Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (103)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Carrasquillo, M. M.
Right arrow Articles by Chakravarti, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carrasquillo, M. M.
Right arrow Articles by Chakravarti, A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 2163-2172  

Two different connexin 26 mutations in an inbred kindred segregating non-syndromic recessive deafness: implications for genetic studies in isolated populations
Introduction
Results
   Linkage analysis identifies a 13q NSRD locus
   Haplotype analysis demonstrates two different segregating mutations
   Mutation detection in the connexin 26 gene
   Recent ancestry of connexin 26 mutations
Discussion
   Connexin 26 as a deafness gene
   The nature of genetic variation in isolated populations
Materials And Methods
   Sample collection and DNA extraction
   Genotyping
   Nucleotide sequencing
   Single-strand conformation polymorphism analysis (SSCP)
   Linkage analyses
   Haplotype analysis and estimation of mutation age
Acknowledgements
References

Two different connexin 26 mutations in an inbred kindred segregating non-syndromic recessive deafness: implications for genetic studies in isolated populations

Two different connexin 26 mutations in an inbred kindred segregating non-syndromic recessive deafness: implications for genetic studies in isolated populations

Minerva M. Carrasquillo, Joel Zlotogora1, Saleh Barges2, Aravinda Chakravarti*

Department of Genetics and Center for Human Genetics, Case Western Reserve University School of Medicine and University Hospitals of Cleveland, Cleveland OH 44106, USA, 1Department of Human Genetics, Hadassah Medical Center, Jerusalem, Israel and 2Kupat Holim Klalit, Department of Family Physicians, Afula, Israel

Received August 8, 1997; Revised and Accepted September 3, 1997

Non-syndromic recessive deafness (NSRD) is the most common form of prelingual hereditary hearing loss. To date, 10 autosomal NSRD loci (DFNBs) have been identified by genetic mapping; at least three times as many additional loci are expected to be identified. We have performed linkage analyses in two inter-related inbred kindreds, comprised of >50 affecteds, from a single Israeli-Arab village segregating NSRD. Genetic mapping by two-point and multi-point linkage analysis in 10 candidate regions identified the segregating gene to be on human chromosome 13q11 (DFNB1). Haplotype analysis, using eight microsatellite markers spanning 15 cM in 13q11, suggested the segregation of two different mutations in this kindred: affected individuals were homozygotes for either haplotype or compound heterozygotes. The gene for the connexin 26 gap junction protein, recently shown to be mutant in both dominant and recessive deafness, maps to this locus. We identified two distinct mutations, W77R and Gdel35, both of which likely inactivate connexin 26. The Gdel35 change likely occurs at a mutational hotspot within the connexin 26 gene. The recombination of marker alleles at the polymorphisms studied in 13q11, at known map distances from the mutations, allowed us to estimate the age of the mutations to be 3-5 generations (75-125 years). This study independently confirms the identity of connexin 26 as an NSRD gene. Importantly, we demonstrate that in small populations with high rates of consanguinity, as compared with large outbred populations, recessive mutations may have very recent origin and show allelic diversity.

INTRODUCTION

The phenotype of deafness is easily recognized in humans, and since it does not compromise fertility or longevity in patients, pedigrees segregating the disorder can be identified with ease (1,2). The classification of deafness as conductive or perceptive (sensorineural/neural) requires, however, detailed audiologic examination. The clearest phenotype recognized is in individuals who have deafness at birth or in whom hearing loss occurs before 3 years of age, termed `prelingual' deafness. Although congenital, this type of hearing loss may be inherited or acquired by prenatal infection (rubella), middle-ear disease and maternal drug therapy during pregnancy (thalidomide) and the like (3). Several genetic surveys and family studies have established the incidence of prelingual deafness, not associated with recognized syndromes, as [sim]1/1000 births with >60% of cases being hereditary (1). Of familial cases, >70% are estimated to arise from the segregation of recessive mutations at a minimum of 36 loci (4). The high incidence of hereditary deafness has led to an arduous search for the genes involved in both syndromic and non-syndromic forms (see ref. 2 for review).

The large number of recessive mutations underlying non-syndromic prelingual hearing loss (NSRDs) is not in doubt and is well-supported by observations in the offspring of consanguineous unions. However, the exact number of such genes remains unknown. To date, 10 autosomal NSRD loci (also called DFNBs) have been mapped to human chromosomes: DFNB1 (13q11) (5); DFNB2 (11q13.5) (6); DFNB3 (17p11.2-q12) (7); DFNB4 (7q31) (8); DFNB5 (14q12) (9); DFNB6 (3p14-p21) (10); DFNB7 (9q13-q21) (11,12); DFNB8/10 (21q22) (13,14); DFNB9 (2p22-p23) (15); and DFNB12 (10q21-q22) (16). However, gene identification has been hampered since most autosomal NSRD loci segregate in only a few pedigrees. Nevertheless, while this study has been in progress, mutations in connexin 26 (17) and myosin 7A (18), contributing to both recessive and dominant nonsyndromic deafness, have recently been demonstrated in multiple families.

Since individual NSRD mutations are expected to be rare recessives, studies in multiple inbred populations are necessary to identify the majority of loci. Inbred populations with a founder effect for such mutations are ideal for eventual gene identification. During the course of genetic surveys in different villages in Israel, we identified one population in which the prevalence of profound, isolated, non-syndromic, congenital deafness, as well as less severe forms, is [sim]2%. This isolate is a Muslim Israeli-Arab village of [sim]8000 inhabitants located in the lower Galilee and fully integrated into the life of the state of Israel. The extant members of this community are divided into large inter-related kindreds, called Hamulas, and can trace their ancestry to a few founders about eight generations ago. Two of these kindreds, which we studied and designated as Hamula A and H, each represent 30-40% of all household units in the same village. Hearing loss is present in both kindreds, and there are many cases of intermarriage between the kindreds.


