene used for transfection and transgenesis. The positions of the translation start codon, termination codon and polyadenylation signals are shown above the map and of probes used in Southern analysis below the map. B, BamHI; E, EcoRI; H, HindIII.

Generation of mice transgenic for FrHD

The 30 kb EagI fragment containing the FrHD gene was used to generate transgenic mice by standard procedures. Two founders were recovered from 51 newborns, FrHD43 (male) and FrHD46 (female), both of which transmitted the transgene to their offspring. The genomic structure of the integration sites was determined by Southern analysis (Fig. 3). HindIII digestion of FrHD46 DNA indicated that this line contained a single truncated copy of the transgene extending from the 5[prime] end of the gene and containing 26 exons (as determined by PCR). Digestion of FrHD43 DNA with ScaI, which has a unique site within the microinjection fragment, indicated that the FrHD43 line contained three or four tandem copies of the transgene (as estimated from band intensities).

Expression of the FrHD gene in mouse in vivo and in vitro

As only one transgenic founder containing intact copies of the FrHD gene was recovered, the expression analysis was performed on this transgenic line and two of the L-cell transfectants in parallel. The primers described in Table 1 had been designed to discriminate between the Fugu and mouse transcripts, thereby specifically amplifying the Fugu sequences. The structure of the Fugu mRNA in mouse was analysed by RT-PCR using primers spaced along the transcript, and by 3[prime] RACE. No difference in the pattern of RT-PCR products was identified between brain, liver and kidney. Hybridisation of internal oligonucleotides to RT-PCR products was used to indicate specific amplification products. This analysis is summarised in Table 2 and examples of the RT-PCR amplification products are provided in Figure 4a. RT-PCR indicated that the only portion of the FrHD mRNA to have been correctly processed was that lying between exons 30-35 and 38-48. The analysis was extended to include more primers in an attempt to narrow further the localisation of the aberrant splicing events. However, this approach must be treated with caution. An aberrant product may not be detected, either because the incorrect splicing is not occurring in the part of the amplification product under further analysis, or because the region containing the primer sequence has been incorrectly `spliced out'. Various FrHD cDNA probes were used against Northern panels containing Fugu RNA and RNA from the transgene and transfectants. Whilst discrete bands were present in the Fugu tissue RNA, a high molecular weight smear was detected in the transgene or transfectant RNA (Fig. 4b), consistent with the presence of a broad range of incorrectly processed transcripts.

Table 2 Summary of amplification products arising from the RT-PCR analysis of the FrHD mRNA from L-cell transfectants and transgene FrHD43 tissues
RT-PCR product Fugu product (bp) Product size Oligo detection Hyridisation oligo
    Transgene Cell line Transgene Cell line  
Exon 1-8  884  970  970 + + 43568(ex 3)
   803  870  870 + + 43568(ex 3)
 
Exon 8-13  869 ~900 ~900 + + 40022(ex12)
   840 ~840 ~840 + + 40022(ex12)
    ~800 ~800 + + 40022(ex12)
    ~550 ~550 - - 40022(ex12)
 
Exon 12-16  554  ND ~554 ND + 40023(ex14)
     ND ~520 ND + 40023(ex14)
     ND ~450 ND + 40023(ex14)
 
Exon 16-25 1237 ~1380 ~1380 + + 44555(ex19)
    ~1300 ~1300 + + 44555(ex19)
      ~670   + 44555(ex19)
Exon26-31  668 668 668 + + 45299(ex26)
    ~600 ~600 + + 45299(ex26)
    ~450 ~450 + + 45299(ex26)
    668 668 + + 40073(ex28)
    ~600 ~600 - - 40073(ex28)
    ~450 ~450 - - 40073(ex28)
             
Exon 30-35  640  640  640 ND ND  
Exon 35-40  827 ~1300 ~950 + + 45302(ex39)
    ~700 ~900 + + 45302(ex39)
    ~650 ~700 + + 45302(ex39)
    ~550 ~650 - + 45302(ex39)
      ~550   - 45302(ex39)
 
