Cloning, chromosomal mapping and expression pattern of the mouse Brca2 gene
Cloning, chromosomal mapping and expression pattern of the mouse Brca2 gene Frances Connor1, Amanda Smith1, Richard Wooster2, Michael Stratton3, Alistair Dixon2, Elizabeth Campbell2, Tere-Michelle Tait2, Tom Freeman2 and Alan Ashworth1,*
1CRC Centre for Cell and Molecular Biology, Chester Beatty Laboratories, The Institute of Cancer Research, Fulham Road, London SW3 6JB, UK, 2Human Genetics Group, The Sanger Centre, Wellcome Trust Genome Campus, Hinxton, Cambs CB10 1SA, UK and 3Section of Molecular Carcinogenesis, The Institute of Cancer Research, Sutton, Surrey, UK
Received September 3, 1996;Revised and Accepted November 27, 1996
A proportion of human breast cancers result from an inherited predisposition to the disease. Mutations in the BRCA2 gene confer a high risk of breast cancer and are responsible for almost half of these cases. The recent cloning of the human BRCA2 gene has revealed that it encodes a large protein having little significant homology to known proteins. Here we describe the mouse Brca2 gene. The gene maps to mouse chromosome 5, consistent with its location on human chromosome 13q12. We have sequenced cDNA for the entire 3329 amino acid Brca2 protein and this has revealed that, like Brca1, Brca2 is relatively poorly conserved between humans and mice. Brca2 is transcribed in a diverse range of mouse tissues, and the pattern of expression is strikingly similar to that of Brca1. Taken together, our data highlight some intriguing similarities between two genes involved in inherited breast cancer susceptibility.
About one in 10 women in the Western world develop cancer of the breast, and an estimated 5% of these cases are thought to result from a hereditary predisposition to the disease, primarily due to a small number of highly penetrant autosomally dominant genes (1 ,2 ). Women that carry germ-line mutations in one of these susceptibility genes tend to develop breast cancer at an early age as well as being at elevated risk of bilateral breast cancer and other cancers such as ovarian cancer. Two breast cancer susceptibility (BRCA) genes have been mapped and cloned, and mutations in these genes are responsible for most of these cases in families with large numbers of early-onset breast cancers (1 -6 ). Analysis of >200 families has indicated that mutations in BRCA1 are responsible for predisposition in the large majority of families with both breast and ovarian cancers, but account for predisposition in only about half of families with breast cancer only (7 ). The BRCA2 gene (5 ) carries a risk of breast cancer similar to that of BRCA1, but is associated with a lower risk of ovarian cancer and a considerably higher risk of male breast cancer. Together, mutations in these genes account for ~4-5% of all breast cancers (1 ,2 ). However, no somatic, disease-causing, mutations in either BRCA1 (8 ) or BRCA2 (9 -11 ) have been reported in any breast cancer.
The BRCA1 gene is composed of 22 coding exons and encodes a protein of 1863 amino acids (4 ). Although most of the coding region shows no homology to previously described proteins, a clue to its function may be provided by the presence of a zinc finger domain at the N terminus of the protein. This domain is part of the subclass of so-called RING zinc fingers (12 ). However, the role of this potential protein-protein interaction or DNA binding motif in BRCA1 has yet to be established. Several contradictory studies have now appeared on the subcellular location of the BRCA1 protein (13 -15 ). These include nuclear, nuclear and cytoplasmic, and extracellular locations. Consistent with an extracellular localisation, Jensen et al. (1996) have suggested that the BRCA1 protein contains a granin motif (15 ). Granins are proteins that are found predominantly in secretory vesicles where they may participate in the processing of proteins whose secretion is regulated by extracellular stimuli (16 ). Granins can also function extracellularly where cleavage products can function as biologically active peptides (16 ). However, the significance of the granin motif in BRCA1 has been questioned (17 ,18 ) and its role is presently unclear.