Table 1 . Linkage analysis of NSRD in Israeli-Arab kindreds

Two point lod scores were calculated between the segregating NSRD gene in a subset of nuclear families and genetic markers at 10 candidate regions corresponding to the ten known autosomal NSRD loci. In each case, two genetic markers within 12 cM of the NSRD locus were studied. Lod scores were calculated at recombination values of 0, 5 and 10% assuming recessive inheritance. From refs a(11), b(12), c(14) and d(13).


We performed two-point linkage analyses on the 10 candidate NSRD regions listed earlier for a small subset of nuclear families and detected significant linkage to DFNB1 (3) on chromosome 13q11. Specifically, we observed a maximum two-point lod score of 4.9 at marker D13S175; multi-point analyses using eight markers in 13q11 showed a maximum lod score of 21.2 at D13S175. Interestingly, haplotype analysis using eight microsatellite markers spanning 15 cM in 13q11 suggested the segregation of two different mutations with affected individuals being homozygous for either mutation or compound heterozygotes. Subsequently, we investigated the gene for the gap junction protein connexin 26 (Cx26). Since it is a positional candidate gene which maps to the same region on 13q11 as DFNB1 (17), it is a biological candidate by virtue of the ability of hexameric assemblies of these proteins to compose electrical synapses which couple some neurons (19), and, it has recently been shown to be mutant in individuals whose deafness phenotype segregates with DFNB1 (17). By DNA sequencing and single stranded conformation polymorphism analyses, we identified two distinct mutations which co-segregate with deafness in our families confirming the role of Cx26 in hereditary deafness. The finding of two mutations in an inbred population, which we show have likely arisen in the last three to five generations, has several implications for disease gene mapping studies in isolated communities.


Figure 1 Multi-point linkage analysis of NSRD. (A) Multipoint lod scores were calculated for DFNB1 using eight chromosome 13q11 genetic markers, and using the genetic map of chromosome 13q11 shown in (B). The intermarker map distances are estimates taken from refs (36,37).

RESULTS

Linkage analysis identifies a 13q NSRD locus

We investigated 20 families, presently residing in an Israeli-Arab village in the lower Galilee, in whom both parents have normal hearing and ascertained through one child with a significant hearing defect. In 19 of these families all the affected children were profoundly deaf; the remaining families showed phenotypic variation in severity among the siblings. We also ascertained two families in whom both parents were deaf and all of their nine children were affected; in one of these families the hearing defect was of variable severity among the siblings. We have also identified an additional seven families in whom only one parent is deaf and all of their children have normal hearing. All these observations favor an autosomal recessive mode of inheritance with variable expressivity. In the nuclear families in which both parents have normal hearing, there are a total of 55 affected offspring out of a total of 170 offspring in 26 sibships ascertained through a single proband each. After correction of ascertainment by the proband method (20) the segregation ratio is estimated as 0.20 ± 0.03 [(55-26)/(170-26)] which, although slightly lower, is not significantly different from that expected for a fully penetrant recessive trait. Although the results are also consistent with partial reduction in penetrance, not unlikely in view of the phenotypic variation within and between sibships, the mapping data shown later do not support this hypothesis.


Figure 2 Haplotype segregation in two kinship groups (Hamula A and H) within the kindred. The genetic markers are listed in the following order: D13S1316, D13S250, D13S175, D13S141, D13S143, D13S115, D13S232 and D13S292. The only allele identical by descent in all affected individuals with haplotype `a' is allele 3 of marker D13S175. All affected individuals with haplotype `b' share the same alleles identical by descent for markers D13S175 (allele 6), D13S141 (allele 2), and D13S143 (allele 3). Note that marker locus D13S115 is highly heterozygous and likely shows a high mutation rate. Fully filled symbols denote profound deafness (prelingual) while half filled symbols denote severe to moderate deafness (some language was developed).


Our first aim was to evaluate whether the NSRD locus segregating in the sampled kindreds mapped to any of the 10 known DFNB loci. For two-point linkage analysis, we utilized DNA samples from 22 individuals, 14 of whom demonstrated profound deafness, from four nuclear families for an initial screen (see Materials and Methods). For each of the candidate locations we genotyped two markers within each locus; these were no more than 12 cM apart from each other and selected based on published linkage studies. The lod scores for each marker at each of the 10 known NSRD loci are shown in Table 1. These results clearly demonstrate that linkage can be excluded to all candidate loci except for DFNB1; specifically, significant lod scores of 4.93 and 3.43, at the recombination value [thetas] = 0 for a fully penetrant recessive trait, was detected at D13S175 and D13S141, respectively. Thus, the gene segregating in the two kindreds is at locus DFNB1 on human chromosome 13q11 (5,21). For fine-structure mapping we next genotyped eight microsatellite markers spanning 15 cM in 13q11. For this analysis we genotyped samples from 94 individuals, 46 of whom were profoundly deaf and three were moderately deaf (see Fig. 2). Given the strong evidence of linkage in a small genomic segment (15 cM) in an isolated population we expected at least one marker locus to be completely homozygous in affected individuals. Surprisingly, no such marker locus was evident suggesting the possibility of complex inheritance. Consequently, and also in view of the complexity of the pedigrees, due to common ancestry and multiple inbreeding relationships, we utilized the computer program GENEHUNTER v.5.1 (22) and performed both multipoint parametric and nonparametric linkage analysis. The results are shown in Figure 1A; the map used is provided in Figure 1B. Non-parametric linkage analysis gave a peak NPL score of 11.6 at D13S175 which is highly significant (P = 3.2 × 10-11). Under a recessive mode of inheritance, and 100% penetrance, significant lod scores were obtained for markers D13S1316, D13S250, D13S175, D13S141. The maximum lod score was 21.2 for marker D13S175. These data showed the DFNB1 locus to lie in the [sim]10 cM segment between markers D13S1316 and D13S143.

