Structural and mutational analysis of a conserved gene (DGSI) from the minimal DiGeorge syndrome critical region
Structural and mutational analysis of a conserved gene ( DGSI ) from the minimal DiGeorge syndrome critical regionWeilong Gong1, Beverly S. Emanuel1,2,3, Naomi Galili5, David H. Kim1, Bruce Roe6, Deborah A. Driscoll1,4 and Marcia L. Budarf1,2,*
1The Division of Human Genetics and Molecular Biology, The Children's Hospital of Philadelphia, Philadelphia, PA, USA, Departments of 2Pediatrics, 3Genetics and 4Obstetrics and Gynecology and 5The Wistar Institute, University of Pennsylvania School of Medicine, Philadelphia, PA, USA and 6The Departments of Chemistry and Biochemistry, University of Oklahoma, Norman, OK, USA
Received September 18, 1996;Revised and Accepted November 27, 1996
The majority of patients with DiGeorge syndrome (DGS), velocardiofacial syndrome (VCFS), conotruncal anomaly face syndrome (CTAFS) and some individuals with familial or sporadic conotruncal cardiac defects have hemizygous deletions of chromosome 22. Most patients with these disorders share a common large deletion, spanning >1.5 Mb within 22q11.21-q11.23. Recently, the smallest region of deletion overlap has been narrowed to a 250 kb area, the minimal DGS critical region (MDGCR), which includes the locus D22S75 (N25). We have isolated and characterized a novel, highly conserved gene, DGSI, within the MDGCR. DGSI has 10 exons and nine introns encompassing 1702 bp of cDNA sequence and 11 kb of genomic DNA. The encoded protein has 476 amino acids with a predicted mol. wt of 52.6 kDa. The intron-exon boundaries have been analyzed and conform to the consensus GT/AG motif. The corresponding murine Dgsi has been isolated and localized to proximal mouse chromosome 16. The mouse gene contains the same number of exons and introns, and the predicted protein has 479 amino acids with 93.2% identity to that of the human DGSI gene. By database searching, both genes have significant homology to a Caenorhabditis elegans hypothetical protein, F42H10.7. Further, mutation analysis has been performed in 16 patients, who have no detectable 22q11.2 deletion and some of the characteristic clinical features of DGS/VCFS. We have detected eight sequence variants in DGSI. These occurred in the 5'-untranslated region, the coding region and the intronic regions adjacent to the intron-exon boundaries of the gene. Seven of the eight variants were also present in normal controls or unaffected family members, suggesting they may not be of etiologic significance.
The DGSI transcript (accession no. L77566) maps to the central portion of the MDGCR (Fig. 1 A). On Northern blots containing mRNA from 23 adult and four fetal tissues, two different sized mRNAs were detected (Fig. 2 A) using the probe c4A10 (Fig. 1 D). One is 1.7 kb and is expressed in all adult and fetal tissues tested. The other transcript is 5.2 kb in size and is strongly expressed in adult skeletal muscle and heart. After a longer exposure, a weak 5.2 kb band was also seen in the four fetal tissues tested (brain, lung, liver and kidney) by Northern analysis (data not shown), suggesting the possibility of alternative splicing. A transcript representing the 1.7 kb signal seen on Northern blots could be assembled from clones isolated by cDNA selection and 3' and 5' RACE products (Fig. 1 D). The transcript is 1702 bp in length, excluding the 85 bp poly(A) tail. Efforts to identify cDNAs representing the larger transcript were made which included screening a cDNA library. Since the 5.2 kb transcript is highly expressed in adult skeletal muscle, the probe c4A10 was used to screen a human skeletal muscle cDNA library. Two positive clones (SM-2 and SM-3) (Fig. 1 D) were isolated, but sequence analysis demonstrated that neither of these cDNAs represents an alternatively processed transcript of DGSI. This raises a question as to whether the 5.2 kb transcript actually represents an alternative form of DGSI or a related expressed sequence located elsewhere in the genome. To examine this possibility, Southern hybridization to a complete monochromosomal hybrid panel was performed with the same probe (c4A10) that was used for the Northern blot analysis. A single 5.5 kb EcoRI band was seen in total human DNA (Fig. 2 B). The only somatic cell hybrid which gave the same size band was the one containing human chromosome 22 (GM10888) (Fig. 2 B), suggesting that DGSI is a single-copy gene. Additional experiments to characterize the larger transcript further will be required.
