Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (93)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Abdelhak, S.
Right arrow Articles by Weil, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abdelhak, S.
Right arrow Articles by Weil, D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 2247-2255


Clustering of mutations responsible for branchio-oto-renal (BOR) syndrome in the eyes absent homologous region (eyaHR) of EYA1
Introduction
Results And Discussion
   EYA1 alternative transcripts and gene structure
   Mutations in BOR-affected individuals
Materials And Methods
   Patients
   cDNA isolation
   Exon positions and intron-exon boundaries
   Southern blot analysis
   Genomic PCR amplification and DNA sequencing
Acknowledgements
References


Clustering of mutations responsible for branchio-oto-renal (BOR) syndrome in the eyes absent homologous region (eyaHR) of EYA1

Clustering of mutations responsible for branchio-oto-renal (BOR) syndrome in the eyes absent homologous region (eyaHR) of EYA1 Sonia Abdelhak1, Vasiliki Kalatzis1, Roland Heilig2, Sylvie Compain1, Delphine Samson2, Christophe Vincent1, Fabienne Levi-Acobas1, Corinne Cruaud2, Martine Le Merrer3, Michèle Mathieu4, Rainer König5, Jacqueline Vigneron6, Jean Weissenbach2, Christine Petit1,* and Dominique Weil1

1Unit de Génétique des Déficits Sensoriels, CNRS URA 1968, Institut Pasteur, 25 rue du Dr. Roux, 75724 Paris Cedex 15, France, 2Généthon Human Research Centre, 1 rue de l'Internationale, 91000 Evry, France, 3Unité de Recherche sur les Handicaps Génétiques de l'Enfant, INSERM U393, Hôpital Necker-Enfants Malades, 149 rue de Sèvres, 75743 Paris Cedex 15, France, 4Centre Hospitalier Régional Universitaire d'Amiens, Hôpital Nord, Place V. Pauchet, 80054 Amiens Cedex, France, 5Klinikum Der Johann Wolfgang Goethe-Universität, Institut für Humangenetik, Theodor- Stern Kai 7, D-60590 Frankfurt, Germany and 6Service de Néonatalogie-Génétique, Maternité Régionale, 10 rue du Dr Heydenreich, 54042 Nancy Cedex, France

Received July 17, 1997; Revised and Accepted September 5, 1997

DDBJ/EMBL/GenBank accession nos AJ000097 and AJ000098

Branchio-oto-renal (BOR) syndrome is an autosomal dominant disorder, characterised by the association of branchial, otic and renal anomalies with variable degrees of severity. We have recently identified EYA1, a human homologue of the Drosophila eyes absent gene, as the gene underlying this syndrome. The products of both genes share a highly conserved 271 amino acid C-terminal region (eyaHR). The eyaHR was also found in the products of two other human genes (EYA2 and EYA3), demonstrating the existence of a novel gene family. We report here on the complete genomic structure of EYA1. This gene consists of 16 coding exons and extends over 156 kb. It encodes various alternatively spliced transcripts differing only in their 5' regions. Sequence analysis of the entire EYA1 coding region was performed for 20 unrelated patients affected by BOR syndrome, and six novel mutations were identified. Among these mutations, two are missense mutations, highlighting amino acid residues essential for the function of the EYA1 protein, and one mutation comprises a de novoAlu insertion into an exon. This insertion presumably occurs by retrotransposition, and the mobile Alu element has a poly(A) tail that is unstable throughout generations. To date, 14 mutations have been detected in BOR patients, all of which are different. However, all the mutations are located within or in the immediate vicinity of the eyaHR; the significance of this clustering is discussed.

INTRODUCTION

Branchio-oto-renal (BOR) syndrome, first described by Melnick et al., is characterised by the association of branchial anomalies (i.e. pre-auricular pits and branchial fistulae or cysts), otic anomalies affecting the outer, middle and/or inner ear that frequently lead to hearing loss (sensorineural, conductive or mixed) and a wide spectrum of renal anomalies ranging from mild hypoplasia to lethal bilateral renal aplasia (1 ). The clinical features of BOR syndrome are indicative of an early developmental defect. This syndrome is transmitted as an autosomal dominant disorder with high but incomplete penetrance and variable expressivity (2 -4 ). Hearing loss is the most constant feature of BOR syndrome, detected in 93% of affected individuals. This syndrome accounts for 2% of profoundly deaf children (5 ).


Figure 1. Sequence and exon-intron structure of the alternative isoforms of EYA1. (a) The complete nucleotide and amino acid sequence of the cDNA EYA1A. Exon-intron boundaries are marked by a vertical line. (b) and (c) Nucleotide and amino acid sequence of the N-terminal region of the cDNAs EYA1B and EYA1C respectively. For each cDNA sequence, the initiator methionine codon is in bold, the first stop before the initiator codon is underlined and the first codon common to the three cDNAs is circled. The additional exon 1', present in EYA1B and EYA1C, is indicated by ^, and the nucleotide sequence of the additional exon -1, present only in EYA1C and the corresponding ORF are indicated in lower case and in italics.

The gene responsible for BOR syndrome was mapped to the long arm of chromosome 8 (6 ,7 ). By linkage studies of BOR-affected families and molecular analysis of a deletion carried by a patient, this gene was localised to a 7 cM interval between the markers D8S543 and D8S286 (8 ,9 ). Subsequently, by the characterisation of another deletion associated with an 8q translocation, dir ins (8 )(q24.11; q13.3; q21.13) (10 ), the gene interval was redefined to ~500 kb (11 ). Recently, we isolated the gene underlying BOR syndrome using a positional cloning strategy (12 ). This gene was called EYA1 in reference to the strong sequence homology between the 271 amino acid C-terminal region of the predicted protein and the Drosophila eya gene product (69% identity and 88% similarity). Two cDNAs encoding a 559 amino acid protein (predicted mol. wt 61.2 kDa) were reconstructed, and found to differ in the length of their 3' untranslated region (UTR). The limits of the last nine exons, encoding 317 C-terminal amino acids and the 3' UTR, were defined and eight mutations subsequently were detected in BOR-affected patients (12 ). In addition, two mutations were identified in BO affected patients (individuals presenting with branchial and otic anomalies but without renal anomalies), thus demonstrating that EYA1 also underlies BO syndrome (13 ).