Exon 39-48 1371  1371 1371 ND ND  
 
Exon 52-59 1008 ~1300 ~1350 + + 40079(ex55)
    ~1150 ~1300 + + 40079(ex55)
    ~700 ~1250 - + 40079(ex55)
      ~1200   + 40079(ex55)
      ~1150   + 40079(ex55)
      ~750   + 40079(ex55)
      ~700   - 40079(ex55)
 
Exon 55-59  631 ~1300 ~1300 ++ + 40079(ex55)
    ~1070 ~1070 ++ + 40079(ex55)
    ~872 ~872 + ++ 40079(ex55)
    ~840 ~840 + ++ 40079(ex55)
 
Exon 59-67 1368 ~1360 ~1400 + + 47293(ex65)
  1257 ~1257 ~1360 ++ + 47293(ex65)
      ~1257   + 47293(ex65)


Figure 3 Southern blots showing the genomic structure of the transgene integration sites. DNA was digested with either (a) HindIII and fractionated on a 0.8% agarose gel or (b) ScaI and fractionated on a 0.5% gel. Southern filters were probed with the 30 kb EagI fragment from cosmid 36E6. C, cosmid 36E6; 43 and 46, transgenic line FrHD43 and FrHD46; M, normal mouse; H, high molecular weight markers (BRL).


Figure 4 Expression analysis of the FrHD gene in transgenic line FrHD43 and transfected cell lines 76 and 88. (a) RT-PCR analysis of the FrHD mRNA from line FrHD43 and L-cell transfectants. Amplification products were fractionated on 2.5% gels. (b) Northern analysis of the expression of the FrHD gene in Fugu tissues and transfected cell lines using the RT-PCR product containing exons 1-8 as a probe. (c) 3[prime] RACE products showing the use of polyadenylation signals used in line FrHD43 and transfected cell lines 76 and 88. Signals at positions 26080 and 27410 in the genomic sequence were used in both cell lines and in all transgene tissues tested. B, Fugu brain tissue; 43, FrHD43 brain tissue; 76 and 88, transfected cell lines; M, normal mouse brain; W, water; P, [phis]X HaeIII markers.

A sequence analysis of the aberrant splice products was initiated. The sequence of the RT-PCR product from exons 1-8 showed that intron 7 (81 bp) had been retained. This was identical to one of the aberrant splice forms identified in the Fugu tissues, and it maintains the reading frame of the message. The 3[prime] 84 bp of intron 4 was also found arising from the presence of a possible branch site sequence (CATTTAT) 20 nucleotides prior to an internal splice acceptor site (Y6AG). This aberrant splice product contained four in-frame stop codons and would be incompatible with the production of a full length FrHD protein. All of the transgene mouse tissues tested and the L-cell transfectants showed no evidence of a correctly spliced product that did not contain the in-frame stop codons in intron 4. Sequencing of the many other aberrant splice forms was not pursued once this result had been obtained.


Differential polyadenylation was found to originate from the polyadenylation signals predicted at positions 26080 (AGTAAA) and 27410 (ATTAAA) in the genomic sequence. Therefore the same polyadenylation signals were used in both the Fugu and mouse cells. However, in mouse there was no evidence of the brain-specific product detected in Fugu (Fig. 4c).

DISCUSSION

Comparative sequencing projects between the genomes of human and Fugu rubripes are providing increasing evidence that Fugu represents a good model genome for the identification of human genes and control elements (2,3). Human and Fugu represent the maximum evolutionary distance between two vertebrates and conserved sequences are expected to have a functional importance. The major attraction of the Fugu genome is its relatively compact size of ~7.5 fold smaller than the human genome (1). This has arisen by the loss of intronic and intergenic sequences, the selective pressure for which is unknown. It has been suggested that in cases of very large human genes, these natural Fugu minigenes may provide a convenient form for the generation of transgenic mice by cosmid-based rather than YAC-based technology. We have used the Fugu homologue of the HD gene to test this possibility.