On a zoo-blot containing nine eukaryotic species, c4A10 identified strong positive signals in human, monkey, rat, mouse and dog. Somewhat weaker signals were observed in cow and rabbit (data not shown), suggesting that DGSI is conserved. Recently, a 150 kb genomic DNA contig encompassing the region of mouse chromosome 16 which is syntenic to the human MDGCR has been constructed (Galili et al., in press). A 38 kb cosmid from this contig has been sequenced completely (accession no. U70231) and sequence analysis demonstrates that there is a high degree of identity between DGSI and the mouse genomic DNA sequence. Using primers designed from the conserved region in the mouse genomic sequence (see Materials and Methods), a 1437 bp RT-PCR product was generated from 9-day mouse embryo and embryonic heart mRNA. RACE experiments were carried out using primers derived from the ends of the RT-PCR product (see Materials and Methods). Sequence analysis of the RT-PCR and 5' and 3' RACE products allowed the assembly of 1732 bp of mouse Dgsi cDNA sequence, including the 5' methionine start codon and a 3' polyadenylation signal ATTAAA followed by a poly(A) tail (accession no. GSDB:S:1118295). The predicted protein has 479 amino acids, and comparison between the amino acid sequence of human and mouse DGSI revealed 96.8% similarity and 93.2% identity overall (Fig. 4 B), indicating that this gene is highly conserved in evolution. Further, Dgsi shows 52.5% similarity and 30.6% identity to the C.elegans hypothetical protein, F42H10.7 using BLASTP.
The structure of the human and mouse DGSI genes were determined by comparison between the cDNA sequence and the corresponding genomic sequence (accession no L77570 and U70231, respectively). The 5' end of the human DGSI gene is 31 kb upstream of the CTP gene (16 ), and its 3' end is 12 kb downstream of the LAN/DGCR2/IDD gene (9 ,14 ,15 ). Human DGSI consists of 10 exons and nine introns spanning 1.7 kb ofcDNA and 11 kb of genomic DNA (Fig. 1 ). The sizes of the exons range from 96 (exon 3) to 170 bp (exon 4), except the last exon which is the largest (541 bp), containing 280 bp of coding sequence and 261 bp of 3'-untranslated region (UTR). The intron length varies between 92 (intron 2) and 2513 bp (intron 3). Similarly, the mouse Dgsi gene also contains 10 exons and nine introns encompassing 1.7 kb of cDNA sequence and 9.6 kb of genomic DNA. The first exon of mouse Dgsi contains 144 bp of coding region and a short 5'-UTR. The last exon of mouse Dgsi contains 280 bp of coding sequence and 280 bp of 3'-UTR. Although the 3'-UTR of the mouse Dgsi gene is 19 bp larger than that of the human DGSI gene, the polyadenylation signal, ATTAAA, is conserved and located 18 bp upstream of the poly(A) tail of both transcripts. All introns, except intron 7, of the mouse Dgsi gene are smaller than those of the human DGSI gene. The exon-intron boundaries of both genes were identified, and the donor and acceptor splice site at each exon-intron junction conform to the consensus (Table 1 ). It is interesting to note that a variation in splicing is found at the boundary of intron 3 and exon 4. As indicated in Table 1 , the mouse selects the first ag as the acceptor site, while the human selects the second ag, resulting in an insertion of CAG in the mouse Dgsi cDNA sequence. This insertion was detected in expressed sequences derived from the whole mouse embryo and the heart. All other exon-intron boundaries occur in the same position with respect to the coding sequence.
The genomic DNA surrounding the first exon of human and mouse DGSI has been analyzed and compared. There is 64% identity over 635 bp in intron 1 between both DGSI genes. Despite the fact that the nucleotide sequence of the 5' upstream region is somewhat less conserved, and two SpI elements and two CACCC boxes seen in the human DGSI gene are not found in mouse Dgsi, the two regions share certain features. Both lack TATA consensus in the immediate upstream region. Further, a putative CAAT box and a possible binding site for ATF/CREB (TGACGTCA) (23 ) were observed in the 5' upstream region of both genes (Fig. 5 ).