We have determined the complete gene structure of EYA1 and report here on the existence of various alternatively spliced transcripts and describe six novel mutations segregating in BOR-affected families.

RESULTS AND DISCUSSION

EYA1 alternative transcripts and gene structure

During the reconstitution of the EYA1 cDNAs, we initially observed two cDNAs differing only in their 3' UTRs (12 ). These cDNAs, isolated from total 9-week foetus RNA, are hereafter referred to as EYA1A (YIO260). Subsequently two additional cDNAs, EYA1B (AJ000097) and EYA1C (AJ000098), were isolated from the same mRNA source (see Materials and Methods) that differed from EYA1A in the 5' region. EYA1B has an insertion of 128 bp at nucleotide position +25 (the first base of the initiator codon of EYA1A is designated as position +1, Fig. 1 ). EYA1C differs from EYA1B by the replacement of the 5' region, extending from position -26 to -148, with a 584 bp sequence (Fig. 1 ). We previously reported on the cDNA sequence of the murine homologue of EYA1 which had the same 5' sequence as EYA1A (12 ). We (data not shown) and others (14 ) have identified an alternative murine cDNA sequence which is homologous to EYA1B. Consistent with these various cDNA forms, several bands were observed on northern blots containing human and mouse mRNA (12 ,14 ). These results suggested the existence of alternatively spliced mRNA transcripts.

To investigate this possibility, we determined the complete gene structure of EYA1. The terminal 3' exon, exon 16, was identified previously (and referred to as exon H) by partial sequencing of PAC clone 10910 (Fig. 2 ). The entire sequence of two adjacent overlapping P1s, 4405 and 9480 (116 kb), known to contain at least part of EYA1 (12 ) was established and compared with the sequence of the three EYA1 cDNAs. Thirteen exons were determined, of which five, exons 3-7, were newly identified (Fig. 2 ). In order to search for the remaining 5' exons, subclones of the next adjacent PAC clone (11083), were selected by hybridisation with the three cDNAs and analysed (see Materials and Methods and Fig. 2 ). A total of four exons were identified. Exon 2 was common to all three cDNAs. Exon 1 was present in EYA1A and EYA1B. Between exon 1 and exon 2, an additional exon was detected, exon 1', in EYA1B and EYA1C. Another exon, exon -1, located upstream of exon 1, was identified in the 5' end of EYA1C. Moreover, EYA1C contains only the 3' part of exon 1; this correlates with the existence of a consensus 3' acceptor splice site YnNYAG/G within this exon which could act as a cryptic splice site (15 ). All exon-intron junction sequences conform to the GT/AG rule (Table 1 ), except intron XII which has a GC donor site. The GT -> GC replacement has been reported as the most frequent 5' splice site variant (16 ), and this substitution has been proven to allow correct splicing (17 ). The 17 introns vary in size from 0.1 to 27.5 kb. EYA1 has been estimated to extend over 156 kb (Fig. 2 ) (see Materials and Methods). The sequence of the three cDNA isoforms has been derived from several independent cDNA clones and confirmed by genomic sequences.

Table 1 . Splice site sequences and organisation of EYA1
Exon Size (bp) Intron Size (kb) Donor site Acceptor site
1 583 -I 5.5 gctGTAAG TTTTaCCCCTgaTCaCAGGb
1 175 I 1.5 CAGGTAAG aaggC(T/g)TCTTgTCTTTAGG
1' 128 I' 23 AAGGTGAG TgTTgTTTaTTTTTgTAGt
2 78 II 10 CAGGTAAG TTTgTTTTTgTTTTCCAGc
3 70 III 0.32 CAaGTAAG gTCaTTTCTgaCaaaTAGc
4 156 IV 4 AtGGTGAG TaTCaCTaaCTgaTTTAGG
5 138 V 17.8 AAGGTctG CTTTTCaTTTTgTTTTAGG
6 83 VI 0.4 CAGGTAAt TgTggTTTgaTTTggTAGG
7 187 VII 27.1 CAGGTAAt CTTCCTaTaTTCCTgCAGa
8 140 VIII 1.9 CAGGTAcG TTggTTCTTCCTTTgTAGa
9 84 IX 25.1 AgGGTGAG gTCaTaTTCTTaTTTTAGG
10 90 X 27.5 AAGGTGAG aTTTTaaTTgCaTTTTAGG
11 69 XI 0.1 gAGGTGAat TTTCTTgCaTaTaaaTAGc
12 161 XII 0.9 gAGGCAAG gTgCTTTTaaaTCCTCAGG
13 115 XIII 0.1 CcGGTGAG TTCTTTTTgTTCTCaTAGG
14 122 XIV 4.1 tAGGTGAG TTTaTTTTTgTTCaCTAGG
15 101 XV 6 AAGGTGAG TgTgTgCCTCTgCTg(C/T)AGc
16 1275/1984a        
    Consensus   C/AAGGTRAG YYYYYYYYYYYYYYNYAGG
aThe size of the last exon differs according to the polyadenylation site used (12).
bCorresponds to a cryptic splice site in exon 1.


Figure 2. Schematic representation of the EYA1 gene structure and cDNAs. (a) P1/PAC contig spanning EYA1. PAC clones are indicated in italics and P1 clones in standard print. (b) Gene structure of EYA1. Open boxes represent coding exons, filled boxes non-coding exons (exon size is not to scale) and shaded boxes correspond to the exons of the eya homologous region (eyaHR). (c) Illustration of the three EYA1 isoforms.