Haplotype analysis demonstrates two different segregating mutations

The genetic marker data were used to construct the most likely haplotypes by visual inspection. These haplotype data convincingly, and interestingly, showed that the mutation in these pedigrees segregated with two different haplotypes within the sampled families: haplotype a (alleles 1, 1, 3, 3, 4, 1, 3, and 6 at markers D13S1316, D13S250, D13S175, D13S141, D13S143, D13S115, D13S232, and D13S292) and haplotype b (alleles 6, 2, 6, 2, 3, 2, 8, and 3 at markers D13S1316, D13S250, D13S175, D13S141, D13S143, D13S115, D13S232, and D13S292). Affected individuals were always homozygotes for haplotype a or b, or were ab compound heterozygotes. Since affecteds had no other haplotype combinations this is genetic proof that the NSRD mutation(s) segregating in our families is autosomal recessive. Of the two haplotypes, a segregates in Hamula A and H whereas b is found in Hamula H. Surprisingly, genetic kinship does not reflect which haplotype segregates since, in Hamula H, individual 98 is aa but his first cousin once removed (individual 158) is bb. Since two different haplotypes are segregating with the NSRD phenotype, either the mutation is very old and has recombined onto different genetic backgrounds (haplotypes) or multiple, distinct mutations are responsible for the deafness. Our subsequent mutation detection has clarified that the latter is true.


Figure 3 (A) Connexin 26 nucleotide sequence electropherograms. Numbers below each electropherogram correspond to the ID number of the individual whose DNA was sequenced: control individual (CEPH 1347.02), unaffected Gdel35 heterozygote (109), affected Gdel35 homozygote (111), unaffected W77R heterozygote (156), affected W77R homozygote (158), and affected compound heterozygote (169). The arrows point to the variant nucleotide. Note that the sequence electropherograms for the Gdel35 mutation show the antisense sequence. (B) SSCP analysis of connexin 26 for the same individuals whose DNA sequence is shown in 3A (the DNA sequences for individuals 157 and 189 are not shown). The gel on the left shows a mobility shift for the Gdel35 mutation in individuals 109, 111 and 169. The gel on the right shows a mobility shift for the W77R mutation in individuals 156, 157, 158, 169 and 189.

Mutation detection in the connexin 26 gene

The mapping results strongly implicate mutations in the gene for the gap junction protein connexin 26 (Cx26) by virtue of its position in 13q11, its known biological role as a component of intercellular channels and recent findings of mutations in Cx26. By virtue of the close linkage between Cx26 and the related connexin 46 (Cx46), the latter is equally compelling as a positional candidate gene. We performed both nucleotide sequence analysis and single-strand conformation polymorphism analysis (SSCP) to scan the connexin 26 (Cx26) gene for mutations. Nucleotide sequence analysis revealed the deletion of a guanine residue at cDNA position 35 (Gdel35) (23), in individuals with the mutant haplotype a (Fig. 2): Gdel35 causes a frameshift of the coding sequence leading to premature chain termination at the twelfth amino acid. A different mutation was found in individuals carrying the mutant haplotype b, consisting of a T[rarr]C transition at cDNA position 229: this mutation converts a tryptophan (TGG) into arginine (CGG) (W77R). The wild-type tryptophan residue occurs in the second putative transmembrane domain of Cx26, as proposed by hydropathy analysis, and is conserved in at least nine connexins (19). Its replacement by the hydrophilic, basic arginine almost surely leads to an inactive Cx26, as with the Gdel35 mutation. Figure 3A shows the DNA sequences for individuals who carry the Gdel35 and/or W77R mutations. All 98 samples were screened for both mutations by SSCP analysis. As expected, SSCP analysis identified mobility shifts in all affected individuals, and specific to each mutation, but not in the CEPH control nor in individuals with neither mutant haplotype (Fig. 3B). The only exception was individual 78 from Hamula A, who is homozygous for the haplotype a mutation (Gdel35), but appears to be unaffected. The reason for this could be that the hearing loss is not evident yet because of her early age.

Recent ancestry of connexin 26 mutations

The finding of distinct and haplotype-specific (>15 cM) mutations strongly argues for the recent origin of each change. We have attempted to estimate the ages of each mutation by haplotype analysis and based on the frequency of ancestral recombinants (24-26). We chose 25 parents distributed throughout the kindred and avoiding close relationships; these included 23 unaffected and obligate mutant heterozygotes and two affected individuals (see Materials and Methods). We estimated the allele frequency distribution for each mutant and for wild-type chromosomes. The haplotypes of the mutants clarify that the mutations are likely of very recent origin since only the most distant markers have recombined away. D13S115 appears by its pattern of variation to be a highly mutable marker locus consistent with its heterozygosity of 76.2%. Maximum likelihood analysis of the frequency of the variation at each of the eight marker loci in 13q11, using the computer program MLD (27), estimated the age of each mutation to be 3-5 generations. Since a typical human generation is 25 years this suggests mutation origins to be in the past 75-125 years. This estimate of mutational age should be regarded as tentative since the estimate is dependent on marker allele frequencies, on both wild-type and mutant chromosomes, obtained from a small sample and from related individuals. However, for both mutations, mutant gene-bearing marker haplotypes for the 15 cM segment D13S1316 to D13S292 are largely identical (15/21 chromosomes for Gdel35 and 4/6 chromosomes for W77R), suggesting a recent origin.

DISCUSSION

Connexin 26 as a deafness gene

Genetic mapping and mutation detection clearly confirms and implicates the gap junction protein connexin 26 (Cx26) in hereditary prelingual deafness with a recessive mode of inheritance. This study and those of Kelsell et al. (17) and Zelante et al. (33) have identified a total of six Cx26 mutations all of which are localized to the single coding exon. Of these mutations, a T[rarr]C transition substitution in codon 34 is associated with non-syndromic dominant deafness (NSDD) (17). Thus, mutations in Cx26 can have different modes of inheritance, suggesting that activating or dominant negative mutations can occur and lead to deafness. Kelsell et al. (17) have shown via immunocytochemical staining of human cochlear cells that Cx26 is highly expressed in this tissue. Since connexins form hexameric assemblies to interact with their counterparts on neighboring cells and induce intercellular channels, and since they can compose electrical synapses which couple some neurons, their role in sensorineural hearing can be clearly envisaged. More importantly, the inactivating mutations, such as the ones we report and those in recent publications (17,33), likely lead to proteins which are either not membrane anchored or are missing their cytoplasmic tail, suggesting that cytoplasmic effector proteins are crucial in hearing. These, and other proteins, which interact with Cx26 are additional candidates for non-syndromic hearing loss.