It was difficult to predict whether the Fugu promoter would be functional in mouse cells. The Fugu and human 5[prime] UTR sequences are 46% identical at the nucleotide level, and possible conserved regulatory sequences are not apparent (4). The human gene has a CpG island identified by a cluster of unmethylated rare cutter restriction sites located within exon 1, 60-220 bp upstream of the ATG initiation codon. Although there is a putative computer predicted CpG island in the Fugu sequence this is probably too far upstream of the first exon, located at 2.7-2.8 kb before the ATG. Other possible CpG islands lie within the gene, including one of >8 kb. However, this elevated CG ratio could be accounted for by the Fugu codon preference in the exon-rich regions (4). Comparison of human and mouse upstream sequences has uncovered a region of 150 bp of 78% identity (30), but this region is not well conserved in Fugu, with the exception of a 28 nt stretch of 71% identity which spans the proposed transcription start site (4). Similarly, potential SP1 and AP2 binding sites conserved between human and mouse (30) were not found in Fugu, suggesting that either they may not be involved in the regulation of HD, or that the Fugu and mammalian promoters are different. However, despite the apparent absence of conserved regulatory sequences, the FrHD gene was transcribed from its own promoter both in L-cell transfectants and in vivo in a transgenic mouse assay. This suggests sufficient conservation of unidentified transcription factor binding sites or of structural motifs to allow mouse transcription factors to direct expression of the Fugu gene.

In human there are two differentially polyadenylated isoforms of the HD mRNA generating 3[prime] untranslated regions of 600 and 3921 bp which Northern analysis suggests show a tissue-specific relative abundance (12,14). Although two transcripts are also detected on mouse Northern blots, probably resulting from alternative polyadenylation signals, cDNA clones containing the longer of the 3[prime] untranslated regions have not been identified (26,27). The FrHD sequence predicted three possible polyadenylation signals at positions 26080 (AGTAAA), 26884 (AGTAAA) and 27410 (ATTAAA). The 26884 signal is preceded by a 45 bp region that has 69% identity to the human sequence, which is also the most conserved region between the mouse and human 3[prime] untranslated regions (4). Using 3[prime] RACE we were able to identify transcripts with polyA tails arising from signals at positions 26080 and 27410, but not from 26884. Therefore, the functional significance of the sequence conservation preceding 26884 is not clear. It is interesting that the human, mouse and Fugu genes all appear to have two polyadenylated forms, and that the FrHD mRNA was polyadenylated in mouse as in Fugu tissues. The 3[prime] untranslated regions in Fugu are of 191 and 1521 bp, compared with 600 and 3921 bp in human.

Although the FrHD gene was found to be expressed from its own promoter in mouse cells and polyadenylation was conserved, we found multiple instances of aberrant splicing throughout the mRNA. In metazoans, high fidelity in pre-mRNA splicing is important at three distinct points during the splicing pathway: first during the initial recognition of the 5[prime] and 3[prime] splice site; second for connecting the correct pairs of 5[prime] and 3[prime] splice sites across the intron; and third for selecting the precise bonds for cleavage at each 5[prime] and 3[prime] splice site. The cis-acting sequences in the pre-mRNA that participate in the initial complex formation are localized to a ~300 nucleotide region containing the branchpoint sequence (BPS), the 3[prime] splice site, the exon and the 5[prime] splice site, and it is the spacing of each of these elements within the 300 nucleotide region that determines whether complex assembly will occur. This model suggests that cryptic splice sites are not recognised because they are not situated at the appropriate distances from the multiple elements involved in efficient complex assembly (31).