EYA1A is predicted to encode a 559 amino acid protein. The ATG start codon was identified in exon 1 (Figs 1 and 2 ) within an adequate Kozak consensus sequence (RNNatgY) (18 ), and was preceded by a stop codon 71 bp upstream. The additional exon, exon 1', contained in EYA1B, creates a frameshift resulting in a stop codon in the sequence derived from this exon. Therefore, either this isoform is an untranslated transcript or it is translated using a different start codon. We favour the latter hypothesis, since an adequate Kozak consensus sequence (YNNatgG) was found in exon 1' preceded by a stop codon 63 bp upstream. This ATG was also proposed as the initiator codon for the alternative cDNA transcript of the murine homologue eya1 (14 ). Accordingly, the proteins encoded by EYA1A and EYA1B should differ only in their N-terminal region (Fig. 1 ), exon 1 being used as a coding exon in EYA1A and a non-coding exon in EYA1B. The protein resulting from EYA1B is predicted to be 592 amino acids long. In mammals, we know of one situation which is reminiscent of the present one. In the tumour suppressor gene INK4A (also called MTS1 or CDKN2), one exon has been shown to be used in two different reading frames, thus resulting in two unrelated proteins (p16INK4a and p19ARF) (19 ,20 ). In contrast, the use of overlapping reading frames is very common in viral systems where it is one of the strategies used to create protein diversity (21 ). EYA1C has two overlapping open reading frames (ORFs). One of the two predicted ORFs extends from the beginning of the cDNA for 156 amino acids. As this ORF has no methionine initiation codon, this sequence probably extends further 5'. The second ORF is identical to that of EYA1B. However, for this second ORF, the first upstream stop codon is 369 nucleotides distant. Therefore, the two overlapping ORFs of cDNA EYA1C could give rise to two distinct proteins. Alternately, the two ORFs could be translated into a single protein by ribosomal frameshifting. Translational frameshifting has been largely demonstrated in bacteria, yeast and eukaryotic viruses (for a review see ref. 22 ). In humans, translational frameshifting has been described for ornithine decarboxylase antizyme (23 ) and has been proposed for F18, a newly identified gene (24 ).

5' and 3' UTR variations and alternate splicing of full-length transcripts are used to generate heterogeneous mRNA populations and suggest multifaceted control of gene expression (25 -28 ). In this regard, it would be of particular interest to investigate the spatio-temporal distribution of the different messengers, as well as their encoded protein products during inner ear and kidney development.

Mutations in BOR-affected individuals

We previously searched for mutations in the last nine EYA1 exons of BOR patients, and reported eight mutations. In the present study, all EYA1 coding exons were analysed in 20 unrelated BOR-affected individuals, 16 of which were familial cases.DNA rearrangements. Genomic DNA from BOR-affected patients and their relatives was first analysed by Southern blotting and hybridisation with probes corresponding to each of the 17 EYA1 exons (see Materials and Methods). DNA rearrangements were observed in three families.

In family 14, hybridisation with a probe for exon 9 to Southern blots containing DNA from the two affected individuals resulted in a band shift. Using the sequence data of the EYA1 region, this rearrangement was analysed further. Amplification using a primer specific to a sequence from intron VIII and a primer 9.7 kb downstream in intron IX (see Materials and Methods) resulted in two products: a 10 kb product corresponding to the normal amplimer, and a smaller 4.6 kb product. Sequencing of the smaller fragment identified a 5.6 kb deletion starting from nucleotide position 39 of exon 9 and ending into intron IX.

Hybridisation with probes corresponding to exons 11, 12, 13, 14 and 15 as well as to a sequence of intron X (located 9 kb upstream of exon 11), to Southern blots containing DNA from affected individuals from family 13, resulted in a signal of reduced intensity. Hybridisation with a probe for exon 10 did not result in the reduction of signal intensity, whereas hybridisation with a probe for exon 16 resulted in a band shift. Altogether, these results indicate a distance of 20-37 kb in this family for a deletion extending from intron X to exon 16.

For family 9, in which the mother and daughter are affected, hybridisation with a probe for exon 10 resulted in two additional MspI and TaqI fragments for both patients as compared with control individuals. One of these additional two bands differed in size between the two individuals (Fig. 3 a and b). Amplification with primers flanking exon 10 (Table 4 ) resulted in a 310 bp fragment, corresponding to the normal amplimer, for both the affected mother and daughter and in an additional fragment of ~700 and 650 bp respectively. Sequencing of each of these products confirmed that the 310 bp fragment corresponds to the normal sequence of exon 10 and showed that the larger fragments correspond to exon 10 with an inserted Alu element in the opposite orientation. A duplication of 10-16 bp had occurred at the insertion target site, and the 3' sequence of the Alu element was followed by a long poly(A) tail [the exact length of the duplicated target sequence was indeterminate, owing to the poly(A) tract] (Fig. 3 c). These features correspond to properties of retrotransposition of a non-viral element (29 ). The site of insertion was adjacent to a sequence that completely fits the consensus sequence (5'TTAAAA/3'AATTTT) proposed by Jurka as the signal sequence for staggered nicks prior to integration of mammalian retrotransposons (30 ). The difference in size between the larger amplified fragments of the mother and daughter was due to a difference in the length of the poly(A) tail, which was reduced from poly(A)97 to poly(A)31 when transmitted from mother to daughter. This instability contrasts with a previous report which shows that the polydeoxyadenylate tract of Alu repetitive elements is polymorphic but stable within a given family (31 ). The transposition of the Alu element was a de novo insertion as it was not present in the DNA from the maternal grandparents (data not shown). An increasing number of reports have shown that the transposition of Alu elements, as well as that of L1 or other mobile elements, is a source for mutations which give rise to genetic diseases (32 -39 ). The comparison of the newly inserted Alu element with a database for repeated elements (Pythia) showed that it belongs to the Sb1 Alu subfamily. This subfamily, which corresponds to one of the most recent evolutionary branches of Alu elements (40 ), is transcriptionally active (41 ). The insertion of mobile elements is likely to result in exon skipping, as demonstrated by other reports (37 -39 ).


Figure 3. Detection of DNA rearrangment in the BOR-affected patients of family 9 (a and b) and illustration of the Alu insertion in exon 10 of EYA1 (c). Hybridisation with a probe corresponding to exon 10 to Southern blots containing MspI- (a) and TaqI- (b) digested genomic DNA. Note for both digestions the difference in size of the additional band for both the mother and daughter [sequencing revealed that this was due to a difference in the length of the poly(A) tract]. The transposed Alu element is flanked by a direct repeat and the insertion site is adjacent to a 5' nicking signal sequence (with respect to the orientation of the Alu element) (underlined) described by Jurka (30).