In families segregating NSRD, ascertained from an inbred Israeli-Arab community, we have demonstrated linkage to markers flanking DFNB1 on chromosome 13q11 and multiple mutations in Cx26. The missense and deletion/frameshift mutations detected are almost surely inactivating null mutations, consistent with both of them segregating as a recessive trait with 100% penetrance. We have established a simple SSCP assay that can uniquely detect each mutation homozygote and the compound heterozygote so that individuals in the population can be screened relatively easily. This may be a priority since NSRD has a prevalence of [sim]2% in the community we sampled. However, even in this genetic isolate there is significant phenotypic variation in the severity of deafness, even among siblings who share the same mutant Cx26 allele. This variation may be environmental, but the variation in severity between sibships argues for segregation of a modifier gene. Additional studies in this village, with individuals of known Cx26 mutation type, and a high resolution genome screen is likely to reveal the genetic location of such modifiers.

The nature of genetic variation in isolated populations

Genetically, the surprising aspect of this study is the finding of two distinct and young (3-5 generations) mutations within a genetic isolate of recent history. Although this may be a rare and chance finding we suspect that it is not so, but rather a persistent feature of many inbred communities. Several studies of genetic disorders among Arab villages around the Galilee in Israel show the feature of multiple mutations of recent origin arising within a small geographic region. Thus, for Hurler syndrome three unique mutations (28), whereas for metachromatic leukodystrophy five distinct mutations (29), were discovered among the Druze and Muslim Arab villages in the lower Galilee. These villages, which include the one in which NSRD segregates, were similar in structure and history and in the same region as the village we have sampled. Although many scenarios may explain these findings, such as high mutation rates, environmental factors, selective advantage to carriers (30), we argue that this mutation distribution is a direct consequence of the population structure of these Arab villages. It has been well documented that consanguinity in some Israeli-Arab villages can be very high with [sim]50% consanguinity every generation, and 50% of these marriages being between first cousins (31). Furthermore, the majority of such villages have been founded in the past several hundred years usually by very few founders. These villages have also experienced very rapid population growth and have had very small degrees of immigration. Under these circumstances, particularly in view of the high inbreeding rates, the chance that any rare variant or mutation will become homozygous is extremely large in comparison with most outbred, and even most inbred, populations.

Recessive (inactivating) mutations occur at all genes in all populations every generation. The large fraction of these mutations are lost every generation simply by chance; this probability is at least 37% per generation (32). In large outbred and randomly mating populations the time taken for two copies of the same mutation to appear together is dictated by chance and of the order of the 1 / {sqrt mu}, where [mu] is the mutation rate, or several hundred generations. On the other hand, for inbred populations the time to appearance for a new mutation is determined by the inbreeding rate. In communities such as the one we have studied the total inbreeding rate is determined both by intense cultural consanguinity and by the recent common ancestry-the larger the value, the quicker mutant homozygotes appear in the population. This is the most likely explanation for the pattern of mutations in the Israeli-Arab village segregating NSRD, for several disorders (28,29, this paper).

Zelante et al. (33) have recently shown two mutations in connexin 26 in NSRD patients. Intriguingly, they show a very high frequency ([sim]50%) of the Gdel35 mutation in Spanish, Italian and Israeli NSRD patients. This may argue for an ancient Gdel35 mutation that has spread in Europe and the Middle-East since we have also identified a Gdel35 mutation. However, this mutation is clearly of recent origin in the kindreds we have studied, is likely on different haplotypes in the Zelante et al. (33) study (see fig. 1 ref. 33) and occurs (by deletion of one G) at a stretch of six Gs on the coding strand. Thus, these mutations are all likely different, independent and recurrent, and arise due to the run of Gs being a mutational hotspot. Haplotype analysis of Gdel35 mutations in different populations can be used to definitively address this question.

There is considerable recent interest in genetic studies of isolated populations since these communities may help in the genetic dissection of simple and complex disorders. Our studies emphasize that population structure has to be considered in the study design since these communities may uncover, rather than reduce, allelic diversity. It is likely that in these highly inbred communities homozygosity mapping studies may be compromised, as may be studies of mapping by linkage disequilibrium, unless we explicitly allow for mutational diversity.

MATERIALS AND METHODS

Sample collection and DNA extraction

Surveys of genetic disorders in a number of villages in Israel, in the region of the lower Galilee, were conducted by one of us (J.Z.). One village in particular was recognized as having a recognizably high frequency of hereditary deafness with a prevalence of [sim]2%. The [sim]8000 inhabitants of this village are Muslim Arabs and are, as evidenced from their oral history, descendants from a single family that immigrated to this region from Jordan [sim]200 years (eight generations) ago. Three sons from this immigrant family each founded a Hamula (kinship group). Most marriages are within each Hamula, although intermarriages between the Hamulas and with closely neighboring villages (5-10 km) do occur; in rare instances, marriages can occur with individuals in other regions. Blood samples, under informed consent, were collected from 51 individuals affected with nonsyndromic hearing loss, 29 of their parents, and 18 of their unaffected siblings; these individuals are members of Hamula A and H (Fig. 2). Each of the Hamulas A and H comprise 30-40% of the entire village. Genealogical and pedigree analysis shows that all sampled probands in the nuclear families are related through their Hamulas. Nuclear DNA was extracted from blood lymphocytes as described previously (34).