Mutation analysis was performed on a small group of patients who did not have a detectable 22q11.2 deletion by FISH analysis, but have two or more of the clinical features consistent with a diagnosis of DGS (four cases) or VCFS (10 cases). In addition, two `non-deleted' siblings with truncus arteriosus (TA) were studied, since it has been reported that 33% of all patients with TA have DGS (24 ). Screening was first performed on these 16 patients, four family members and 31 normal controls. The 5' upstream region (primers DGS-I.1, Table 2 ) and the first exon (primers DGS-I.2, Table 2 ) were assessed both by heteroduplex analysis and by direct sequencing. Since similar results were obtained with the two methods, we used heteroduplex analysis for the subsequent screening experiments.
We have isolated and characterized a novel gene, DGSI, within the MDGCR which, based on its map position, is a potential candidate gene for DGS/VCFS or related disorders. DGSI is hemizygously deleted in the vast majority of patients with DGS/VCFS. Despite the absence of homology between DGSI and other genes or proteins with known function, it is highly conserved in eukaryotic species. Comparison of the deduced amino acid sequence reveals 96.8 and 53% similarity between the human and mouse DGSI, and the human DGSI and the C.elegans predicted protein (P34420), respectively. At the N-terminal conserved region, there is a 66 amino acid stretch with a high degree of similarity to the Drosophila expanded protein (ex). Included in the region of similarity between ex and DGSI are two regions which are rich in proline and glutamic acid. The function of the region of ex with similarity to DGSI is unknown. However, ex is an essential gene in Drosophila, necessary for proper growth control of imaginal discs. Some ex mutants display phenotypes affecting head, thorax, legs and wings in heterozygotes (26 ). Further evidence of a role for DGSI in development comes from RT-PCR experiments which demonstrate that Dgsi is expressed in early mouse development. A transcript was detected at 9 days in mouse whole embryo and heart. Additional in situ hybridization experiments on mouse embryo sections will be required to determine the precise location of Dgsi expression in the early mouse embryo.
In our study, mutational analysis of all 10 exons and the 5' upstream region of DGSI was performed on patients with features of DGS/VCFS but no detectable deletion of 22q11. The rationale for this strategy is based on the premise that if loss of a single gene is responsible for features of the 22q11 deletion syndrome then there should be patients who, instead of deletions, have mutations within the causative gene. Failure to find patients with mutations could indicate either that the gene under study is not the correct gene or that haploinsufficiency of multiple genes is required for expression of the phenotype. A further complication to this type of analysis is that DGS/VCFS is known to be etiologically heterogeneous. Exposure to teratogens (27 ), maternal diabetes (28 ) and rearrangements of other chromosomal regions, including 4q (29 ), 10p13 (30 ) and 17p13 (31 ), have been seen in association with patients diagnosed with DGS. Nonetheless, mutational analysis of candidate genes is a necessary step to distinguish between these possibilities.
Sixteen non-deleted patients were selected for mutational analysis. Eight nucleotide changes, all single-base substitutions, were found in seven non-deleted patients. Five were observed in both patients and normal controls, indicating that these are normal variants. Three base pair changes were found only in two affected patients (patients 1 and 11). Two changes, at -2 (C -> G) and 92 (C -> T) were only observed in patient 11 and her unaffected parents, suggesting that these are rare variants. Further, detailed genotyping of this family excluded 22q11 as a candidate region.
A third nucleotide change was found in patient 1. This is a G -> A transition found in the promoter region of DGSI. It is 65 bp upstream from the translation start codon, 7 bp upstream of a putative SpI binding site and 28 bp downstream of the putative CAAT box. The guanosine at position -65 is conserved in the mouse Dgsi sequence. It is possible that this single-base substitution in the promoter region could influence transcription. Such an example has been reported for the apolipoprotein A-I gene, where an A -> G transition 78 bp upstream from the transcription initiation site has been associated with decreased promoter activity in vitro and apoA-I production in vivo (32 ). Another example is a T -> C substitution at nt -39 in the promoter region of the lipoprotein lipase gene. As a result of this single nucleotide change, the transcriptional activity of the mutant promoter was <15% of wild-type (33 ). However, in our study, the significance of this G -> A change seen in patient 1 is unclear, because similar nucleotide changes have yet to be found in other non-deleted DGS/VCFS patients. Further, this change does not occur within any recognizable cis-acting element. Additional studies to determine the transcriptional consequences of this change will be required.