The human BRCA2 gene has 26 coding exons spread over 70 kb of genomic DNA and produces an mRNA of ~11 kb (6 ,19 ). However, almost half the coding potential of the gene is contained within exon 11 which is almost 5 kb in length. A fragment of exon 11 [nucleotides 2537-4396 (ref. 19 )] was used to identify homologous sequences in the mouse genome by Southern blotting (data not shown). Using these hybridisation conditions, this DNA fragment was used to screen a mouse [lambda]FixII genomic library. Hybridising clones were plaque-purified and [lambda] DNA prepared. Hybridising restriction fragments were subcloned and sequenced. DNA sequence analysis revealed homology to the human BRCA2 gene within exon 11. Mouse Brca2-specific oligonucleotides were then designed and utilised to screen a mouse 129 strain genomic BAC library in the vector pBeloBACII by PCR. Positive clones were confirmed by Southern hybridisation. DNA fragments which hybridised to human BRCA2 cDNAs were then subcloned from the BAC and partially sequenced. PCR primers corresponding to mouse Brca2 were then designed and PCR used to amplify fragments of cDNA. These were then sequenced. Part of the 3' end of the cDNA including the polyadenylation site was isolated by screening a mouse testis cDNA library. Using these techniques, sequence covering all of the almost 10 kb coding region of mouse Brca2 cDNA was derived.
The full-length mouse Brca2 protein is composed of 3329 amino acids, which is considerably shorter than the 3418 amino acids encoded by the human gene (19 ). Thus the mouse Brca2 protein is predicted to be 370 432 Da with an overall negative charge (pI = 6.23). An alignment of the mouse and human proteins is shown in Figure 1 . A large number of gaps have been introduced to maintain co-linearity. Most of these gaps, the largest of which is 19 amino acids, are present in the mouse sequence, explaining its shorter overall length. The overall identity between the two sequences is 59.2% with 72.6% similarity. Although this is a relatively low level of conservation between mouse and human proteins (21 ), some parts of the protein are clearly much more highly conserved, suggesting potential functional constraints. For example, a region towards the C terminus (residues 2427-3071) is significantly more highly conserved (78.6% identity) with one 115 amino acid stretch having 92.2% identity (residues 2501-2616).
Almost half the Brca2 protein is encoded by exon 11 (residues 628-2229). This part of the protein is even more poorly conserved (52.2% identity) than the overall protein and contains most of the gaps in the sequence (37 out of 49 gaps in the mouse sequence). However, there are islands of strongly conserved residues within exon 11. Some of these correspond to the previously described BRC repeats (20 ). Elsewhere we describe the structure of exon 11 from six mammalian species and show that these repeats are highly conserved (Bignell et al., submitted). However, the functional significance of the conservation of the BRC repeats and other conserved regions of the Brca2 protein is unclear. One region of the human BRCA2 that has been suggested to have a function is the so-called granin motif (15 ). The availability of the mouse sequence provides an opportunity to re-evaluate this homology (Fig. 2 ). Although the C-terminal part of the motif is conserved, the N terminus appears to have diverged from the, albeit poorly defined, consensus. This calls into question the significance of this homology. In our original report of the cloning of human BRCA2 we noted an extremely weak homology with BRCA1 over residues 1094-1174 in BRCA2 (6 ). This corresponds to a region that is not highly conserved between mouse and human, suggesting the possibility that the observed homology was not significant. However, this does not rule out some distant evolutionary relationship between the proteins that is only revealed by comparison of the human proteins.
The relatively poor conservation of the Brca2 gene raised the question of whether we had isolated the equivalent mouse gene to human BRCA2 or another related gene. To address this question, we determined the chromosomal location in the mouse of the gene that we had isolated. One would expect that, if we had isolated the equivalent gene, it should map to a region of the mouse genome corresponding to human chromosome 13q12.