Genotyping

All genetic markers used in this study were microsatellite repeat polymorphisms; primer sets to amplify these markers were obtained from Research Genetics, Inc. (Huntsville, AL). Microsatellite repeat alleles were amplified via the PCR using 80 [mu]g of genomic DNA and [[gamma]-33P]deoxyadenosine triphosphate end-labeled forward primers. The reaction volume was 19 [mu]l and included 0.625 U Taq polymerase (Boehringer Mannheim, Indianapolis, IN), 200 [mu]M each of dATP, dCTP, dGTP, dTTP, and 2.5 [mu]l of 10X incubation buffer (Boehringer Mannheim, Indianapolis, IN). The reactions were amplified by touchdown PCR which consisted of 40 denaturation/annealing cycles and ended with an extension step at 72°C for 5 min. The first 4 cycles started with a denaturation step at 95°C for 30 s, followed by an initial annealing temperature of 60°C for 40 s that decreased by 1°C each in four subsequent cycles. The last 35 cycles started with a denaturation step at 95°C for 30 s, followed by an annealing temperature of 55°C for 40 s. One volume of stop solution (95% formamide, 20 mM EDTA, 0.05% bromophenol blue, and 0.05% xylene cyanol FF) was added to each reaction product, and 4 [mu]l of each sample were resolved on a 6% polyacrylamide gel, followed by drying and autoradiography. Genomic DNA from CEPH individual 1347.02 was genotyped and used as an allele size reference for those genetic markers for which such data were available (Généthon, Evry, France; http://www. genethon.fr/).

Nucleotide sequencing

The sequence of Cx26 cDNA was obtained from GenBank (accession no. M86849), and used to develop the following pairs of amplimer sequences: GJB2.1F: 5[prime]tcttttccagagcaaaccgc3[prime] and GJB2.1R: 5[prime]gacacgaagatcagctgcag3[prime] from (17); GJB2.3F: 5[prime]gagatgagcaggccgacttg3[prime] and GJB2.3R: 5[prime]ctccggtaggccacgtgcatg3[prime]. The primer set GJB2.3F/GJB2.3R was used to sequence Cx26 from PCR-amplified genomic DNA in individuals who were suspected to be compound heterozygotes. This was done because the heterozygous Gdel35 mutation made it impossible to accurately read the DNA sequence downstream from the deletion. DNA amplification for both primer sets was carried out as described in (17). Sequencing reactions were performed using the ABI PRISMª Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Foster City, CA) as specified by the manufacturer. The sequencing reactions were run on an automated ABI model 377 sequencer, and the gels were analyzed by the Sequencing Analysis program v.3.0 (Perkin Elmer, Foster City, CA).

Single-strand conformation polymorphism analysis (SSCP)

Eighty [mu]l of genomic DNA were amplified using primer sets GJB2.1F/GJB2.1R and GJB2.1F/GJB2.1Ra as described in ref. (17). The sequence of primer GJB2.1Ra is 5[prime]caaagtcggcctgctcatctc3[prime]. Each PCR amplification was carried out in a 25 [mu]l volume which contained 0.5 mM of each primer, 0.625 U Taq polymerase (Boehringer Mannheim, Indianapolis, IN), 200 [mu]M each of dATP, dCTP, dGTP, dTTP, and 1X incubation buffer (Boehringer Mannheim, Indianapolis, IN). A volume of [sim]0.3-1 [mu]l of a 2:1 mixture of PCR product and stop solution was analyzed by SSCP using the Pharmacia LKB PHAST System.

Linkage analyses

The computer program MLINK in the LINKAGE v.5.1 package (35) was used to calculate two-point lod scores for each of the two markers at each of the 10 known non-syndromic recessive deafness loci. These calculations were performed on a subset of four related nuclear families to identify the most likely candidate locus. The samples used were 115-119 (family 1) in Hamula A, and 191, 164, 165 (family 2), 189, 169, 171, 172, 200, 191 (family 3) and 209, 210, 232, 215, 159, 211,214, 213, 174 (family 4) in Hamula H, and are shown in Figure 2. Based on the segregation analysis (see Results), we assumed the segregation of a rare recessive mutation with 100% penetrance and a mutant allele frequency of 0.001. Changing the mutant allele frequency did not alter the lod scores significantly. For this preliminary linkage search no inbreeding loops were necessary.

For multipoint parametric and nonparametric linkage analysis we utilized the computer program GENEHUNTER v.1.1 (22). The family structures used for these analyses did allow for inbreeding loops but restrictions of the computer program necessitated the consideration of the total kindred as multiple sub-families. We considered 13 pedigree units with sizes in the range 6-21 members; five had one inbreeding loop, two had two inbreeding loops. Scores were added over the pedigree units at each position on the genetic map. The genetic map of the eight markers in 13q11 used in linkage analysis is that shown in Figure 1B; we used the sex-averaged intermarker distances in cM as given previously (36,37). For both parametric and nonparametric, as well as two-point and multi-point, analyses we assumed that all marker alleles at each marker locus tested were equally frequent.

Haplotype analysis and estimation of mutation age

Haplotypes were constructed for the eight chromosome 13q11 genetic markers D13S1316, D13S250, D13S175, D13S141, D13S143, D13S115, D13S232 and D13S292 by visual inspection. The frequency of marker alleles was estimated separately from mutant gene bearing and wild-type chromosomes based on observed genotypes and allele counting. Haplotype data of 25 parents (82, 83, 105, 104, 89, 90, 57, 109, 110, 116, 115, 86, 74, 73, 157, 156,4, 167, 166, 191, 185, 181, 210, 209 and 366) distributed throughout the kindred were used for these calculations; the haplotypes for 366 were deduced from the genotypes of his five offspring and spouse. The ancestral allele at each marker was estimated as the most frequent allele on mutant gene-bearing chromosomes. These calculations were performed separately for each mutation observed. If y and x are the frequencies of the ancestral allele on mutant gene bearing and wild-type chromosomes, respectively, [thetas] is the recombination value between the mutation and any marker locus and g is the time to origin (in generations) of a mutation, then (38):
y = x + (1 - x) (1 - [thetas])g.

This equation was used to compute the joint likelihood of the ancestral allele frequency distributions at the eight loci. The value of g was estimated by maximum likelihood using the values of y, x for each marker and [thetas] from the genetic map in Figure 1B. We assumed that the mutation occurred very close to D13S175. The computer program MLD (27; Audrey Lynn and Aravinda Chakravarti, in preparation) was used for these computations.