Prior to studying the processing of the Fugu pre-mRNA transcript in mouse cells, we used RT-PCR to test whether the Fugu pre-mRNA was processed in Fugu tissues as predicted from the comparison of the human and Fugu genes. Amplification products of the predicted size were obtained across the entire gene except in three regions. The retention of intron 7 and the use of an internal splice acceptor in intron 63 maintains the reading frame of the message. All tissues contained both the intron 7 spliced and non-spliced isoforms. However, only brain contained both of the intron 63 isoforms, all other tissues tested containing only the alternatively spliced version. The identification in Fugu tissues of the incorrectly spliced isoform that has skipped exon 10 and retains intron 11 was unexpected, as this contains in-frame stop codons and is incompatible with the production of a full length protein. Not surprisingly, all tissues were also found to contain the correctly spliced version.

The expression analysis of the FrHD transfectants and transgenes would suggest that Fugu genes are unlikely to be useful in the construction of transgenic mice. The reduction of intron size appears severely to stress the fidelity of the mouse splicing machinery. The Fugu splicing complexes must have evolved in parallel to compensate for a reduction in the spacing of the cis-elements important for complex assembly. The identification of at least one aberrant splice form which would terminate the FrHD protein relatively close to its N-terminus suggests that the reduction in the size of the FrHD gene may have reached an equilibrium. The selective pressures causing the Fugu genome to lose DNA are not known. However, it is possible that the inability correctly to process pre-mRNAs once intron size has decreased beyond a certain threshold size acts as a counter selection to this DNA loss.

MATERIALS AND METHODS

Generation and characterisation of L-cell transfectants and transgenic mice

Mouse L-cells were co-transfected with 25 [mu]g of the 30 kb EagI fragment containing the FrHD gene and 1 [mu]g of the PGK-neo plasmid pKJ1 per 2.5 × 107 cells by calcium phosphate precipitation as previously described (32). G418 resistant colonies were picked, expanded as stable transfectants and DNA was prepared. Southern blotting was to nylon membranes (Merck) and hybridisations were performed as previously described (33). Southern blots of HindIII and EcoRI digested DNA probed with F36Eag30 were indicative of intact FrHD integrants and BamHI Southerns probed with F64H2.8 were used to show that the promoter region was present. DNA for transgenesis was purified from agarose by Biotrap (Schleicher and Schuell), resuspended in TE0.1 and injected into fertilised mouse embryos at a concentration of 5 ng/[mu]l by standard procedures (34). Genotyping of mice was performed on DNA prepared from tail biopsy (34) by both Southern blotting (F36Eag30 as hybridisation probe) and PCR. Amplification was using primers 40022 and 40028 (Table 1) in AM buffer (67 mM Tris-HCl pH 8.8, 16.6 mM NH4SO4, 2.0 mM MgCl2, 0.17 mg/ml BSA, 10 mM 2-mercaptoethanol), 10% DMSO, 200 [mu]M dNTPs, 10 ng/[mu]l primers with 0.5 U/[mu]l Taq polymerase (Cetus). Cycling conditions were 90 s at 94°C, 35×(30 s at 94°C, 30 s at 60°C, 90 s at 72°C), 10 min at 72°C.

Expression analysis

RNA was prepared from cell lines and tissues as described (35). Northern blots contained 20 [mu]g total RNA per lane and hybridisations were as previously described (33). RNA was reverse transcribed (14 U/[mu]l MMTV RTase, BRL) in 50 mM KCl, 10 mM Tris-HCl pH 9.0, 0.1% Triton X-100, 6.5 mM MgCl2, 10 mM DTT, 1 mM dNTPs, 10 ng/[mu]l random hexamers with 0.35 U/[mu]l RNasin (Promega) at 10 min at 23°C and then 40 min at 37°C. Primers were selected from those presented in Table 1 and PCR was performed as above except in the case of the reaction containing primers 40043 and 45301, to which no DMSO was added. Southern blots of PCR products were hybridised with oligonucleotides as previously reported (36). 3[prime] RACE reactions were carried out as described by Frohman (37) using the nested internal primers listed in Table 1: 46853 and 45308; 40051 and 40058; 40050 and 40059. Reverse transcription [using the QT primer (37)] and PCR were performed using the parameters described above.