We used the European Collaborative Interspecific Backcross (EUCIB) (22 ) to map the Brca2 gene in the mouse genome. EUCIB consists of almost 1000 progeny from a backcross of C57BL/6*Mus spretus F1 hybrid animals to either C57BL/6 or M.spretus which have been analysed for the segregation of several variant markers per chromosome (22 ). Genes are mapped by identifying a variant in the gene between the two progenitor species and typing a subset of the backcross for this variant. Haplotypes are compared with previously mapped loci using a computer programme (MBx, ref. 22 ) and linkage assigned. We identified such a variant by PCR amplification of part of the Brca2 gene from C57BL/6 and M.spretus DNA and direct DNA sequencing. Primers were synthesised that amplified part of the intron preceding exon 11. Sequencing revealed the presence of a SmaI site in the M.spretus fragment but not in the C57BL/6 fragment. PCR on genomic DNA from C57BL/6 and M.spretus mice gave the expected 321 bp band. After digestion with SmaI, the C57BL/6 band remained intact whereas the M.spretus band gave two fragments of 191 and 130 bp. Thus backcross mice could be typed for the presence or absence of the M.spretus variant.
Forty three mice from the portion of the cross backcrossed to C57BL/6 were analysed using this method. Analysis of the haplotypes using the program MBx (22 ) showed that Brca2 was significantly linked to markers at the telomeric end of mouse chromosome 5 and is located ~14 cM (±5.3 cM) distal to the marker D5Nds6 (the gene Gus) (23 ). Human BRCA2 maps to chromosome 13q12 (5 ) and other genes that map to this part of mouse chromosome 5, such as the FMS-like tyrosine kinases 1 and 3 (Flt1 and Flt3) and the cationic amino acid transporter (Atrc1), are also located on chromosome 13q12 in humans (23 ). Given this conservation of linkage, we conclude that we have most likely isolated the mouse equivalent of the human BRCA2 gene. No mutations for which Brca2 is an obvious candidate have been described in this region of mouse chromosome 5 (23 ).
Surprisingly, given its large size, the sequence of the human breast cancer susceptibility gene BRCA2 provided few clues as to its normal cellular function or its role as a tumour suppressor gene (6 ,19 ). Evolutionary comparisons can provide considerable insights into the identification of functional domains in proteins. Here we describe the structure of the mouse Brca2 cDNA. The high divergence rate of the Brca2 protein allows the assessment of any putatively important functional domains. The granin motif has been suggested to be functionally important in both the human BRCA1 and BRCA2 proteins (15 ). Granins are a family of acidic proteins that bind calcium and aggregate in its presence, and they are found predominantly in secretory vesicles (16 ,25 ). Intracellularly, granins participate in the regulated secretory pathway which is involved in the processing of proteins whose secretion is regulated by extracellular stimuli. Granins can also function extracellularly where cleavage products can function as biologically active peptides. These can function in an autocrine or paracrine fashion. BRCA1 has been suggested to have several of the hallmarks of the granin family; it has been suggested to be localised to secretory vesicles, to be a secretory protein, to be post-translationally glycosylated and to be estrogen-regulated (15 ). Human BRCA2 has also been suggested to contain a motif showing some similarity to the granin consensus (15 ). However, the potential granin motif in human BRCA2 (Fig. 2 ) is less similar to the granin consensus than is BRCA1. The mouse Brca2 sequence presented here is even more remote from the consensus. Furthermore, the granin motif itself has not been shown to be sufficient in itself for secretion (16 ,25 ). Although this does not rule out the possibility that either Brca1 or Brca2 is secreted, it seems unlikely that this is due to the granin motif itself. Furthermore, the expression pattern of the Brca2 and Brca1 genes in mice is also distinct from known members of the granin gene family (Fig. 3 ), further questioning the relationship between the proteins.
Tumour suppressor genes are a functionally diverse set of proteins which have in common the fact that their loss leads to tumourigenesis. Functions include proteins involved in transcriptional regulation/splicing (WT1), cell cycle control (RB) and signal transduction (NF1). Despite the heterogeneity in function, tumour suppressor genes are, in general, highly conserved between mice and humans (Table 1 ). In contrast, Brca2 is relatively poorly conserved between mouse and man. The large size of the Brca2 protein appears not to be an important factor in its lack of divergence, as both NF1 (2841 amino acids) and ATM (3056 amino acids) are of similar size (26 ,27 ). Intriguingly, the other known breast cancer susceptibility gene Brca1 is also similarly conserved between humans and mice (28 ,29 ). Thus it appears that Brca1 and Brca2 may be evolving at similar rates. Considerable gapping is necessary to align both proteins between the two species, which is also an unusual feature. For Brca2, most of the gaps have to be introduced within the large 5 kb exon 11. Brca1 also contains an unusually large exon 11 of 3.4 kb. The average size of an exon in mammalian DNA is 140 bp (30 ) so exon 11 in both genes is remarkably large. Thus the two genes show some similarity in organization as well as in rate of evolution.