In summary, we propose that DGSI remains a candidate gene for DGS/VCFS syndrome and related abnormalities. Firstly, this gene maps within the MDGCR and is hemizygous in the vast majority of patients with the 22q11 deletion. Secondly, DGSI is highly conserved in eukaryotic species and expressed during early mouse development. Finally, a rare sequence variant which could represent a possible mutation has been detected in one DGS patient. The wide phenotypic variability in patients with the 22q11 deletion has led to the suggestion that multiple genes from the deleted region may be responsible for the wide range of clinical features. DGSI is located in a region from which several novel transcripts are produced, creating a small gene cluster (17 ). It is possible that more than one of the genes in this gene-rich region may be associated with the etiology of DGS/VCFS. Additional experiments, such as functional analysis of DGSI and knockouts of this gene in a murine model, will be essential to clarify the possible developmental role of DGSI in producing the phenotype of the 22q11 deletion syndrome.
Table 3 Polymorphisms and sequence variants of the DGSI gene
Genomic DNA was available from 16 patients referred to our laboratory with either a diagnosis of DGS/VCFS (14 cases) or an isolated conotruncal cardiac malformation (two affected siblings). Clinical summaries were provided on 13 of the 14 DGS/VCFS patients by a referring geneticist and/or immunologist. All 13 had two or more of the major clinical features seen in these disorders including congenital heart defect, absent thymus or a history of frequent infections, palatal abnormalities and/or speech difficulties, facial dysmorphia and a history of learning disabilities or developmental delay. Clinical information was not available on one patient (P3) referred with the diagnosis of VCFS. Twelve of the 14 DGS/VCFS cases were sporadic; patients 9 and 11 were siblings with the diagnosis of DGS. The remaining two patients were siblings (P16 and P17) with TA, a diagnosis frequently seen in DGS. These siblings have no other features of DGS or VCFS.
A 5' stretch- [lambda]gt10 human adult skeletal muscle library (Clontech) was screened using c4A10 as probe. The library was plated at a density of ~300 000 p.f.u. per 150 mm plate on the Escherichia coli host strain Y1090. Filter hybridization was performed according the protocol provided by the manufacturer.
cDNA was synthesized in a 50 µl reaction using 100 ng of poly(A) RNA extracted from various tissues. The RNA was heated with random and oligo(dT) primers for 5 min at 65oC and cooled to room temperature for 10 min. Reverse transcription was performed at 37oC for 1 h after adding 5 µl of 10* RT buffer (Stratagene), 20 U of RNase inhibitor (Stratagene), 2 µl of 0.1 M dNTPs and 50 U of MMLV reverse transcriptase. The cDNA mixture then was heated for 5 min at 90oC. For PCR amplification, 2 µl of cDNA was used per 50 µl reaction. The primers for mouse Dgsi are: GGACTTCAGACAGTTATCCAGAGAGACTTC (F) and ACTAGATATTTGTGGCTCCTGGAATAATCA (R).
Marathon-ReadyT mouse skeletal muscle cDNA (Clontech) was used in PCR with an anchor primer provided by the manufacturer and a gene-specific antisense primer, 5'-GAAGTCTCTCTGGATAACTGTCTGAAGTCC-3' for 5' RACE and a sense primer, 5'-GACGCAAAGCTTCAGACTTCTTTTAG- 3' for 3' RACE. PCR was performed in 50 µl reactions using 1* PCR buffer (Clontech): 40 mM Tricine-KOH, 15 mM KOAc, 3.5 mM Mg(OAc)2, 75 mg/ml bovine serum albumin and 0.25 U of KlenTaq-1 DNA polymerase (Clontech). PCR conditions were: a 1 min denaturation step at 94oC followed by 30 cycles of, denaturation at 94oC for 30 s, annealing and extension at 68oC for 3 min, and lastly a 3 min extension at 68oC. The PCR reactions were performed in Perkin Elmer 9600 thermal cyclers. PCR products were analyzed by gel electrophoresis using 1-1.5% agarose.