ACKNOWLEDGEMENTS

We thank the members of the Chakravarti laboratory for their technical and intellectual support during this study. In particular, we acknowledge the help of Audrey Lynn and Carl Kashuk for assistance in data analysis. M.M.C. was partially supported by NIH Training Grant T32 GM08056 to the Department of Genetics, Case Western Reserve University; J.Z. was supported in part by grants from the Israeli Ministry of Sciences and Arts; and, A.C., and a portion of this research, was supported by NIH grant HD 28088.

REFERENCES

1. Fraser, G.R. (1976) The causes of profound deafness in childhood. Johns Hopkins University Press, Baltimore.

2. Petit, C. (1996) Genes responsible for human hereditary deafness: symphony of a thousand. Nature Genet. 14, 385-391. MEDLINE Abstract

3. Konigsmark, B.W. and Gorlin, R.J. (1976) Genetic and metabolic deafness. W. B. Saunders Co., Philadelphia.

4. Chung, C.S., Robison, O.W. and Morton, N.E. (1959) A note on deaf mutism. Ann. Hum. Genet. 23, 357-366.

5. Guilford, P., Ben Arab, S., Blanchard, S., Levilliers, J., Weissenbach, J., Belkahia, A. and Petit, C. (1994) A non-syndromic form of neurosensory, recessive deafness maps to the pericentromeric region of chromosome 13q. Nature Genet. 6, 24-28. MEDLINE Abstract

6. Guilford, P., Ayadi, H., Blanchard, S., Chaïb, H., Le Paslier, D., Weissenbach, J., Drira, M. and Petit, C. (1994) A human gene responsible for neurosensory non-syndromic deafness is a candidate homologue of the mouse sh-1 gene. Hum. Mol. Genet. 3, 989-993. MEDLINE Abstract

7. Friedman, T.B., Liang, Y., Weber, J.L., Hinnant, J.T., Barber, T.D., Winata, S., Arhya, I.N. and Asher, Jr., J.H. (1995) A gene for congenital, recessive deafness DFNB3 maps to the pericentromeric region of chromosome 17. Nature Genet. 9, 86-91. MEDLINE Abstract

8. Baldwin, C. T., Weiss, S., Farrer, L.A., De Stefano, A.L., Adair, R., Franklyn, B., Kidd, K.K., Korostishevsky, M. and Bonné-Tamir, B. (1995) Linkage of congenital, recessive deafness (DFNB4) to chromosome 7q31 and evidence for genetic heterogeneity in the Middle Eastern Druze population. Hum. Mol. Genet. 4, 1637-1642. MEDLINE Abstract

9. Fukushima, K., Ramesh, A., Srisailapathy, C.R.S., Ni, L., Chen, A., O'Neill, M., VanCamp, G., Coucke, P., Smith, S.D., Kenyon, J.B., Jain, P., Wilcox, E.R., Zbar, R.I.S. and Smith, R.J.H. (1995) Consanguineous nuclear families used to identify a new locus for recessive non-syndromic hearing loss on 14q. Hum. Mol. Genet. 4, 1643-1648. MEDLINE Abstract

10. Fukushima, K., Ramesh, A., Srisailapathy, C.R.S., Ni, L., Wayne, S., O'Neill, M.E., Van Camp, G., Coucke, P., Jain, P., Wilcox, E.R., Smith, S.D., Kenyon, J.B., Zbar, R.I.S. and Smith, R.J.H. (1995) An autosomal recessive non-syndromic form of sensorineural hearing loss maps to 3p-DFNB6. Genome Res. 5, 305-308. MEDLINE Abstract

11. Jain, P.K., Fukushima, K., Deshmukh, D., Ramesh, A., Thomas, E., Lalwani, A.K., Kumar, S., Ploplis, B., Skarka, H., Srisailapathy, C.R.S., Wayne, S., Zbar, R.I.S., Verma, I.C., Smith, R.J.H. and Wilcox, E.R. (1995) A human recessive neurosensory nonsyndromic hearing impairment locus is a potential homologue of the murine deafness (dn) locus. Hum. Mol. Genet. 4, 2391-2394. MEDLINE Abstract

12. Scott, D.A., Carmi, R., Khalil, E., Yosefsberg, S., Stone, E.M. and Sheffield, V.C. (1996) An autosomal recessive non-syndromic-hearing-loss locus identified by DNA pooling using two inbred Bedouin kindreds. Am. J. Hum. Genet. 59, 385-391. MEDLINE Abstract

13. Veske, A., Oehlmann, R., Younus, F., Mohyuddin, A., Müller-Myhsok, B., Mehdi, S.Q. and Gal, A. (1996) Autosomal recessive non-syndromic deafness locus (DFNB8) maps on chromosome 21q22 in a large consanguineous kindred from Pakistan. Hum. Mol. Genet. 5, 165-168. MEDLINE Abstract

14. Bonné-Tamir, B., De Stefano, A.L., Briggs, C.E., Adair, R., Franklyn, B., Weiss, S., Korostishevsky, M., Frydman, M., Baldwin, C.T. and Farrer, L.A. (1996) Linkage of congenital recessive deafness (gene DFNB10) to chromosome 21q22.3. Am. J. Hum. Genet. 58, 1254-1259. MEDLINE Abstract

15. Chaïb, H., Place, C., Salem, N., Chardenoux, S., Vincent, C., Weissenbach, J., El-Zir, E., Loiselet, J. and Petit, C. (1996) A gene responsible for sensorineural nonsyndromic recessive deafness maps to chromosome 2p22-23. Hum. Mol. Genet. 5, 155-158. MEDLINE Abstract

16. Chaïb, H., Place, C., Salem, N., Dod, C., Chardenoux, S., Weissenbach, J., El-Zir, E., Loiselet, J. and Petit, C. (1996) Mapping of DFNB12, a gene for non-syndromal autosomal recessive deafness, to chromosome 10q21-22. Hum. Mol. Genet. 5, 1061-1064. MEDLINE Abstract