Analysis of the expression pattern of the mouse Brca2 gene has revealed that, like the human gene (19 ), the mouse gene is widely transcribed. A previous analysis of the expression pattern of the Brca1 gene has also demonstrated widespread transcription (31 ). Analysis of the expression pattern of Brca1 using the same samples used for Brca2 shows that both genes have strikingly similar patterns of expression in mice (Fig. 3 ); both genes are highly expressed in several regions of the brain, the eye, the testis and ovary, and in addition both genes appear to be highly induced in the mammary gland on pregnancy. The wide distribution and overlapping expression pattern of the genes was also seen in late fetal stages of mouse development. Studies are underway to determine if this is due to common regulatory elements in the promoters of the genes.
Sequence of primers used for RT-PCR expression profiling
Gene symbol and name
Accession no.
Primer
Nucleotides
Sequence
Product size
Brca2
U82270
Forward
9739-9758
5'-CCATTTCAGAAGACCAGTGG
283
Reverse
10041-10022
5'-ACGAACACCTATGAGTAGCC
Brca1
U32446
Forward
5268-5287
5'-CCCAAAGATGAGCTGGAGAG
183
Reverse
5450-5431
5'-GTCCCACATCACAAGACGTG
Chga
M64278
Forward
1678-1695
5'-ACACTTCTGCAGGGCAGC
113
Chromogranin A
Reverse
1790-1771
5'-AGTTATTGCAGTTGTGCCCC
Chgb
X51429
Forward
2126-2145
5'-ATTCACCCACAGGCAGAAG
111
Chromogranin B
Reverse
2236-2215
5'-ACAAGTCACGCTAGTCACATGG
Chgc
X68838
Forward
378-395
5'-GTGGAATGCGGAGTCAGG
102
Chromogranin C
Reverse
461-479
5'-CAAGCATGCTCCTCTCTGC
Scg3
U02982
Forward
2056-2075
5'-TGTCTCGGCATGCTAGACAC
101
Secretogranin III
Reverse
2156-2137
5'-GACGTGGGTTTATTTCCGTG
Csna
M36780
Forward
1103-1124
5'-GCCAATGATTCATCTTGAGTTG
128
[alpha]-Casein
Reverse
1230-1211
5'-CCTTGATTCTCTCCGCTCAG
Lamr1
J02870
Forward
853-870
5'-CATCCAGCAGTTCCCCAC
122
Laminin receptor
Reverse
974-955
5'-CAGCAGATCAGGACCACTCA
Taken together, the data presented here suggest a number of intriguing similarities in gene organisation, expression and conservation of the two breast cancer susceptibility genes isolated thus far. Whether this reflects an ancestral evolutionary relationship or functional interaction of the two proteins in a common pathway remains to be determined.
A 1.9 kb DNA fragment derived from human BRCA2 exon 11 (nucleotides 2357-4396 in ref. 19 ) was generated by PCR and used to screen a 129 mouse genomic library in the vector [lambda]FixII. Hybridisation was at 60oC in RapidHyb (Amersham) and filters were washed in 2* SSC/0.1%SDS at room temperature. Hybridising clones were plaque-purified and DNA prepared using standard techniques. The 129 mouse genomic BAC library in the vector pBeloBACII was screened by PCR as described by the suppliers (Genome Systems Inc.). Fragments hybridising to human BRCA2 cDNA were subcloned into pBluescript and and sequenced using the Taq FST Terminator Cycle Sequencing kit and the 377 DNA Sequencer (Applied Biosystems). Oligonucleotides designed from exons of mouse Brca2 were used to generate cDNA fragments for sequencing using PCR from reverse-transcribed mouse testis RNA. The 3'-terminal 1.5 kb of cDNA was derived by screening a mouse testis cDNA library in [lambda]ZAP. Further oligonucleotide primers and various deletion templates generated by subcloning specific restriction fragments was used to obtain the sequence of both strands.