DNA sequencing

PCR products were either blunt ended by T4 DNA polymerase (NEB) as recommended by the manufacturer at 12°C for 25 min, and subcloned into SmaI cut bluescript plasmid (Stratagene) after the addition of 5[prime] phosphates using T4 DNA kinase (NEB), or purified by Geneclean (Bio 101 Inc.) and sequenced directly. Sequencing was by dideoxy chain termination (38) using an automated gel reader (377, Applied Biosystems).

ACKNOWLEDGEMENTS

We wish to thank John Copier and Adrian Kelly for advice concerning calcium phosphate transfections and Adrienne Knight for proof reading the manuscript. This work was supported by grants from the MRC, Hereditary Disease Foundation (in the form of an award donated by Harry Liebermann) and Special Trustees of St. Thomas's Hospital.

REFERENCES

1. Brenner, S., Elgar, G., Sandford, R., Macrae, A., Venkatesh, B.and Aparicio, S. (1993) Characterisation of the puffer fish (Fugu) genome as a compact model vertebrate genome. Nature, 366, 265-268.

2. Elgar, G., Sandford, R., Aparicio, S., McCrea, A., Venkatesh, B.and Brenner, S. (1996) Small is beautiful: comparative genomics with the pufferfish (Fugu rubripes). Trends Genet., 12, 145-150. MEDLINE Abstract

3. Elgar, G. (1996) Quality not quantity: the pufferfish genome. Hum. Mol. Genet., 5, 1437-1442. MEDLINE Abstract

4. Baxendale, S., Abdulla, S., Elgar, G., Buck, D., Berks, M., Micklem, G., Durbin, R., Bates, G., Brenner, S., Beck, S. and Lehrach, H. (1995) Comparative sequence analysis of the human and pufferfish Huntington's disease genes. Nature Genet., 10, 67-75. MEDLINE Abstract

5. Mason, P.J., Stevens, D.J., Luzzatto, L., Brenner, S. and Aparicio, S. (1995) Genomic structure and sequence of the Fugu rubripes glucose-6-phosphate dehydrogenase gene (G6PD). Genomics, 26, 587-591. MEDLINE Abstract

6. Maheshwar, M.M., Sandford, R., Nellist, M., Cheadle, J.P., Sgotto, B., Vaudin, M. and Sampson, J.R. (1996) Comparative analysis and genomic structure of the tuberous sclerosis 2 (TSC2) gene in human and pufferfish. Hum. Mol. Genet., 5, 131-137. MEDLINE Abstract

7. Macrae, A.D. and Brenner, S. (1995) Analysis of the dopamine receptor family in the compact genome of the puffer fish Fugu rubripes. Genomics, 25, 436-446. MEDLINE Abstract

8. Venkatesh, B., Tay, B.H., Elgar, G. and Brenner, S. (1996) Isolation, characterisation and evolution of nine pufferfish (Fugu rubripes) actin genes. J. Mol. Biol., 259, 655-665. MEDLINE Abstract

9. Aparicio, S., Hawker, K., Cottage, A., Mikawa, Y., Zuo, L., Venkatesh, B., Chen, E., Krumlauf, R. and Brenner, S. (1997) Organisation of the Fugu rubripes Hox clusters: evidence for continuing evolution of vertebrate Hox complexes. Nature Genet., 16, 79-83. MEDLINE Abstract

10. Aparicio, S., Morrison, A., Gould, A., Gilthorpe, J., Chaudhuri, C., Rigby, P., Krumlauf, R. and Brenner, S. (1995) Detecting conserved regulatory elements with the model genome of the Japanese puffer fish, Fugu rupripes. Proc. Natl. Acad. Sci. USA, 92, 1684-1688. MEDLINE Abstract

