Disruption of the clathrin heavy chain-like gene (CLTCL) associated with features of DGS/VCFS: a balanced (21;22)(p12;q11) translocation
Disruption of the clathrin heavy chain-like gene ( CLTCL ) associated with features of DGS/VCFS: a balanced (21;22)(p12;q11) translocation Susan E. Holmes1,+, M. Ali Riazi2,+, Weilong Gong1, Heather E. McDermid2, Beatrice T. Sellinger1, Axin Hua3, Feng Chen3, Zhili Wang3, Guozhang Zhang3, Bruce Roe3, Iris Gonzalez4, Donna M. McDonald-McGinn1, Elaine Zackai1,5, Beverly S. Emanuel1,5 and Marcia L. Budarf1,5,*
1The Division of Human Genetics and Molecular Biology, The Children's Hospital of Philadelphia, Philadelphia, PA 19104, USA, 2Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada, 3The Department of Chemistry and Biochemistry, University of Oklahoma, Norman, OK 73019, USA, 4A.I. DuPont Institute, Nemours Foundation, Wilmington, DE 19899, USA and 5The Department of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, PA 19104, USA
Received October 28, 1996;Revised and Accepted December 31, 1996
The smallest region of deletion overlap in the patients we have studied defines a DiGeorge syndrome/velocardiofacial syndrome (DGS/VCFS) minimal critical region (MDGCR) of ~250 kb within 22q11. A de novo constitutional balanced translocation has been identified within the MDGCR. The patient has some features which have been reported in individuals with DGS/VCFS, including: facial dysmorphia, mental retardation, long slender digits and genital anomalies. We have cloned the breakpoint of his translocation and shown that it interrupts the clathrin heavy chain-like gene (CLTCL) within the MDGCR. The breakpoint of the translocation partner is in a repeated region telomeric to the rDNA cluster on chromosome 21p. Therefore, it is unlikely that the patient's findings are caused by interruption of sequences on 21p. The chromosome 22 breakpoint disrupts the 3' coding region of the CLTCL gene and leads to a truncated transcript, strongly suggesting a role for this gene in the features found in this patient. Further, the patient's partial DGS/VCFS phenotype suggests that additional features of DGS/VCFS may be attributed to other genes in the MDGCR. Thus, haploinsufficiency for more than one gene in the MDGCR may be etiologic for DGS/VCFS.
DiGeorge syndrome (DGS), velocardiofacial syndrome (VCFS) and conotruncal anomaly face syndrome (CTAF), are three of several congenital disorders associated with chromosomal abnormalities of 22q11.2 (1 -4 ). Overlapping phenotypes suggested that DGS and VCFS share a common etiology (5 ), and molecular studies have confirmed this (1 -3 ). DGS/VCFS is a developmental field defect of structures arising primarily from the 3rd and 4th pharyngeal arches which are populated by migrating cephalic neural crest cells. Candidate genes for these disorders include those affecting migration or differentiation of these cells. Several genes mapping to the deleted region have been characterized, but none have been clearly associated with any of the phenotypic features.
The majority of patients with DGS/VCFS (~90%) have a common large deletion, and a minority have smaller deletions, unbalanced translocations or no detectable abnormality of 22q11.2. Though the phenotype is highly variable, there is no correlation between deletion size and phenotype (1 ). The minimal DGS/VCFS critical region (MDGCR) is defined as the region most likely to contain the gene or genes etiologic for DGS/VCFS. We currently delineate the MDGCR as a 250 kb region, bordered on the centromeric side by the common proximal deletion endpoint and distally by the breakpoint of an unbalanced 15;22 translocation in a patient with VCFS (6 ). With the analyses of additional patients, this region could narrow further. In fact, a recent report describes `patient G' (7 ) with mild DGS/VCFS features and a deletion endpoint which could exclude a significant portion of the proximal end of the MDGCR. We have generated a transcription map which identifies 11 transcripts within this region (8 ) and another novel transcript has recently been reported which may produce a functional RNA (9 ). The only reported balanced translocation associated with features of DGS or more specifically `partial DiGeorge syndrome' is a t(2;22) in the patient ADU (10 ). This breakpoint was shown to be within the MDGCR (11 -13 ) and was cloned and shown to occur within an open reading frame (ORF) (11 ). However, subsequent studies suggest that a common polymorphism would lead to a frameshift in this ORF (Holmes et al., unpublished). To date, a functional gene has not been found which spans this breakpoint, and thus the possibility remains that the translocation is exerting a position effect on a gene or genes in the region.