Figure 4. Schematic representation of all the identified mutations in EYA1 of BOR- and BO- (underlined) affected patients. Nomenclature is as described in (42). For key, see legend to Figure 2.

Point mutations. Sequence analysis of the EYA1 coding exons, starting from exon 1 to 16, was carried out on 20 unrelated affected individuals. When a mutation was detected, the corresponding exon of other available affected family members was sequenced. Seven single base changes, corresponding to silent polymorphisms (Table 2 ), and three point mutations were detected.

Table 2 . Polymorphisms in the coding sequence of EYA1
Exon Nucleotide change Amino acid change
1' 107T -> A None
2 66G -> A none
6 510A -> C none
8 741C -> A none
12 1179C -> T none
12 1233T -> C none
16 1656T -> C none
Nomenclature used is as described in (49). Nucleotide position +1 corresponds to the first base of the initiation codon of the cDNA EYA1A, except for exon 1', in which nucleotide position +1 corresponds to the first base of the initiation codon of the cDNA EYA1B.

Table 3 . Summary of presently known EYA1 mutations in BOR- and BO-affected patients
Type of case Individual Location Nucleotide change Predicted effect on coding sequence
BO familialb 21 exon 4 297del frameshift
BOR familiala 1 exon 8 823C -> T R275X
BOR sporadica 23 exon 8 755insC frameshift
BO familialb 8 exon 9 870insGT frameshift
BOR familial 14 exon 9 del5.6 kb deletion
BOR familial 9 exon 10 insAlu exon skipping
BOR familiala 11 exon 12 1251T -> CC frameshift
BOR sporadica 34 exon 13 1360TC S454P
BOR familial 7 exon 13 1359insC frameshift
BOR familiala 40 exon 13 1372T -> AGAGC frameshift
BOR familial 24 exon 14 1414T -> G L472R
BOR familiala 48 exon 14 1498+2T -> G aberrant splicing
BOR familial 10 exon 15 1599+5G -> C aberrant splicing
BOR sporadica 22 exon 15 1555ins4 frameshift
BOR sporadica 4 exons 11-15 del5.8-7 kb deletion
BOR familial 13 exons 11-16 del20-37 kb deletion
Nomenclature used is as described in (49). For consistency with our previous reports (12,13), nucleotide position +1 corresponds to the initial base of the initiation codon of EYA1A, and amino acid position +1 corresponds to the initiation codon of EYA1A. In families 7 and 13 one non-penetrant carrier was observed out of four and five carriers for each family respectively.a(12); b(13).

In family 10, all affected members carried a G -> C transversion at the +5 position of the intron XV splice donor site. This transversion was not observed in the sequences from 50 unaffected control individuals. Moreover, several reports have described replacement of the G in position +5 of splice donor sites in different genetic diseases, thus suggesting that mutations at this position prevent normal splicing of the upstream exonic sequence (42 -45 ). Therefore, this mutation is likely to be responsible for the disease by impairing normal splicing of the penultimate exon.

In family 7 and family 24, a missense mutation was detected in all affected members. In family 7, the mutation resulted in a Ser -> Pro substitution at codon 454 (TCG -> CCG) in exon 13 (mutation S454P). In family 24, the mutation resulted in a Leu -> Arg substitution at codon 472 (CTC -> CGC) in exon 14 (mutation L472R). These two substitutions were absent in the 50 control individuals. S454P and L472R produce dramatic changes by introducing amino acids with different hydropathy. Moreover, the targeted serine residue is conserved among the EYA1 gene products of man and mouse, as well as the eya gene product of Drosophila, and the targeted leucine residue is common to all the eya family members isolated so far (12 ,14 ). Therefore, S454P and L472R are likely to give rise to the disease, suggesting that these two serine and leucine residues, of the eyaHR, are essential for the structure and/or function of the EYA1 protein.

Sequence analysis of the coding region, including splice site junctions of EYA1, as well as Southern blot analysis of the coding region and the 5' and 3' UTRs, failed to detect anomalies in 14 of the 20 patients. Among these 14 patients, 10 represented familial cases and, for six of them, linkage analysis was consistent with the involvement of EYA1 (8 ). Since no evidence for genetic heterogeneity has ever been reported, we assume that, for these 14 patients, the mutations lie either in the promoter region, within an intron, in the 3' UTR or in the most 5' sequences which have not yet been studied extensively.

Table 4 . Sequences of the primers designed for the amplification and sequencing of EYA1 exons
Exon Forward primer 5'-3' Reverse primer 5'-3' Amplicon size (bp)
1 CACTGAAGCAGAGTAACAACA CCAACAGAGGCTGTTACTATT 211
1' GGGACTTTTGTGCAAGTGTG GACAACTGAAATCATAACCAC 324
2 TTATGATATATGTTCAGTTAGGG CATACACAGGGACATTACATG 292
3 CGCAGGTCACAAAGACCAAA AGATGGAACATGTGGGCACA 292
4 GTGATGTGGTTGTTAATCGGT ACACAGAAGGTGACAACACTG 344
5 GAGATAAGATTGGGGAAGCAT CCAATCCAGTTGCCATCATC 361
6 GCTATTTTCCTGTACCCACATT GAAAGCTCTCACTTATAAACAG 247
7 GGCTCAGAAACCCAAACATAC GTGCAACCACTGCATGAATAT 376
8 AGGCTAATCTTGGCACCATGG CACTGCTGTTTACGTAGCAGG 290
9 TGAATAACAGCTTTCTCAGCC GACTATATAGTTCTTCTCCATTT 269
10 CTTTCAGCCTCTCCCAATGC ACCAACAAACTCCTGTCTCAC, 310
11 ACCTACTGATTGACATAGTTGA ACTATAAAAGGGAGATGGTCAC
12 GTGACCATCTCCCTTTTATAGT ATGAAACTGCCCAAATAGAAGC 584
13 AAATCTGGAGGCTGGTATTC ATGAACAAGCACGAGCATTGC
14 GCAATGCTCGTGCTTGTTCAT TGCTTTATGTTTCTCTTACGTC 622
15 TGCTGTGGCACATACAACCC AGAGTACTGCACATATTCATCA 387
16 AGCTGGCATTTCAATGATACT GTGGCAGACACATAACGCTG 457
Exons 11 and 12, 13 and 14 were amplified in pairs.