The European Collaborative Interspecific Backcross (EUCIB; ref. 22 ) was used to map the Brca2 gene in the mouse genome. The segregation of the C57BL/6 and M.spretus (EUCIB parental species) Brca2 alleles was followed by digestion of PCR products with SmaI. Genomic DNAs from the backcross parental species and from 43 randomly chosen samples from the backcross to C57BL/6 were amplified by PCR using the Brca2-specific primers CTGTTCCATTCCTCATCATCTCC and GAGCAAAGGGTGACTTAGAG designed from the sequence from the intron between exons 10 and 11. The PCRs were subjected to 30 cycles of 94oC for 30 s, 50oC for 30 s and 72oC for 1 min, followed by a final incubation at 72oC for 5 min. The buffer was adjusted to be compatible with SmaI by the addition of KCl, MgCl2 and Tris-HCl (pH 7.0) then 10 U of SmaI were added. After incubation at room temperature for 4 h, the samples were electrophoresed in 4% Metaphor agarose (FMC products) gels. The segregation pattern was analysed and linkage assigned using the MBx database (ref. 22 ) at the HGMP Resource Centre, UK.
Male and female mice (C57B L/6, 6-8 weeks old) were killed by cervical dislocation. Tissue was dissected out, snap frozen in isopentane cooled by solid CO2 and stored at -70oC. Total RNA was extracted using an InVisorb kit (Bioline Ltd.), DNase I treated, and reverse transcribed in the presence of an anchored oligo(dT) primer, T17(A,G,C), using M-MLV reverse transcriptase (Gibco-BRL). PCR primers were designed and synthesised (Genset) to give products of between 100 and 300 bp in length from close to the 3' end of the target sequence (see Table 2 for primer sequences). Each PCR cycle consisted of denaturing at 92oC for 30 s, annealing at 55 or 60oC for 2 min, and extension at 72oC for 1 min. The reaction mixture contained 0.5 mM dNTPs, 0.625 U of DNA polymerase (AmpliTaq, Applied Biosystems), 12.5% sucrose, 1* PCR buffer (3.5 mM Mg2+, pH 8.8), 200 ng of each primer, and cDNA equivalent to ~10 ng of total RNA. PCR reactions were carried out on a PTC-225 thermal cycler (MJ Research) in 96-well plates (Costar). All PCR assays were carried out in duplicate on the same single-stranded cDNAs. PCR products were separated on 2.5% agarose gels and visualised by staining with ethidium bromide. The cDNA panel employed here has been established as part of a large project to examine tissue specificity of gene expression and has already been used to profile the expression pattern of ~200 mouse genes (T.F., in preparation).
Cryostat sections (10 µm) were thaw-mounted onto poly-L-lysine-coated slides, fixed in phosphate-buffered 4% paraformaldehyde and stored in 95% ethanol at 4oC. The basic method used for in situ hybridization has been described previously (32 ). Briefly, specific antisense oligonucleotide probes complementary to the mouse Brca2 and Brca1 mRNAs were labelled with [[alpha]-35S]dATP (>1000 Ci/mmol, Amersham) using terminal deoxynucleotidyl transferase at 32oC for 1 h. A pool of 2-5 oligonucleotides (40-45mers) was used, the sequences of which are available on request. Labelled probe was applied to sections in hybridization buffer containing 4* SSC, 50% deionised formamide. The slides were incubated overnight at 42oC before being washed in 1* SSC containing 0.1% sodium thiosulphate for 1 h at 55oC and dehydrated through alcohol. Slides were exposed to X-ray film (Hyperfilm-[beta]max, Kodak) for 12 days, then dipped in Ilford K5 emulsion and stored desiccated at 4oC for 6 weeks. After development, sections were stained with haematoxylin and eosin.