17. Kelsell, D.P., Dunlop J., Stevens, H.P., Lench, N.J., Liang, J.N., Parry, G., Mueller, R.F. and Leigh, I.M. (1997) Connexin 26 mutations in hereditary non-syndromic sensorineural deafness. Nature 387, 80-83. MEDLINE Abstract

18. Liu, X.-Z., Walsh, J., Mburu, P., Kendrick-Jones, J., Cope, M.J.T.V., Steel, K.P. and Brown, S.D.M. (1997) Mutations in the myosin VIIA gene cause non-syndromic recessive deafness. Nature Genet. 16, 188-190. MEDLINE Abstract

19. Haefliger, J.-A., Bruzzone, R., Jenkins N.A., Gilbert, D.J., Copeland, N.G. and Paul, D.L. (1992) Four novel members of the connexin family of gap junction proteins: molecular cloning, expression, and chromosome mapping. J. Biol. Chem. 267, 2057-2064. MEDLINE Abstract

20. Elandt-Johnson, R.C. (1971) Probability models and statistical methods in genetics. John Wiley & Sons, New York.

21. Scott, D.A., Carmi, R., Elbedour, K., Duyk, G.M., Stone, E.M. and Sheffield V.C. (1995) Nonsyndromic autosomal recessive deafness is linked to the DFNB1 locus in a large inbred Bedouin family from Israel. Am. J. Hum. Genet. 57, 965-968. MEDLINE Abstract

22. Kruglyak, L., Daly, M.J., Reeve-Daly, M.P. and Lander, E.S. (1996) Parametric and nonparametric linkage analysis: A unified multipoint approach. Am. J. Genet. 58, 1347-1363.

23. Lee, S.W., Tomasetto, C., Paul, D., Keyomarsi, K. and Sager, R. (1992) Transcriptional downregulation of gap-junction proteins blocks junctional communication in human mammary tumor cell lines. J. Cell Biol. 118, 1213-1221. MEDLINE Abstract

24. Puffenberger, E.G., Kauffman, E.R., Bolk, S., Matisse, T.C., Washington, S.S., Angrist, M., Weissenbach, J., Garver, K.L., Mascari, M., Ladda, R., Slaugenhaupt, S.A. and Chakravarti, A. (1994) Identity-by-descent and association mapping of a recessive gene for Hirschprung disease on human chromosome 13q22. Hum. Mol. Genet. 3, 1217-1225. MEDLINE Abstract

25. Puffenberger, E.G., Hosoda, K., Washington, S.S., Nakao, K., deWit, D., Yanagisawa, M. and Chakravarti, A. (1994) A missense mutation of the endothelin-B receptor gene in multigenic Hirschprung's disease. Cell 79, 1257-1266. MEDLINE Abstract

26. Hästbacka, J., de la Chapelle, A., Kaitila, I., Sistonen, P., Weaver, A. and Lander, E. (1992) Linkage disequilibrium mapping in isolated founder populations: diastrophic dysplasia in Finland. Nature Genet. 2, 204-211. MEDLINE Abstract

27. Lynn, A.H., Puffenberger, E.G., Kashuk, C. and Chakravarti, A. (1995) Multipoint linkage disequilibrium mapping using ancestral recombinants. Am. J. Hum. Genet. 57, A27.

28. Bach, G., Moskowitz, S.M., Tieu. P.T., Matynia, A. and Neufeld, E.F. (1993) Molecular analysis of Hurler syndrome in Druze and Muslim Arab patients in Israel: multiple allelic mutations of the IDUA gene in a small geographic area. Am. J. Hum. Genet. 53, 330-338. MEDLINE Abstract

29. Heinisch, U., Zlotogora, J., Kafert, S. and Gieselmann, V. (1995) Multiple mutations are responsible for the high frequency of metachromatic leukodystrophy in a small geographic area. Am. J. Hum. Genet. 56, 51-57. MEDLINE Abstract

30. Zlotogora, J., Gieselmann, V. and Bach, G. (1996) Multiple mutations in a specific gene in a small geographic area: a common phenomenon? Am. J. Hum. Genet. 58, 241-243. MEDLINE Abstract

31. Jaber, L., Merlob, P., Bu, X., Rotter, J.I. and Shohat, M. (1992) Marked parental consanguinity as a cause for increased major malformations in an Israeli Arab community. Am. J. Med. Genet. 44, 1-6. MEDLINE Abstract

32. Fisher, R.A. (1930) The distribution of gene ratios for rare mutations. Proc. Roy. Soc. Edinburgh 50, 205-220.

33. Zelante, L., Gasparini, P., Estivill, X., Melchionda, S., D'Agruma, L., Govea, N., Milá, M., Della Monica, M., Lufti, J., Shohat, M., Mansfield, E., Delgrosso, K., Rappaport, E., Surrey, S., and Fortina, P. (1997) Connexin26 mutations associated with the most common form of non-syndromic neurosensory autosomal recessive deafness (DFNB1) in Mediterraneans. Hum. Mol. Genet. 6, 1605-1609. MEDLINE Abstract

34. Miller, S.A., Dykes, D.D. and Polesky, H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16, 1215. MEDLINE Abstract

35. Lathrop, G.M., Lalouel, J.M., Julier, C. and Ott, J. (1984) Strategies for multilocus linkage analysis in humans. Proc. Natl. Acad. Sci. USA 81, 3443-3446. MEDLINE Abstract

36. Dib, C., Fauré, S., Fizames, C., Samson, D., Drouot, N., Vignal, A., Millaseau, P., Marc, S., Hazan, J., Seboun, E., Lathrop, M., Gyapay, G., Morissette, J. and Weissenbach, J. (1996) A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 380, suppl.

37. Warburton, D., Shaw, S.H., Matice, T.C., Kalchikov, S. and Fischer, S. (1995) Third International Workshop on Human Chromosome 13 Mapping Tarrytown, New York.