The patient was evaluated by Clinical Genetics at Children's Hospital of Philadelphia at age 5 years 6 months as part of his comprehensive developmental examination. He was noted to have an IQ of 44 (Stanford Binet), with verbal IQ greater than performance. On physical examination, the patient was noted to be dysmorphic with slightly upslanting palpebral fissures, bulbous nose and simple prominent large ears with overfolded helices (Fig. 1 A). There was first degree hypospadias and a history of surgery for bilateral cryptorchidism. He was also noted to have hypermobile joints of the fingers and wrists. Past history revealed a seizure disorder diagnosed at age 2 years and extraocular muscle imbalance. Family history revealed five normal siblings and a single miscarriage. The patient was shown by cytogenetic analysis to carry a de novo balanced (21;22)(p12;q11) translocation (14 ).
On recent re-evaluation at the age of 23 years, pertinent history revealed: a posterior subcapsular cataract removed at age 14 years, a small cataract in the other eye and scoliosis. Developmental assessment using the Wechsler Adult Intelligence Scale-Revised (WAIS-R) was performed at age 20 years and revealed a full scale IQ of 60, with verbal IQ of 66 and performance IQ of 56. His physical examination, in addition to the findings noted previously, revealed macrocephaly, hooded upper eyelids, prominent nasal root, narrow alae nasi with prominent nasal tip, high arched palate, long slender fingers and hypotonia (Fig. 1 B and C).
In situ hybridization studies using tritium-labeled probes had demonstrated previously that the 22q11 breakpoint was located proximal to the constant region of the immunoglobulin [lambda] light chain locus (IGL) (14 ). A more detailed analysis utilizing FISH was therefore performed. Individual cosmid probes mapping to 22q11.2, together with a control probe which maps to the distal long arm of chromosome 22 (D22S39), were co-hybridized to metaphase chromosomes. Preliminary results localized the TOH breakpoint distal to D22S43, a locus in the cat eye syndrome region, and proximal to the entire IGL gene cluster. These results suggested that the breakpoint could be located in the DGS/VCFS region.
A cosmid for D22S75, 5D9, which maps to the MDGCR and is deleted in the majority of DGS/VCFS patients, was tested using FISH. A signal was seen on both of the derivative chromosomes (Fig. 2 A), suggesting that the cosmid could span the breakpoint. To investigate this possibility, cosmids which map immediately proximal and distal to 5D9 were tested on metaphase spreads from the patient. A more proximal cosmid in the contig (79H12), which overlaps by ~13 kb with 5D9, demonstrated no hybridization to the der(21), but strong signal on the der(22) (data not shown), indicating that the TOH translocation breakpoint is located distal to 79H12. Similarly, a more distal cosmid (98B11), which overlaps 5D9 by ~18 kb, showed no hybridization to the der(22) in any of the metaphase spreads examined, but strong signal on the der(21) (data not shown). These results indicated that the TOH translocation breakpoint localized to ~10 kb in the middle of 5D9.
The 3' region of the previously identified clathrin-like transcript CLTCL (8 ) is located in the portion of 5D9 which appeared to contain the breakpoint. We thus undertook to narrow the breakpoint region using a probe from the 3' end of the cDNA and TOH DNA samples digested with several enzymes. Novel fragments were detected in the HindIII-digested DNA of TOH but not the control DNA, suggesting a rearrangement (data not shown). We then designed several PCR probes from genomic sequence available from the region to narrow the breakpoint further (Fig. 2 C). `TOH2' and `TOH3' each detected one novel fragment in various digests (data not shown), whereas probe `TOH4' detected both novel fragments in several digests, including SstI and BamHI (Fig. 2 B). Only one rearrangement fragment could be detected in HindIII-digested DNA (Fig. 2 B), suggesting that the breakpoint was very close to the HindIII site within `TOH4'; indeed the breakpoint proved to be five nucleotides centromeric to this site.
Size-selected libraries were constructed from BamHI-digested DNA of the patient TOH. Probing of Southern blots with `TOH2' and `TOH3' demonstrated that the 4.2 kb novel BamHI fragment was derived from the der(22), while the 2.5 kb novel fragment was derived from the der(21) (data not shown). The BamHI-digested TOH DNA in these size ranges was excised from an agarose gel and cloned into the Uni-zap vector (Stratagene). A portion of the lane was blotted and probed with `TOH4' to confirm that the excised regions indeed contained the derivative fragments.