Double-stranded plasmid DNA was prepared and purified using the Wizard Mini Prep DNA Purification System (Promega) and sequenced from both ends on an ABI 373A sequencer using the universal forward and reverse M13 fluorescent primers. PCR products were purified using the QIA quick gel extraction kit (Qiagen) and directly sequenced using the primers specific for PCR amplification. Cosmid sequencing was performed using a double-stranded random shotgun approach described elsewhere (34 ).
Primer extension analysis was performed using a modified protocol (35 ). An antisense primer, 5'-ATACTCTTCCTCGTCCAGGACCC-3', was end-labeled with [[gamma]-32P]ATP and 106 c.p.m. of labeled primer was mixed with 2 µg of adult skeletal poly(A) RNA in a volume of 20 µl. The mixture was precipitated, redissolved in 40 µl of hybridization buffer (0.3 M KCl, 10 mM Tris-HCl at pH 7.6, 0.5 mM EDTA) and then heat-denatured at 75oC for 5 min. The hybridization was carried out overnight at 37oC and terminated by precipitation. The pellet was redissolved in reverse transcriptase buffer containing 1.0 U/µl of RNase inhibitor and 50 U of MMLV reverse transcriptase (Stratagene) and incubated for 1 h at 37oC. The reaction was terminated by addition of 1 µl of 0.5 M EDTA (pH 8.0). The RNA portion of the hybrid was removed by digestion with 1 µl of DNase-free pancreatic RNase (5 µg/ml) at 37oC for 30 min. The extended products were phenol extracted, ethanol precipitated, heated at 65oC for 5 min, and analyzed by 8% denaturing polyacrylamide gel electrophoresis followed by autoradiography.
Heteroduplex analysis was performed using a protocol described elsewhere (36 ). Primers flanking each exon (except for exon 2 and exon 3) and the 5' upstream region of DGSI were designed from intronic sequence, 100 bp upstream or downstream of the exon-intron boundaries as listed in Table 2 . Genomic fragments from all patients and controls examined were amplified using these primers and their sizes range from 193 to 478 bp. PCR products with different sizes were mixed, denatured at 98oC for 5 min and incubated at 65oC for 1 h to induce heteroduplex formation. Approximately 10 µl of each sample subsequently was electrophoresed though a standard sequencing gel containing 10% polyacrylamide (99:1 w/w acrylamide:bis-acrolylpiperazine, Fluka), 10% ethylene glycol, 15% formamide, 0.2% ammonium persulfate in 0.5* TTE buffer for 16-18 h at 400-600 V.
The allele-specific oligonucleotides were designed based on the single base changes of DGSI detected by heteroduplex analysis and direct sequencing and have the same length (17 bases). The mismatched oligonucleotides (ASO-M) are: G2A, 5'- CAAATGATGCAGTCCCG -3'; C24T, 5'-TCCACCTTGTGACGCGC-3'; C65G, 5'- GATAGGGATGGAGACGC-3'; C159T, 5'-GGCTGTGACGAGCAAGC-3'. The discriminating single base mismatch between the oligonucleotide probe and the DGSI sequence is located 6-7 bases from the 5' end of the oligonucleotide probe, and is indicated by bold letters. Thirty µM of each ASO probe were end-labeled with [[gamma]-32P]ATP in 1* T4 polynucleotide kinase buffer containing 20 mM dithiothreitol (DTT), 1 U of T4 polynucleotide kinase for 1 h at 37oC. All four labeled ASO-M probes were pooled and hybridized to Southern blots containing the genomic PCR products, amplified from normal individuals using the primers listed in Table 2 , in TMAC hybridization buffer (3 M tetramethylammonium chloride, 0.6% SDS, 1 mM EDTA, 10 mM Na3PO4 pH 6.8, 5* Denhardt solution, 40 µg/ml yeast RNA) overnight at 56oC.