11. Elgar, G., Rattray, F., Greystrong, J. and Brenner, S. (1995) Genomic structure and nucleotide sequence of the p55 gene of the puffer fish Fugu rubripes. Genomics, 27, 442-446. MEDLINE Abstract

12. Ambrose, C.M., Duyao, M.P., Barnes, G., Bates, G.P., Lin, C.S., Srinidhi, J., Baxendale, S., Hummerich, H., Lehrach, H., Altherr, M., Wasmuth, J., Buckler, A., Church, D., Housman, D., Berks, M., Micklem, G., Durbin, R., Dodge, A., Read, A., Gusella, J. and MacDonald, M.E. (1993) Structure and expression of the Huntington's disease gene: evidence against simple inactivation due to an expanded CAG repeat. Somatic Cell Mol. Genet., 20, 27-38.

13. HDCRG (1993) A novel gene containing a trinucleotide repeat that is unstable on Huntington's disease chromosomes. Cell, 72, 971-983.

14. Lin, B., Rommens, J.M., Graham, R.K., Kalchman, M., MacDonald, H., Nasir, J., Delaney, A., Goldberg, Y.P. and Hayden, M.R. (1993) Differential 3[prime] polyadenylation of the Huntington disease gene results in two mRNA species with variable tissue expression. Hum. Mol. Genet., 2, 1541-1545. MEDLINE Abstract

15. Li, S.H., Schilling, G., Young, W.S., Li, X.J., Margolis, R.L., Stine, O.C., Wagster, M.V., Abbott, M.H., Franz, M.L., Ranen, N.G., Folstein, S.E., Hedreen, J.C. and Ross, C.A. (1993) Huntington's disease gene (it-15) is widely expressed in human and rat tissues. Neuron, 11, 985-993. MEDLINE Abstract

16. Strong, T.V., Tagle, D.A., Valdes, J.M., Elmer, L.W., Boehm, K., Swaroop, M., Kaatz, K.W., Collins, F.S. and Albin, R.L. (1993) Widespread expression of the human and rat Huntington's disease gene in brain and nonneuronal tissues. Nature Genet., 5, 259-263 MEDLINE Abstract

17. Dure, L.S., Landwehrmeyer, G.B., J. Golden, McNeil, S., Ge, P., Aizawa, H., Huang, Q., Ambrose, C.M., Duyao, M.P., Bird, E.D., DiFiglia, M., Gusella, J.F., MacDonald, M.E., Penney, J.B., Young, A.B. and Vonstattel, J.-P. (1994) IT15 gene expression in fetal human brain. Brain Res., 659, 33-41. MEDLINE Abstract

18. Jou, Y.-S. and Myers, R.M. (1995) Evidence from antibody studies that the CAG repeat in the Huntington disease gene is expressed in the protein. Hum. Mol. Genet., 4, 465-469. MEDLINE Abstract

19. Trottier, Y., Devys, D., Imbert, G., Sandou, F., An, I., Lutz, Y., Weber, C., Agid, Y., Hirsch, E.C. and Mandel, J.-L. (1995) Cellular localisation of the Huntington's disease protein and discrimination of the normal and mutated forms. Nature Genet., 10, 104-110. MEDLINE Abstract

20. Ide, K., Nobuyuki, N., Masuda, N., Goto, J. and Kanazawa, I. (1995) Abnormal gene product identified in Huntington's disease lymphocytes and brain. Biochem. Biophys. Res. Comm., 209, 1119-1125. MEDLINE Abstract

21. DiFiglia, M., Sapp, E., Chase, K., Schwarz, C., Meloni, A., Young, C., Martin, E., Vonstattel, J.-P., Carraway, R., Reeves, S.A., Boyce, F.M. and Aronin, N. (1995) Huntingtin is a cytoplasmic protein associated with vesicles in human and rat brain neurons. Neuron, 14, 1075-1081. MEDLINE Abstract