1 Stratton, M.R. and Wooster, R. (1996) Hereditary predisposition to breast cancer. Curr. Opin. Genet.Dev., 6, 93-97.
2 Szabo, C.A. and King, M.-C. (1995) Inherited breast and ovarian cancer. Hum. Mol. Genet.,4,1811-1817.
3 Hall, J.M., Lee, M.K., Newman, B., Morrow, J.E., Anderson, L.A., Huey, B. and King, M.C. (1990) Linkage of early-onset familial breast cancer to chromosome 17q 21. Science, 250, 1684-1689.MEDLINE Abstract
4 Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P.A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennett, L.M., Ding, W., Bell, R., Rosenthal, J., Hussey, C., Tran, T., McClure, M., Frye, C., Hattier, T., Phelps, R., Haugen-Strano, A., Katcher, H., Yakumo, K., Gholami, Z., Shaffer, D., Stone, S., Bayer, S., Wray, C., Bogden, R., Dayananth, P., Ward, J., Tonin, P., Narod, S., Bristow, P.K., Norris, F.J., Helvering, L., Morrison, P., Rosteck, P., Lai, M., Barrett, J.C., Lewis, C., Neuhausen, S., Cannon-Albright, L., Goldgar, D., Wiseman, R., Kamb, A. and Skolnick, M.H. (1994) A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science, 266, 66-71.MEDLINE Abstract
5 Wooster, R., Neuhausen, S.L., Mangion, J., Quirk, Y., Ford, D., Collins, N., Nguyen, K., Seal, S., Tran, T., Averill, D., Fields, P., Marshall, G., Narod, S., Lenoir, G.M., Lynch, H., Feunteun, J., Devilee, P., Cornelisse, C.J., Menko, F.H., Daly, P.A., Ormiston, W., McManus, R., Pye,C., Lewis, C.M., Cannon-Albright, L.A., Peto, J., Ponder, B.A.J., Skolnick, M.H., Easton, D.F., Goldgar, D.E. and Stratton, M.R. (1994) Localization of a breast-cancer susceptibility gene, BRCA2, to chromosome 13q12-13. Science, 265, 2088-2090.MEDLINE Abstract
6 Wooster, R., Bignell, G., Lancaster, J., Swift, S., Seal, S., Mangion, J., Collins, N., Gregory, S., Gumbs, C., Micklem, G., Barfoot, R., Hamoudi, R., Patel, S., Rice, C., Biggs, P., Hashim, Y., Smith, A., Connor, F., Arason, A., Gudmundsson, J., Ficenec, D., Kelsell, D., Ford, D., Tonin, P., Bishop, T., Spurr, N.K., Ponder, B.A.J., Eeles, R., Peto, J., Devilee, P., Cornelisse, C., Lynch, H., Narod, S., Lenoir, G., Egilsson, V., Barkadottir, R.B., Easton, D.G., Bentley, D.R., Futreal, P.A., Ashworth, A. and Stratton, M.R. (1995) Identification of the breast cancer susceptibility gene BRCA2. Nature, 378, 789-791.MEDLINE Abstract
7 Easton, D.F., Bishop, D.T., Ford, D. and Crockford, G.P. (1993) Genetic linkage analysis in familial breast and ovarian cancer: result from 214 families. The Breast Cancer Linkage Consortium. Am. J. Hum. Genet., 52, 678-701.MEDLINE Abstract
8 Futreal, P.A., Liu, Q., Shattuck-Eidens, D., Cochran, C., Harshman, K., Tavtigian, S., Bennett, L.M., Haugen-Strano, A., Swensen, J., Miki, Y., Eddington, K., McClure, M., Frye, C., Weaver-Feldhaus, J., Ding, W., Gholami, Z., Soderkvist, P., Terry, L., Jhanwar, S., Berchuck, A., Iglehart, J.D., Marks, J., Ballinger, D.G., Barrett, J.C., Skolnick, M.H., Kamb, A. and Wiseman, R. (1994) BRCA1 mutations in primary breast and ovarian carcinomas. Science, 266, 120-122.MEDLINE Abstract
9 Lancaster, J.M., Wooster, R., Mangion, J., Phelan, C.M., Cochran, C., Gumbs, C., Seal, S., Barfoot, R., Collins, N., Bignell, G., Patel, S., Hamoudi, R., Larsson, C., Wiseman, R.W., Berchuck, A., Iglehart, J.D., Marks, J.R., Ashworth, A., Stratton, M.R. and Futreal, P.A. (1996) BRCA2 mutations in primary breast and ovarian cancers. Nature Genet., 13, 238-240.MEDLINE Abstract
10 Miki, Y., Katagiri, T., Kasumi, F., Yoshimoto, T. and Nakamura, Y. (1996) Mutation analysis in the BRCA2 gene in primary breast cancers. Nature Genet., 13, 245-247.MEDLINE Abstract
11 Teng, D.H.F., Bogden, R., Mitchell, J., Baumgard, M., Bell, R., Berry, S., Davis, T., Ha, P.C., Kehrer, R., Jammulapati, S., Chen, Q., Offit, K., Skolnick, M.H., Tavtigian, S. V., Jhanwar, S., Swedlund, B., Wong, A.K.C. and Kamb, A. (1996) Low incidence of BRCA2 mutations in breast carcinoma and other cancers. Nature Genet.,13, 241-244.