The authors wish to thank the clinicians, especially Drs Hope H. Punnett and Tamison Jewett, for providing patient samples, Dr Vahe Bedian at the University of Pennsylvania Sequencing Facility for sequencing of PCR products and cDNAs and Dr Nancy Spinner for the samples from normal controls. The chromosome-specific cosmid library LL22NC03 used in this study was constructed at the Biomedical Sciences Division, Lawrence Livermore National Laboratory, Livermore, CA 94550 under the auspices of the National Laboratory Gene Library Project sponsored by the U.S. Department of Energy. These studies were supported in part by HG00425 (B.S.E., M.L.B), HL51533 (M.L.B, B.R., B.S.E.), DC02027 (M.L.B, B.S.E., B.R), HG00313 (B.R.), HD26979 (B.S.E) from the National Institutes of Health.
1 Driscoll, D.A., Budarf, M.L. and Emanuel B.S. (1992) A genetic etiology for DiGeorge syndrome: consistent deletion and microdeletion of 22q11. Am. J. Hum. Genet., 50, 924-933.MEDLINE Abstract
2 Driscoll, D.A., Spinner, N.B., Budarf, M.L., McDonald-McGinn, D.M., Zackai, R.B., Goldberg, E.H., Shprintzen, R.J., Saal, H.M., Zonana, J., Jones, M.C., Mascarello, J.T. and Emanuel, B.S. (1992) Deletions and microdeletions of 22q11.2 in velo-cardio-facial syndrome. Am. J. Med. Genet., 44, 261-268.MEDLINE Abstract
3 Wilson, D.I., Cross, I., Goodship, J.A., Scambler, P.J., Taylor, J.F.N., Walsh, K. and Burn, J. (1992) Deletion within chromosome 22q11 in familial congenital heart disease. Am. J. Hum. Genet., 51, 957-963MEDLINE Abstract
4 Burn, J., Takao, A., Wilson, D., Cross, I., Momma, K., Wadey, R., Scambler, P. and Goodship, J. (1993) Conotruncal anomaly face syndrome is associated with a deletion within chromosome 22q11. J. Med. Genet., 30, 822-824.MEDLINE Abstract
5 Goldmuntz, E., Driscoll, D., Budarf, M.L., Zackai, E.H., McDonald-McGinn, D.M., Biegel, J.A. and Emanuel, B.S. (1993) Microdeletions of chromosomal region 22q11 in patients with congenital conotruncal cardiac defects. J. Med. Genet., 30, 807-812.MEDLINE Abstract
6 Kelly D., Goldberg, R., Wilson, D., Lindsay, E., Carey, A.H., Goodship, J., Burn, J., Gross, I., Shprintzen, R.and Scambler, P.J. (1993) Confirmation that the velo-cardio-facial syndrome is associated with haplo-insufficiency of genes at chromosome 22q11. Am. J. Med. Genet., 45, 308-312.MEDLINE Abstract
7 Lindsay, E.A., Halford, S., Wadey, R., Scambler, P.J.and Baldini, A. (1993) Molecular cytogenetic characterization of the DiGeorge syndrome region using fluorescence in situ hybridization. Genomics, 17, 403-407.MEDLINE Abstract
8 Desmaze, C., Prieur, M., Amblard, F., Ailem, M., LeDeist, F., Demczuk, S., Zucman J., Plougastel, B., Delattre, O., Croquette, M.-F., Breviere, G.-M., Huon, C., Le Merrer, M., Mathieu, M., Sidi, D., Stephan, J.-L. and Aurias, A. (1993) Physical mapping by FISH of the DiGeorge critical region (DGCR): involvement of the region in familial cases. Am. J. Hum. Genet., 53, 1239-1249.MEDLINE Abstract
9 Budarf, M.L., Collins, J., Gong, W., Roe, B., Wang, Z., Bailey, L.C., Sellinger, B., Michaud, D., Driscoll, D. and Emanuel, B.S. (1995) Cloning a balanced translocation associated with DiGeorge syndrome and identification of a disrupted candidate gene. Nature Genet., 10, 269-288. MEDLINE Abstract
10 Driscoll, D.A., Sellinger, J., Budarf, M.L., McDonald-McGinn, D.M., Zackai, E.H. and Emanuel, B.S. (1993) Prevalence of 22q11 microdeletions in DiGeorge and velocardiofacial syndromes: implications for genetic counseling and prenatal diagnosis. J. Med. Genet., 30, 813-817.MEDLINE Abstract
11 Morrow, B., Goldberg, R., Carlson, C., Gupta, R.D., Sirotkin, H., Collins, J., Dunham, I., O'Donnell, H., Scambler, P., Shprintzen, R. and Kucherlapati, R. (1995) Molecular definition of the 22q11 deletions in Velo-Cardio-Facial syndrome. Am. J. Hum. Genet., 56, 1391-1403.MEDLINE Abstract
12 Li, M., Budarf, M.L., Sellinger, B., Jaquez, M., Matalon, R., Ball, S., Pagon, R.A., Rosengren, S.S, Emanuel, B.S. and Driscoll, D.A. (1994) Narrowing the DiGeorge region (DGCR) using DGS-VCFS associated translocation breakpoints. Am. J. Hum. Genet., 55, A10.