Figure 4 and Table 3 summarise all the mutations we have detected in BOR- and BO-affected families to date. All the reported 14 mutations are different, demonstrating the heterogeneity of mutations in BOR-affected patients. Nevertheless, all the mutations occurred in exons belonging, or immediately adjacent, to the eyaHR [also called Eya box (14 )]. This clustering of mutations in the eyaHR, which represents half of the coding sequence, is intriguing. Mutations outside this domain may either give rise to a lethal defect or to a discrete undetected phenotype. We favour the latter hypothesis for the following reasons: one of the two patients carrying a deletion of the whole gene was exclusively affected by BO syndrome (11 ,46 ), and the only mutation that has been detected outside the eyaHR was also present in a BO-affected patient (13 ). Based on these observations, we hypothesise that most of the mutations detected in BOR patients could act as dominant-negative mutations. The clustering of mutations in eyaHR delineates the crucial role of this highly conserved domain and will guide further functional studies of the EYA1 protein.

MATERIALS AND METHODS

Patients

Clinical studies of BOR families were previously described (8 ).

cDNA isolation

Oligo(dT) and random primed cDNA populations were generated from total 9 week human foetus poly(A)+ RNA, and amplified using the marathon cDNA amplification kit (Clontech) according to the manufacturer's recommendations. Specific primers for the 5' RACE-PCR were EYA30R3.2: 5' GAATGAGCGAGAGTGCTTTCAGGGCCAGTG 3', specific to exon 13, for the first amplification, and 30BR2 nest: 5' CAGCCAGGCTTCCCTCTTAGCTGGACCA 3', a nested primer also specific to exon 13, for the second amplification. Primers for the 3' RACE-PCR were 26F3: 5' CCACTCCTTGCTTACTGGGTCCTACGCCAA 3', specific to exon 9, for the first amplification, and EYA30BF2 nest: 5' TGGTCCAGCTAAGAGGGAAGCCTGGCTG 3', a nested primer specific to exon 13, for the second amplification. In order to isolate the complete 5' sequence for each cDNA isoform, 5' RACE-PCR amplifications were performed using the PCR primer EYA30R3.2, and the second amplification was performed with the primers NEYAKnest: 5' GAGGAAACAGCAACATCTGAACTGGCTTGAG 3', specific to exon 2 and present in all the cDNA isoforms.

Exon positions and intron-exon boundaries

Two overlapping P1s, 4405 and 9480, mapping to the centre of the gene interval were sequenced as described (12 ). To determine the intron-exon boundaries, genomic DNA sequences of the two P1s were compared with the EYA1 cDNA sequences. Subclones of the adjacent PACs 11083 and 10910, containing the 5' and 3' exons respectively, were identified by hybridisation with subclones of the EYA1 cDNAs. Exon-intron boundaries, and the intronic sequences flanking each exon, were determined by sequencing positive subclones with primers derived from the EYA1 cDNA sequences. Intronic sequences flanking the exons are available upon request. The distance between these exons was deduced from either the assembled contig of genomic sequences of the P1s 4405 and 9480, or by long-range PCR for the exons lying outside this contig [performed using the Boehringer Mannheim Expand PCR system as described (47 )].

Southern blot analysis

Southern blots containing EcoRI-, MspI-, PstI- or TaqI-digested DNA, from both familial and sporadic cases, were prepared according to standard techniques. In order to detect possible DNA rearrangements in BOR-affected patients, 14 probes covering the entire EYA1 cDNA were derived by PCR amplification and hybridised to the Southern blots.

Genomic PCR amplification and DNA sequencing

For the detection of point mutations, two sets of specific primers were chosen in the intronic sequences flanking each exon at a distance of at least 60 bp from the corresponding exon-intron junction (Table 4 ). PCR amplification and DNA sequencing conditions were as described (48 ). In order to determine the extent of the deletion carried by the affected individuals of family 14, long-range PCR was carried out as described above using the forward primer from the intronic sequence of exon 9 (Table 4 ) and primer 24R: 5' TCTACAATCAATCCTCCCTC 3' as the reverse primer.

ACKNOWLEDGEMENTS

We thank Laurent Sainte-Marthe and Simone Bentolila for aid with computer analysis; Sylvie Gisselbrecht, Joëlle Marie and Françoise Denoyelle for helpful discussions; and Jacqueline Levilliers, Elisabeth Verpy and Polonca Küssel for critical reading of the manuscript. S.A. is supported by the Association Française contre le Myopathies (AFM) and V.K. is supported by the Fondation pour la Recherche Médicale. This work is supported by grants from the AFM (4402 MG-1996) and the Commission of the European Community (PL95-1324)

REFERENCES

1 Melnick, M., Bixler, D., Nance, W., Silk, K. and Yune, H. (1976) Familial branchio-oto-renal dysplasia: a new addition to the branchial arch syndromes. Clin. Genet., 9, 25-34. MEDLINE Abstract

2 Stoll, C., Roth, M.-P., Hessemann, H. and Paira, M. (1983) La dysplasie branchio-oto-rénale. Arch. Fr. Pédiatr., 40, 763-766. MEDLINE Abstract

3 Heimler, A. and Lieber, E. (1986) Branchio-oto-renal syndrome: reduced penetrance and variable expressivity in four generations of a large kindred. Am. J. Med. Genet., 25, 15-27. MEDLINE Abstract

4 König, R., Fuchs, S. and Dukiet, C. (1994) Branchio-oto-renal (BOR) syndrome: variable expressivity in a five-generation pedigree. Eur. J. Pediatr., 153, 446-450. MEDLINE Abstract

5 Fraser, F.C., Sproule, J.R. and Halal, F. (1980) Frequency of the branchio-oto-renal (BOR) syndrome in children with profound hearing loss. Am. J. Med. Genet., 7, 341-349. MEDLINE Abstract

6 Smith, R.J.H., Coppage, K.B., Ankerstjerne, J.K.B., Capper, D.T., Kumar, S., Kenyon, J., Tinley, S., Comeau, K. and Kimberling, W.J. (1992) Localization of the gene for branchiootorenal syndrome to chromosome 8q. Genomics, 14, 841-844.