12 Saurin, A.J., Borden, K.L.B., Boddy, M.N. and Freemont, P.S. (1996) Does this have a familiar RING? Trends Biochem., 21, 208-214.
13 Chen, Y., Chen, C.-F., Riley, D.J., Alfred, D.C., Chen, P.-L., Hoff, D.V., Osborne, C.K. and Lee, W.-H. (1995) Aberrant subcellular localization of BRCA1 in breast cancer. Science, 270, 789-791.MEDLINE Abstract
14 Scully, R., Ganesan, S., Brown, M., De Caprio, J.A., Cannistra, S.A., Feunteun, J., Schnitt, S. and Livingston, D.M. (1996) Location of BRCA1 in human breast and ovarian cancer cells. Science, 272, 123-124.
15 Jensen, R.A., Thompson, M.A., Jetton, T.L., Szabo, C.I., Van der Meer, R., Helou, B., Tronick, S.R., Page, D.L., King, M.-C. and Holt, J.T. (1996) BRCA1 is secreted and exhibits properties of a granin. Nature Genet.,13, 303-308.MEDLINE Abstract
16 Huttner, W.B., Gerdes, H.-H. and Rosa, P. (1991) The granin (chromogranin secretogranin) family. Trends Biochem., 16, 27-30.
18 Jensen, R.A., Thompson, M.E., Jetton, T.L., Van der Meer, R., Helou, B., Arteaga, C.L., Page, D.L. and Holt, J.T. (1996) Nature Genet.,13, 269-271.
19 Tavtigian, S.V., Simard, J., Rommens, J., Couch, F., Shattuckeidens, D., Neuhausen, S., Merajver, S., Thorlacius, S., Offit, K. and Stoppalyonnet, D. (1996) The complete BRCA2 gene and mutations in chromosome 13q-linked kindreds. Nature Genet., 12, 333-337.MEDLINE Abstract
20 Bork, P., Blomberg, N. and Nilges, M. (1996) Internal repeats in the BRCA2 protein sequence. Nature Genet.,13, 22-23.MEDLINE Abstract
21 Collins, D.W. and Jukes, T.H. (1994) Rates of transition and transversion in coding sequences since the human-rodent divergence. Genomics, 20, 386-396.MEDLINE Abstract
22 The European Interspecific Backcross Group (1994) Towards high resolution maps of the mouse and human genomes-a facility for ordering markers to 0.1 cM. Hum. Mol. Genet., 3, 621-627.
23 Kozak, C.A., Bucan, M., Goffinet, A. and Stephenson, D.A., (1996) Mouse chromosome 5. Mamm. Genome, 6, S97-S112.
24 Roberts, R.G., Freeman, T.C., Kendall, E., Vetrie, D.L.P., Dixon, A.K., Shaw-Smith, C.J., Bone, Q. and Bobrow, M. (1996) DRP2, a novel vertebrate dystrophin homologue: evolution, expression and gene structure. Nature Genet., 12, 223-226.