38. Cox, T.K., Kerem , B., Rommens, J., Iannuzzi, M.C., Drumm, M., Collins, F.S., Dean, M., Tsui, L.-C. and Chakravarti, A. (1989) Mapping of the cystic fibrosis gene using putative ancestral recombinants. Am. J. Hum. Genet. 45, A136.

*To whom correspondence should be addressed. Tel: +1 216 368 5847; Fax + 1 216 368 5857; Email: axc39@po.cwru.edu

This page is maintained by OUP admin. Last updated Sat Oct 18 13:41:19 BST 1997. Part of the OUP Journals World Wide Web service.
Copyright Oxford University Press, 1997


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Med. Genet.Home page
D Jeganathan, R Chodhari, M Meeks, O Faeroe, D Smyth, K Nielsen, I Amirav, A S Luder, H Bisgaard, R M Gardiner, et al.
Loci for primary ciliary dyskinesia map to chromosome 16p12.1-12.2 and 15q13.1-15.1 in Faroe Islands and Israeli Druze genetic isolates
J. Med. Genet., March 1, 2004; 41(3): 233 - 240.
[Full Text] [PDF]

Home page
 Physiol. Rev.Home page
J. C. SAEZ, V. M. BERTHOUD, M. C. BRANES, A. D. MARTINEZ, and E. C. BEYER
Plasma Membrane Channels Formed by Connexins: Their Regulation and Functions
Physiol Rev, October 1, 2003; 83(4): 1359 - 1400.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
M RamShankar, S Girirajan, O Dagan, H M Ravi Shankar, R Jalvi, R Rangasayee, K B Avraham, and A Anand
Contribution of connexin26 (GJB2) mutations and founder effect to non-syndromic hearing loss in India
J. Med. Genet., May 1, 2003; 40(5): e68 - 68.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Oshima, T. Doi, K. Mitsuoka, S. Maeda, and Y. Fujiyoshi
Roles of Met-34, Cys-64, and Arg-75 in the Assembly of Human Connexin 26. IMPLICATION FOR KEY AMINO ACID RESIDUES FOR CHANNEL FORMATION AND FUNCTION
J. Biol. Chem., January 10, 2003; 278(3): 1807 - 1816.
[Abstract] [Full Text] [PDF]

Home page
 Arch Otolaryngol Head Neck SurgHome page
S. Marlin, E.-N. Garabedian, G. Roger, L. Moatti, N. Matha, P. Lewin, C. Petit, and F. Denoyelle
Connexin 26 Gene Mutations in Congenitally Deaf Children: Pitfalls for Genetic Counseling
Arch Otolaryngol Head Neck Surg, August 1, 2001; 127(8): 927 - 933.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
L Van Laer, P Coucke, R F Mueller, G Caethoven, K Flothmann, S D Prasad, G P Chamberlin, M Houseman, G R Taylor, C M Van de Heyning, et al.
A common founder for the 35delG GJB2 gene mutation in connexin 26 hearing impairment
J. Med. Genet., August 1, 2001; 38(8): 515 - 518.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
A Murgia, E Orzan, R Polli, M Martella, C Vinanzi, E Leonardi, E Arslan, and F Zacchello
Cx26 deafness: mutation analysis and clinical variability
J. Med. Genet., November 1, 1999; 36(11): 829 - 832.
[Abstract] [Full Text]

Home page
 Hum Mol GenetHome page
E. Maestrini, B. P. Korge, J. Ocana-Sierra, E. Calzolari, S. Cambiaghi, P. M. Scudder, A. Hovnanian, A. P. Monaco, and C. S. Munro
A missense mutation in connexin26, D66H, causes mutilating keratoderma with sensorineural deafness (Vohwinkel's syndrome) in three unrelated families
Hum. Mol. Genet., July 1, 1999; 8(7): 1237 - 1243.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
P J Coucke, P Van Hauwe, L A Everett, O Demirhan, Y Kabakkaya, N L Dietrich, R J H Smith, E Coyle, W Reardon, R Trembath, et al.
Identification of two different mutations in the PDS gene in an inbred family with Pendred syndrome
J. Med. Genet., June 1, 1999; 36(6): 475 - 477.
[Abstract] [Full Text]

Home page
 J. Med. Genet.Home page
R. Rabionet and X. Estivill
Allele specific oligonucleotide analysis of the common deafness mutation 35delG in the connexin 26 (GJB2) gene
J. Med. Genet., March 1, 1999; 36(3): 260 - 261.
[Abstract] [Full Text]

Home page
 NeurologyHome page
T. Stojkovic, P. Latour, A. Vandenberghe, J. F. Hurtevent, and P. Vermersch
Sensorineural deafness in X-linked Charcot-Marie-Tooth disease with connexin 32 mutation (R142Q)
Neurology, March 1, 1999; 52(5): 1010 - 1010.
[Abstract] [Full Text]

Home page
 J. Med. Genet.Home page
M J Parker, H Fortnum, I D Young, and A C Davis
Variations in genetic assessment and recurrence risks quoted for childhood deafness: a survey of clinical geneticists
J. Med. Genet., February 1, 1999; 36(2): 125 - 130.
[Abstract] [Full Text]

Home page
 NEJMHome page
R. J. Morell, H. J. Kim, L. J. Hood, L. Goforth, K. Friderici, R. Fisher, G. Van Camp, C. I. Berlin, C. Oddoux, H. Ostrer, et al.
Mutations in the Connexin 26 Gene (GJB2) among Ashkenazi Jews with Nonsyndromic Recessive Deafness
N. Engl. J. Med., November 19, 1998; 339(21): 1500 - 1505.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
E. D. Lynch, M. K. Lee, J. E. Morrow, P. L. Welcsh, P. E. León, and M. King
Nonsyndromic Deafness DFNA1 Associated with Mutation of a Human Homolog of the Drosophila Gene diaphanous
Science, November 14, 1997; 278(5341): 1315 - 1318.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (103)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Carrasquillo, M. M.
Right arrow Articles by Chakravarti, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carrasquillo, M. M.
Right arrow Articles by Chakravarti, A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?