7 Kumar, S., Kimberling, W.J., Kenyon, J.B., Smith, R.J.H., Marres, H.A.M. and Cremers, C.W.R.J. (1992) Autosomal dominant branchio-oto-renal syndrome-localization of a disease gene to chromosome 8q by linkage in a Dutch family. Hum. Mol. Genet., 1, 491-495. MEDLINE Abstract

8 Vincent, C., Kalatzis, V., Compain, S., Levilliers, J., Slim, R., Graia, F., Pereira, M.d.L., Nivelon, A., Croquette, M.F., Lacombe, D., Vigneron, J., Helias, J., Broyer, M., Callen, D.F., Haan, E.A., Weissenbach, J., Lacroix, B., Bellané-Chantelot, C., Le Paslier, D., Cohen, D. and Petit, C. (1994) A proposed new contiguous gene syndrome on 8q consists of branchio-oto-renal (BOR) syndrome, Duane syndrome, a dominant form of hydrocephalus and trapeze aplasia; implications for the mapping of the BOR gene. Hum. Mol. Genet., 3, 1859-1866. MEDLINE Abstract

9 Ni, L., Wagner, M.J., Kimberling, W.J., Pembrey, M.E., Grundfast, K.M., Kumar, S., Daiger, S.P., Wells, D.E., Johnson, K. and Smith, R.J.H. (1994) Refined localisation of the branchiootorenal syndrome gene by linkage and haplotype analysis. Am. J. Med. Genet., 51, 176-184. MEDLINE Abstract

10 Gu, J.Z., Wagner, M.J., Haan, E.A. and Wells, D.E. (1996) Detection of a megabase deletion in a patient with branchio-oto-renal syndrome (BOR) and tricho-rhino-phalangeal syndrome (TRPS): implications for mapping and cloning the BOR gene. Genomics, 31, 201-206. MEDLINE Abstract

11 Kalatzis, V., Abdelhak, S., Compain, S., Vincent, C. and Petit, C. (1996) Characterisation of a translocation-associated deletion defines the candidate region for the gene responsible for branchio-oto-renal syndrome. Genomics, 34, 422-425. MEDLINE Abstract

12 Abdelhak, S., Kalatzis, V., Heilig, R., Compain, S., Samson, D., Vincent, C., Weil, D., Cruaud, C., Sahly, I., Leibovici, M., Bitner-Glindzicz, M., Francis, M., Lacombe, D., Vigneron, J., Charachon, R., Boven, K., Bedbeder, P., Van Regemorter, N., Weissenbach, J. and Petit, C. (1997) A human homologue of the Drosophila eyes absent gene underlies branchio-oto-renal (BOR) syndrome and identifies a novel gene family. Nature Genet., 15, 157-164. MEDLINE Abstract

13 Vincent, C., Kalatzis, V., Abdelhak, S., Chaïb, H., Compain, S., Helias, J., Vanecloo, F.-M. and Petit, C. (1997) BOR and BO syndromes are allelic defects of EYA1. Eur. J. Hum. Genet., in press. MEDLINE Abstract

14 Xu, P.-X., Woo, I., Her, H., Beier, D.R. and Maas, R.L. (1997) Mouse Eya homologues of the Drosophila eyes absent gene require Pax6 for expression in lens and nasal placode. Development, 124, 219-231. MEDLINE Abstract

15 Green, M.R. (1986) Pre-mRNA splicing. Annu. Rev. Genet., 20, 671-708. MEDLINE Abstract

16 Jackson, I.J. (1991) A reappraisal of non-consensus mRNA splice sites. Nucleic Acids Res., 19, 3795-3798. MEDLINE Abstract

17 Aebi, M., Hornig, H. and Weissmann, C. (1987) 5' Cleavage site in eukaryotic pre-mRNA splicing is determined by the overall 5' splice region, not by the conserved 5' GU. Cell, 50, 237-246. MEDLINE Abstract

18 Kozak, M. (1996) Interpreting cDNA sequences: some insights from studies on translation. Mamm. Genome, 7, 563-574. MEDLINE Abstract

19 Quelle, D.E., Zindy, F., Ashmun, R.A. and Sherr, C.J. (1995) Alternative reading frames of the INKA4 tumor supressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell, 83, 993-1000. MEDLINE Abstract

20 Sidransky, D. (1996) Cancer genetics: two tracks but one race? Curr. Biol., 6, 523-525. MEDLINE Abstract

21 Lamb, R.A. and Horvath, C.M. (1991) Diversity of coding strategies in influenza viruses. Trends Genet., 7, 261-266. MEDLINE Abstract

22 Farabaugh, P.J. (1996) Programmed translational frameshifting. Microbiol. Rev., 60, 103-134. MEDLINE Abstract

23 Matsufuji, S., Matsufuji, T., Miyazaki, Y., Murakami, Y., Atkins, J.F., Gesteland, R.F. and Hayashi, S.-I. (1995) Autoregulatory frameshifting in decoding mammalian ornithine decarboxylase antizyme. Cell, 80, 51-60. MEDLINE Abstract

24 Laporte, J., Kioschis, P., Hu, L.-J., Kretz, C., Carlsson, B., Poutska, A., Mandel, J.L. and Dahl, N. (1997) Cloning and characterization of an alternatively spliced gene in proximal Xq28 deleted in two patients with intersexual genitalia and myotubular myopathy. Genomics, 41, 458-462. MEDLINE Abstract

25 Murphy, D., Pardy, K., Seah, V. and Carter, D. (1992) Posttranscriptional regulation of rat growth hormone gene expression: increased message stability and nuclear polyadenylation accompany thyroid hormone depletion. Mol. Cell Biol., 12, 2624-2632. MEDLINE Abstract

26 de Sauvage, F., Kruys, V., Marinx, O., Huez, G. and Octave, J.N. (1992) Alternative polyadenylation of the amyloid protein precursor mRNA regulates translation. EMBO J., 11, 3099-3103. MEDLINE Abstract