13 Jaquez, M., Driscoll, D.A.., Li, M., Emanuel, B.S., Hernandez, I., Jaquez, F., Lembert, N., Ramirez, J. and Matalon, R. (1996) Unbalanced 15;22 translocation in a patient with features of both DiGeorge and velocardiofacial syndrome. Am. J. Med. Genet., in press.
14 Demczuk, S., Aledo, R., Zucman, J., Delattre, O., Desmaze, C., Dauphinot, L., Jalbert, P., Rouleau, G.A., Thomas, G. and Aurias, A. (1995) Cloning of a balanced translocation breakpoint in the DiGeorge syndrome critical region and isolation of a novel potential adhesion receptor gene in its vicinity. Hum. Mol. Genet., 4, 551-558.MEDLINE Abstract
15 Wadey, R., Daw, S., Taylor, C., Atif, U., Kamath, S., Halford, S., O'Donnell, H., Wilson, D., Goodship, J., Burn, J. and Scambler, P. (1995) Isolation of a gene encoding an integral membrane protein from the vicinity of a balanced translocation breakpoint associated with DiGeorge syndrome. Hum. Mol. Genet., 4, 1027-1033. MEDLINE Abstract
16 Goldmuntz, E, Wang, Z.,.Roe, B. and Budarf, M.L. (1996) Cloning, genomic organization, and chromosomal localization of human citrate transport protein to the DiGeorge/velocardiofacial syndrome minimal critical region. Genomics, 33, 271-276.MEDLINE Abstract
17 Gong, W., Emanuel, B.S, Collins, J., Kim, D.H., Wang , Z., Chen, F., Zhang, G., Roe, B. and Budarf, M.L. (1996) A transcription map of the DiGeorge and velocardiofacial syndrome minimal critical region on 22q11. Hum. Mol. Genet., 5, 789-800.MEDLINE Abstract
18 Kedra D., Peyrard, M., Fransson, I., Collins, J.E., Dunham, I., Roe B.A.and Dumanski, J.P. (1996) Characterization of a second human clathrin heavy chain polypeptide gene (CLH22) from chromosome 22q11. Hum. Mol. Genet., 5, 625-632.MEDLINE Abstract
19 Sirotkin, H., Morrow, B., DasGupta, R., Goldberg, R., Patanjali, S.R., Shi, G., Cannizzaro, L., Shprintzen, R., Weissman, S.M. and Kucherlapati, R. (1996) Isolation of a new clathrin heavy chain gene with muscle-specific expression from the region commonly deleted in velo-cardio-facial syndrome. Hum. Mol. Genet., 5, 617-625.MEDLINE Abstract
20 Sutherland, H.F., Wadey, R., McKie, J.M., Taylor, C., Atif, U., Johnstone, K.A., Halford, S., Kim, U.-J., Goodship, J., Baldini, A.and Scambler, P.J. (1996) Identification of a novel transcript disrupted by a balanced translocaton associated with DiGeorge syndrome. Am. J. Hum. Genet., 59, 23-31.MEDLINE Abstract
21 Mermod, N., O'Neill, E.A., Kelly, T.J. and Tjian, R. (1989) The proline-rich transcriptional activatorof CTF/NF-1 is distinct from the replication and DNA binding domain. Cell, 58, 741-753.MEDLINE Abstract
22 Franks, R.G. and Crew, S.T. (1994) Transcriptional activation domains of the single-minded bHLH protein are required for CNS midline cell development. Mech. Dev., 45, 269-277MEDLINE Abstract
23 Virbasius, J.V. and Scarpulla, R.C. (1993) Identity of GABP with NRF-2, a multisubunit activator of cytochrome oxidase expression reveals a cellular role for an ETS domain activator of viral promoters. Genes Dev., 7, 380-392.MEDLINE Abstract
24 van Mierop, L.H.S. and Kutsche, L.M. (1986) Cardiovascular anomalies in DiGeorge syndrome and importance of neural crest as a possible pathogenetic factor. Am. J. Cardiol., 58, 133-137.