22. Sharp, A.H., Loev, S.J., Schilling, G., Li, S.-H., Li, X.-J., Bao, J., Wagster, M.V., Kotzuk, J.A., Steiner, J.P., Lo, A., Hedreen, J., Sisodia, S., Snyder, S.H., Dawson, T.M., Ryugo, D.K. and Ross, C.A. (1995) Widespread expression of Huntington's disease gene (IT15) protein product. Neuron, 14, 1065-1074. MEDLINE Abstract

23. Trottier, Y., Lutz, Y., Stevanin, G., Imbert, G., Devys, D., Cancel, G., Sandou, F., Weber, C., David, G., Tora, L., Agid, Y., Brice, A. and Mandel, J.-L. (1995) Polyglutamine expansion as a pathological epitope in Huntington's disease and four dominant cerebellar ataxias. Nature, 378, 403-406. MEDLINE Abstract

24. Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A., Hetherington, C., Lawton, M., Trottier, Y., Lehrach, H., Davies, S.W. and Bates, G.P. (1996) Exon 1 of the Huntington's disease gene containing a highly expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell, 87, 493-506. MEDLINE Abstract

25. Davies, S.W., Turmaine, M., Cozens, B.A., DiFiglia, M., Sharp, A.H., Ross, C.A., Scherzinger, E., Wanker, E.E., Mangiarini, L. and Bates, G.P. (1997) Formation of neuronal intranuclear inclusions (NII) underlies the neurological dysfunction in mice transgenic for the HD mutation. Cell, in press.

26. Barnes, G.T., Duyao, M.P., Ambrose, C.M., McNeil, S., Persichetti, F., Srinidhi, J., Gusella, J.F. and MacDonald, M.E. (1994) Mouse Huntington's disease gene homolog (Hdh). Somatic Cell Mol. Genet., 20, 87-97. MEDLINE Abstract

27. Lin, B., Nasir, J., MacDonald, H., Hutchinson, G., Graham, R.K., Rommens, J.M. and Hayden, M.R. (1994) Sequence of the murine Huntington's disease gene: evidence for conservation, and polymorphism in a triplet (CCG) repeat alternate splicing. Hum. Mol. Genet., 3, 85-92. MEDLINE Abstract

28. Schmitt, I., Bachner, D., Megow, D., Henklein, P., Hameister, H., Epplen, J.T. and Riess, O. (1995) Expression of the Huntington disease gene in rodents: cloning of the rat homologue and evidence for downregulation in non-neuronal tissues during development. Hum. Mol. Genet., 4, 1173-1182. MEDLINE Abstract

29. Schedl, A., Montoliu, L., Kelsey, G. and Schutz, G. (1993) A yeast artificial chromosome covering the tyrosinase gene confers copy number-dependent expression in transgenic mice. Nature, 362, 258-261. MEDLINE Abstract

30. Lin, B., Nasir, J., Kalchman, M.A., McDonald, H., Zeisler, J., Goldberg, Y.P. and Hayden, M.R. (1995) Structural analysis of the 5[prime] region of mouse and human Huntington disease genes reveals conservation of putative promotor region and di- and trinucleotide polymorphisms. Genomics, 25, 707-715. MEDLINE Abstract

31. Reed, R. (1996) Initial splice-site recognition and pairing during pre-mRNA splicing. Curr. Opin. Genet. Dev., 6, 215-220. MEDLINE Abstract

32. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (1990) In: Chanda V.B., ed, Current Protocols in Molecular Biology. John Wiley and Sons, Inc., pp 9.1.1-9.1.9.

33. Monaco, A.P., Bertelson, C.J., Middlesworth, W., Colletti, C.-A., Aldridge, J., Fischbeck, K.H., Bartlett, R., Pericak-Vance, M.A., Roses, A.D. and Kunkel, L.M. (1985) Detection of deletions spanning the Duchenne muscular dystrophy locus using a tightly linked DNA probe. Nature, 316, 842-845. MEDLINE Abstract

34. Hogan, B., Beddington, R., Constantini, F. and Lacy, E. (1994) Manipulating the mouse embryo, a laboratory manual, Second edn. Cold Spring Harbor Press, New York.

35. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156-159. MEDLINE Abstract

36. Sathasivam, K., Amaechi, I., Mangiarini, L. and Bates, G.P. (1997) Identification of an HD patient with a (CAG)180 repeat expansion and the propagation of highly expanded CAG repeats in lambda phage. Hum. Genet., 99, 692-695. MEDLINE Abstract

37. Frohman, M.A. (1994) On beyond classic RACE (Rapid Amplification of cDNA ends). PCR Methods Applic., 4, S40-S58.

38. Sanger, F., Nicklen, S.and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA, 74, 5463-5467. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +44 171 955 2505; Fax: +44 171 955 4444; Email: g.bates@umds.ac.uk

This page is maintained by OUP admin. Last updated Sat Oct 18 13:41:19 BST 1997. Part of the OUP Journals World Wide Web service.
Copyright Oxford University Press, 1997


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
V. F. Bumaschny, F. S. J. de Souza, R. A. Lopez Leal, A. M. Santangelo, M. Baetscher, D. H. Levi, M. J. Low, and M. Rubinstein
Transcriptional Regulation of Pituitary POMC Is Conserved at the Vertebrate Extremes Despite Great Promoter Sequence Divergence
Mol. Endocrinol., November 1, 2007; 21(11): 2738 - 2749.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
G. Yeo, S. Hoon, B. Venkatesh, and C. B. Burge
Variation in sequence and organization of splicing regulatory elements in vertebrate genes
PNAS, November 2, 2004; 101(44): 15700 - 15705.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
C. G. Miles, L. Rankin, S. I. Smith, M. Niksic, G. Elgar, and N. D. Hastie
Faithful expression of a tagged Fugu WT1 protein from a genomic transgene in zebrafish: efficient splicing of pufferfish genes in zebrafish but not mice
Nucleic Acids Res., June 1, 2003; 31(11): 2795 - 2802.
[Abstract] [Full Text] [PDF]

Home page
 Genome ResHome page
U. Pozzoli, G. Elgar, R. Cagliani, L. Riva, G. P. Comi, N. Bresolin, A. Bardoni, and M. Sironi
Comparative Analysis of Vertebrate Dystrophin Loci Indicate Intron Gigantism as a Common Feature
Genome Res., May 1, 2003; 13(5): 764 - 772.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
N. Gillemans, T. McMorrow, R. Tewari, A. W. K. Wai, C. Burgtorf, D. Drabek, N. Ventress, A. Langeveld, D. Higgs, K. Tan-Un, et al.
Functional and comparative analysis of globin loci in pufferfish and humans
Blood, April 1, 2003; 101(7): 2842 - 2849.
[Abstract] [Full Text] [PDF]

Home page
 Genome ResHome page
B. Gottgens, L. M. Barton, M. A. Chapman, A. M. Sinclair, B. Knudsen, D. Grafham, J. G.R. Gilbert, J. Rogers, D. R. Bentley, and A. R. Green
Transcriptional Regulation of the Stem Cell Leukemia Gene (SCL) --- Comparative Analysis of Five Vertebrate SCL Loci
Genome Res., May 1, 2002; 12(5): 749 - 759.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
K. Sathasivam, B. Woodman, A. Mahal, F. Bertaux, E. E. Wanker, D. T. Shima, and G. P. Bates
Centrosome disorganization in fibroblast cultures derived from R6/2 Huntington's disease (HD) transgenic mice and HD patients
Hum. Mol. Genet., October 1, 2001; 10(21): 2425 - 2435.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Sathasivam, K.
Right arrow Articles by Bates, G. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sathasivam, K.
Right arrow Articles by Bates, G. P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?