27 Garnier, G., Circolo, A. and Colten, H.R. (1995) Translational regulation of murine complement factor B alternative transcripts by upstream AUG codons. J. Immunol., 154, 3275-3282. MEDLINE Abstract

28 West, C.A., Arnett, T.R. and Farrow, S.M. (1996) Expression of insulin-like growth factor I (IGF-I) mRNA variants in rat bone. Bone, 19, 41-46. MEDLINE Abstract

29 Weiner, A.M., Deininger, P.L. and Efstratiadis, A. (1986) Nonviral retroposons: genes, pseudogenes, and transposable elements generated by the reverse flow of genetic information. Annu. Rev. Biochem., 55, 631-661. MEDLINE Abstract

30 Jurka, J. (1997) Sequence patterns indicate an enzymatic involvement in integration of mammalian retroposons. Proc. Natl Acad. Sci. USA, 94, 1872-1877. MEDLINE Abstract

31 Economou, E.P., Bergen, A.W., Warren, A.C. and Antonarakis, S.E. (1990) The polydeoxyadenylate tract of Alu repetitive elements is polymorphic in the human genome. Proc. Natl Acad. Sci. USA, 87, 2951-2954. MEDLINE Abstract

32 Stoppa-Lyonnet, D., Carter, P., Meo, T. and Tosi, M. (1990) Clusters of intragenic Alu repeats predispose the human C1 inhibitor locus to deleterious rearrangements. Proc. Natl Acad. Sci. USA, 87, 1551-1555. MEDLINE Abstract

33 Wallace, M.R., Andersen, L.B., Saulino, A.M., Gregory, P.E., Glover, T.W. and Collins, F.S. (1991) A de novo Alu insertion results in neurofibromatosis type 1. Nature, 353, 864-868. MEDLINE Abstract

34 Muratani, K., Hada, T., Yamamoto, Y., Kaneko, T., Shigeto, Y., Ohue, T., Furuyama, J. and Higashino, K. (1991) Inactivation of the cholinesterase gene by Alu insertion: possible mechanism for human gene transposition. Proc. Natl Acad. Sci. USA, 88, 11315-11319. MEDLINE Abstract

35 Vidaud, D., Vidaud, M., Bahnak, B.R., Siguret, V., Sanchez, S.G., Laurian, Y., Meyer, D., Goossens, M. and Lavergne, J.M. (1993) Haemophilia B due to a de novo insertion of a human-specific Alu subfamily member within the coding region of the factor IX gene. Eur. J. Hum. Genet., 1, 30-36. MEDLINE Abstract

36 Kazazian, H.H., Jr, Wong, C., Youssoufian, H., Scott, A.F., Philips, D.G. and Antonarakis, S.E. (1988) Haemophilia A resulting from de novo insertion of L1 sequences represents a novel mechanism for mutation in man. Nature, 332, 164-166. MEDLINE Abstract

37 Narita, N., Nishio, H., Kitoh, Y., Ishikawa, Y., Ishikawa, Y., Minami, R., Nakamura, H. and Matsuo, M. (1993) Insertion of a 5' truncated L1 element into the 3' end of exon 44 of the dystrophin gene resulted in skipping of the exon during splicing in a case of Duchenne muscular dystrophy. J. Clin. Invest., 91, 1862-1867. MEDLINE Abstract

38 Takahara, T., Ohsumi, T., Kuromitsu, J., Shibata, K., Sasaki, N., Okazaki, Y., Shibata, H., Sato, S., Yoshiki, A., Kusakabe, M., Muramatsu, M., Ueki, M., Okuda, K. and Hayashizaki, Y. (1996) Dysfunction of the Orleans reeler gene arising from exon skipping due to transposition of a full-length copy of an active L1 sequence into the skipped exon. Hum. Mol. Genet., 5, 989-993. MEDLINE Abstract

39 Hassoun, H., Coetzer, T.L., Vassiliadis, J.N., Sahr, K.E., Maalouf, G.J., Saad, S.T.O., Catanzariti, L. and Palek, J. (1994) A novel mobile element inserted in the [alpha] spectrin gene: spectrin Dayton. A truncated [alpha] spectrin associated with hereditary elliptocytosis. J. Clin. Invest., 94, 643-648. MEDLINE Abstract

40 Jurka, J. (1993) A new subfamily of recently retroposed human Alu repeats. Nucleic Acids Res., 21, 2252.

41 Matera, A.G., Hellmann, U. and Schmid, C.W. (1990) A transpositionally and transcriptionally competent Alu subfamily. Mol. Cell. Biol., 10, 5424-5432. MEDLINE Abstract

42 Tsui, L.-P. (1992) Mutations and sequence variations detected in the cystic fibrosis transmembrane conductance regulator (CFTR) gene: a report from the Cystic Fibrosis Genetic Analysis Consortium. Hum. Mutat., 1, 197-203. MEDLINE Abstract

43 Krawczak, M., Reiss, J. and Cooper, D.N. (1992) The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Hum. Genet., 90, 41-54. MEDLINE Abstract

44 Greenberg, C.R., Reimer, D., Singal, R., Triggs-Raine, B., Chudley, A.E., Dilling, L.A., Philipps, S., Haworth, J.C., Seargeant, L.E. and Goodman, S.I. (1995) A G-to-T transversion at the +5 position of intron 1 in the glutaryl CoA dehydrogenase gene is associated with the Island Lake variant of glutaric acidemia type I. Hum. Mol. Genet., 4, 493-495. MEDLINE Abstract

45 Tiller, G.E., Weis, M.A., Polumbo, P.A., Gruber, H.E., Rimoin, D.L., Cohn, D.H. and Eyre, D.R. (1995) An RNA-splicing mutation (G+5IVS20) in the type II collagen gene (COL2A1) in a family with spondyloepiphyseal dysplasia congenita. Am. J. Hum. Genet., 56, 388-395. MEDLINE Abstract

46 Haan, E.A., Hull, Y.J., White, S., Cockington, R., Charlton, P. and Callen, D.F. (1989) Tricho-rhino-phalangeal and branchio-oto syndromes in a family with an inherited rearrangement of chromosome 8q. Am. J. Med. Genet., 32, 490-494. MEDLINE Abstract