25 Handelin, B and Shuber, A.P. (1994) Simultaneous detection of multiple point mutations using allele-specific oligonucleotides. In Nicolas, C.D. et al. (eds), Current Protocols in Human Genetics. Green Publishing Associates, Inc. and John Wiley & Sons, Inc., pp. 9.4.1-9.4.8.
26 Boedigheimer, M. and Laughon, A. (1993) Expanded: a gene involved in the control of cell proliferation in imaginal discs. Development, 111, 1291-1301.
27 Lammer, E.J. and Opitz, J.M. (1986) The DiGeorge anomaly as a developmental field defect. Am. J. Med. Genet., 29, 113-127.
28 Wilson, T.A., Blethen, S.L., Vallone, A., Alenick, S.C., Nolan, P., Katz, A., Amorillo, T.P., Goldmuntz, E., Emanuel, B.S. and Driscoll, D.A. (1993) DiGeorge anomaly with renal agenesis in infants of mothers with diabetes. Am. J. Med. Genet., 47, 1078-1082.MEDLINE Abstract
29 Fukushima, Y., Ohashi, H., Wakui, T., Nishida, T., Nakamura, Y., Hoshino, K., Igawa, K. and Oh-ishi, T. (1992) DiGeorge syndrome with del (4) (q21.3q25): possibility of the fourth chromosomal region responsible for DiGeorge syndrome. Am. J. Hum. Genet., 51, 306.
30 Greenberg, F., Elder, F.F.B., Haffner, P., Nothrup, H. and Ledbetter, D. (1988a) Cytogenetic findings in a prospective series of patients with DiGeorge anomaly. Am. J. Hum. Genet., 43, 605-611.MEDLINE Abstract
31 Greenberg, F., Courtney, K.B., Wessels, R.A., Huhta, J., Carpenter, R.J., Rich, D.C. and Ledbetter, D. (1988b) Prenatal diagnosis of deletion 17p13 associated with DiGeorge syndrome. Am. J. Med. Genet., 31, 1-4.MEDLINE Abstract
32 Smith, J.D., Brinton, E.A. and Breslow, J.L. (1992) Polymorphism in the human apolipoprotein A-I gene promoter region: association of the minor allele with decreased rate in vivo and promoter activity in vitro. J. Clin. Inverst., 89, 1796-1800.
33 Yang, W.S, Nevin, D.N., Peng, R., Brunzell, J.D. and Deeb, S.S. (1995) A mutation in the promoter of the lipoprotein lipase (LPL) gene in a patient with familial combined hyperlipidemia and low LPL activity. Proc. Natl Acad. Sci. USA, 92, 4462-4466.MEDLINE Abstract
34 Bodenteich, A., Chissoe, S., Wang, Y.F. and Roe, B.A. (1994) Shotgun cloning as the strategy of choice to generate templates for high-throughput dideoxynucleotide sequencing. In Venter, J.C. (ed.), Automated DNA Sequencing and Analysis. Academic Press, London, pp. 42-50.
35 Jones, P., Qiu, J. and Rickwood, D. (1994) Primer extension. In RNA Isolation and Analysis. BIOS Scientific Publishers Ltd, p. 110.
36 Williams, C.J., Matthew, R., Considine, E., McCarron, S., Gow, P., Ladda, R., McLain, D., Michels, V.M., Murphy, W., Prockop D.J. and Ganguly, A. (1995) Three new point mutations in type II procollagen (COL2A1) and identification of a fourth family with the COL2A1 Arg-519-Cys base substitution using conformation sensitive gel electrophoresis. Hum. Mol. Genet., 4, 309-312.MEDLINE Abstract
This page is maintained by OUP admin. Last updated Fri Jan 31 11:45:11 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