25 Steeg, P.S. (1996) Granin expectations in breast cancer? Nature Genet., 12, 223-225.MEDLINE Abstract
26 Bernards, A., Snijders, A J., Hannigan, G.E., Murthy, A.E. and Gusella, J.G. (1993) Mouse neurofibromatosis type 1 cDNA sequence reveals high degree of conservation of both coding and non-coding mRNA segments. Hum. Mol. Genet., 2, 645-650.MEDLINE Abstract
27 Pecker, I., Avraham, K.B., Gilbert, D.J., Savitsky, K., Rotman, G., Harnik, R., Fukao, T., Schrock, E., Hirotsune, S., Tagle, D.A., Collins, F.S., Wynshaw-Boris, A., Ried, T., Copeland, N.G., Jenkins, N.A., Shilkoh, Y. and Ziv, Y. (1996) Identification and chromosomal localization of Atm, the mouse homolog of the ataxia-telangiectasia gene. Genomics, 35, 39-45.MEDLINE Abstract
28 Sharan, S.K., Wims, M. and Bradley, A. (1995) Murine Brca1: sequence and significance for human missense mutations. Hum. Mol. Genet.,4, 2275-2278.MEDLINE Abstract
30 Hawkins, J.D. (1988) A survey on intron and exon lengths. Nucleic Acids Res., 16, 9893-9908.MEDLINE Abstract
31 Marquis, S.T., Rajan, J.V., Wynshaw-Boris, A., Xu, T.J., Yin, G.Y., Abel, K.J., Weber, B.L. and Chodosh, L.A. (1995) The development pattern of BRCA1 expression implies a role in differentiation of the breast and other tissues. Nature Genet., 11, 17-26.MEDLINE Abstract
32 Sirinathsinghji, D.J.S .and Dunnet, S.B. (1993) Imaging gene expression in neural grafts. In Sharif., N.A. (ed.), Molecular Imaging in Neuroscience: A Practical Approach. Oxford University Press, Oxford, pp. 43-70.
33 Szabo, C.I., Wagner, L.A., Francisco, L.V., Roach, J.C., Argonza, R., King, M.-C. and Ostlander, E.A. (1996) Human, canine and murine BRCA1 genes: sequence comparison among species. Hum. Mol. Genet., 5, 1289-1298.MEDLINE Abstract
34 Haase, V.H., Trofatter, J.A., MacCollin, M., Tartelin, E., Gusella, J.F. and Ramesh, V. (1994) The murine NF2 homologue encodes a highly conserved merlin protein with alternative forms. Hum. Mol. Genet., 3, 407-411.MEDLINE Abstract
35 Buckler, A.J., Pelletier, J., Haber, D.A., Glaser, T. and Housman, D.E. (1991) Isolation, characterization and expression of the murine Wilms' tumor gene (WT1) during kidney development. Mol. Cell. Biol., 11, 1707-1711.MEDLINE Abstract
36 Bernards, R., Schackleford, G.M., Gerber, M.R., Horowitz, J.M., Friend, S.H., Schartl, M., Bogenmann, E., Rapaport, J.M., McGee, T., Dryja, T.P. and Weinberg, R.A. (1989) Structure and expression of the murine retinoblastoma gene and characterization of its encoded protein. Proc. Natl Acad. Sci USA, 86, 6474-6478.MEDLINE Abstract
37 Su, L.K., Kinzler, K.W., Vogelstein, B., Preisinger, A.C., Moser, A.R., Luongo, C., Gould, K.A. and Dove, W.F. (1992) Multiple intestinal neoplasia caused by a mutation in the murine homolog of the APC gene. Science, 256, 668-670.MEDLINE Abstract
38 Gao, J., Naglich, J.G., Laidlaw, J., Whaley, J.M., Seizinger, B.R. and Kley, N. (1995) Cloning and characterization of a mouse gene with homology to the human von Hippel-Lindau disease tumor suppressor gene: implications for the potential organization of the human von Hippel-Lindau disease gene. Cancer Res., 55, 743-747.MEDLINE Abstract
39 Zakut-Houri, R., Bienz-Tadmor, B., Givol, D. and Oren, M. (1985) Human p53 cellular tumor antigen: cDNA sequence and expression in COS cells. EMBO J., 4, 1251-1255.MEDLINE Abstract
This page is maintained by OUP admin. Last updated Fri Jan 31 11:45:11 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