47 Lévy, G., Levi-Acobas, F., Blanchard, S., Gerber, S., Larget-Piet, D., Chenal, V., Liu, X.-Z., Newton, V., Steel, K.P., Brown, S.D.M., Munnich, A., Kaplan, J., Petit, C. and Weil, D. (1997) Myosin VIIA gene : heterogeneity of the mutations responsible for Usher syndrome type IB. Hum. Mol. Genet., 6, 111-116. MEDLINE Abstract

48 Weil, D., Blanchard, S., Kaplan, J., Guilford, P., Gibson, F., Walsh, J., Mburu, P., Varela, A., Levilliers, J., Weston, M.D., Kelley, P.M., Kimberling, W.J., Wagenaar, M., Levi-Acobas, F., Larget-Piet, D., Munnich, A., Steel, K.P., Brown, S.D.M. and Petit, C. (1995) Defective myosin VIIA gene responsible for Usher syndrome type 1B. Nature, 374, 60-61. MEDLINE Abstract

49 Beaudet, A.L. and Tsui, L.-C. (1993) A suggested nomenclature for designating mutations. Hum. Mutat., 2, 245-248. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +33 145 688890; Fax: +33 145 676978; Email: cpetit@pasteur.fr


This page is maintained by OUP admin. Last updated Sat Oct 18 13:29:50 BST 1997. Part of the OUP Journals World Wide Web service.
Copyright Oxford University Press, 1997


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
G. Williams, J. T. Fletcher, S. I. Alexander, and J. C. Craig
Vesicoureteral Reflux
J. Am. Soc. Nephrol., May 1, 2008; 19(5): 847 - 862.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. A. Clark, J. M. Wahl, C. A. Rees, and K. E. Murphy
From The Cover: Retrotransposon insertion in SILV is responsible for merle patterning of the domestic dog
PNAS, January 31, 2006; 103(5): 1376 - 1381.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Mutsuddi, B. Chaffee, J. Cassidy, S. J. Silver, T. L. Tootle, and I. Rebay
Using Drosophila to Decipher How Mutations Associated With Human Branchio-Oto-Renal Syndrome and Optical Defects Compromise the Protein Tyrosine Phosphatase and Transcriptional Functions of Eyes Absent
Genetics, June 1, 2005; 170(2): 687 - 695.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
H. Zou, N. K. Osborn, J. J. Harrington, K. K. Klatt, J. R. Molina, L. J. Burgart, and D. A. Ahlquist
Frequent Methylation of Eyes Absent 4 Gene in Barrett's Esophagus and Esophageal Adenocarcinoma
Cancer Epidemiol. Biomarkers Prev., April 1, 2005; 14(4): 830 - 834.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. Grifone, C. Laclef, F. Spitz, S. Lopez, J. Demignon, J.-E. Guidotti, K. Kawakami, P.-X. Xu, R. Kelly, B. J. Petrof, et al.
Six1 and Eya1 Expression Can Reprogram Adult Muscle from the Slow-Twitch Phenotype into the Fast-Twitch Phenotype
Mol. Cell. Biol., July 15, 2004; 24(14): 6253 - 6267.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Martinez, M. Rosa, J.-L. Arsuaga, P. Jarabo, R. Quam, C. Lorenzo, A. Gracia, J.-M. Carretero, J.-M. B. de Castro, and E. Carbonell
Auditory capacities in Middle Pleistocene humans from the Sierra de Atapuerca in Spain
PNAS, July 6, 2004; 101(27): 9976 - 9981.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. G. Ruf, P.-X. Xu, D. Silvius, E. A. Otto, F. Beekmann, U. T. Muerb, S. Kumar, T. J. Neuhaus, M. J. Kemper, R. M. Raymond Jr., et al.
SIX1 mutations cause branchio-oto-renal syndrome by disruption of EYA1-SIX1-DNA complexes
PNAS, May 25, 2004; 101(21): 8090 - 8095.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
A. M. Roy-Engel, A.-H. Salem, O. O. Oyeniran, L. Deininger, D. J. Hedges, G. E. Kilroy, M. A. Batzer, and P. L. Deininger
Active Alu Element "A-Tails": Size Does Matter
Genome Res., September 1, 2002; 12(9): 1333 - 1344.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
A. M. Pierides, Y. Athanasiou, K. Demetriou, M. Koptides, and C. C. Deltas
A family with the branchio-oto-renal syndrome: clinical and genetic correlations
Nephrol. Dial. Transplant., June 1, 2002; 17(6): 1014 - 1018.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. Buller, X. Xu, V. Marquis, R. Schwanke, and P.-X. Xu
Molecular effects of Eya1 domain mutations causing organ defects in BOR syndrome
Hum. Mol. Genet., November 1, 2001; 10(24): 2775 - 2781.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Wayne, N. G. Robertson, F. DeClau, N. Chen, K. Verhoeven, S. Prasad, L. Tranebjarg, C. C. Morton, A. F. Ryan, G. Van Camp, et al.
Mutations in the transcriptional activator EYA4 cause late-onset deafness at the DFNA10 locus
Hum. Mol. Genet., February 1, 2001; 10(3): 195 - 200.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S. RICKARD, M. BOXER, R. TROMPETER, and M. BITNER-GLINDZICZ
Importance of clinical evaluation and molecular testing in the branchio-oto-renal (BOR) syndrome and overlapping phenotypes
J. Med. Genet., August 1, 2000; 37(8): 623 - 627.
[Full Text]


Home page
Hum Mol GenetHome page
J. Dixon, C. Brakebusch, R. Fassler, and M. J. Dixon
Increased levels of apoptosis in the prefusion neural folds underlie the craniofacial disorder, Treacher Collins syndrome
Hum. Mol. Genet., June 12, 2000; 9(10): 1473 - 1480.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
Q. T. Bui, J. E. Zimmerman, H. Liu, and N. M. Bonini
Molecular Analysis of Drosophila eyes absent Mutants Reveals Features of the Conserved Eya Domain
Genetics, June 1, 2000; 155(2): 709 - 720.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (93)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Abdelhak, S.
Right arrow Articles by Weil, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abdelhak, S.
Right arrow Articles by Weil, D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?