Both libraries were screened with `TOH4' and several positive clones were identified from each. Clone 6.1.A from the `der(22)' library and clone 7.A from the `der(21)' library were purified, and DNA was isolated and sequenced. Comparison of the sequences with chromosome 22 genomic sequence in the predicted breakpoint region (GenBank accession no. L77569) revealed that each clone contained a portion of chromosome 22 adjacent to novel sequence (Fig. 2 D).
The chromosome 22 side of the breakpoint falls near the 3' end of the CLTCL transcript which is encoded by 33 exons (Figs 2 C and 3 ). The breakpoint is within intron 27, 32 bp 5' of exon 28. A transcript interrupted at this point would encode a protein lacking the 142 amino acids contained in exons 28-33. Examination of the novel sequence from chromosome 21 downstream of the breakpoint reveals potential splice acceptor sites, but also multiple stop codons in all three reading frames. The translocation is balanced with respect to chromosome 22, as comparison of the two derivative sequences with the normal 22 indicates no loss of sequence (Fig. 2 D).
We have taken several approaches towards localization and characterization of the chromosome 21 sequence interrupted by the translocation. PCR primers (see Materials and Methods) were designed from the chromosome 21 portions of the derivative chromosomes and used for amplification of ~300 bp of the normal 21 spanning the breakpoint region (Fig. 2 C). The sequence of PCR-amplified product from hybrid GM08854, which contains only human chromosome 21 on a mouse background, was used for comparison with the derivative chromosome sequences. No sequence is lost from the chromosome 21 partner, though an extra `A' is inserted at the breakpoint (Fig. 2 D, italics).
These primers also amplified sequences from all the acrocentric chromosomes (13,14,15, 21 and 22) in monochromosomal hybrids, suggesting that the breakpoint falls within a region present on all acrocentrics. Sequence comparisons of the amplified products from all five pairs revealed that the breakpoint sequence is highly conserved (>95%). Amplification was not seen from any of six hybrids containing non-acrocentric chromosomes (1, 4, 7, 16, 19 and X).
Chromosome 21 sequence (2 kb) flanking the breakpoint region was obtained from the derivative chromosome phage clones. The sequence was subjected to BLASTn searches against the non-redundant database PDB + Gbupdate + Genbank + EMBLupdate + EMBL (15 ), and the only significant homology found was to a non-coding region between MER repeats within the MHC class II region which contains a cluster of genes involved in antigen processing. In particular, the sequences were compared with rDNA spacer sequences and no matches were found, indicating that the breakpoint is not within the rDNA cluster. Cytogenetic analysis had suggested, but not firmly established, the localization of the breakpoint distal to the rDNA. This was confirmed by FISH using a 28S rDNA probe (16 ). The 28S probe hybridized to single regions on the der(21) and on the der(22) (data not shown). By chromosomal morphology, it could be determined that the single signal detected on the der(22) represents the rDNA region derived from the chromosome 22 short arm; thus the der(22) contains no detectable rDNA translocated to its long arm from chromosome 21. A signal is detected on the der(21), positioning the chromosome 21 breakpoint telomeric to the rDNA.
To estimate the copy number of the repeated region found at the breakpoint, a PCR probe containing 430 nucleotides of chromosome 21 sequence immediately telomeric to the breakpoint was used to screen a 3* coverage genomic PAC library of total human DNA, and to probe a Southern blot containing DNA from a panel of monochromosomal hybrids. The probe detected 40-45 PACs, and 3-7 bands in each of the acrocentric monochromosomal hybrid DNA lanes (data not shown), again confirming the repeated nature of the breakpoint region. The probe did not hybridize with DNA from hybrid GM10479, which contains as its only human chromosome a copy of chromosome 14 lacking rDNA, suggesting that the breakpoint repeat is specific to the acrocentric short arms.
We and others previously have reported sequence for CLTCL (8 ,17 ,18 ). To obtain the 5' end of this transcript, RACE was performed using a primer from the 5' end of our cDNA sequence. A 293 bp PCR product was generated which contained the predicted start codon. Sequence analysis demonstrated that this product matched the corresponding genomic sequence. However, the first 22 bp of the 5' RACE product differs from a reported sequence (U41763), suggesting that U41763 may have a chimeric 5'-untranslated region. Our results allowed assembly of a 5506 bp cDNA sequence spanning 116 kb of genomic DNA near the telomeric end of the MDGCR. The gene is oriented telomeric (5') to centromeric (3') (Fig. 3 ). We have determined the intron-exon structure of this gene (Table 1 ). It contains 33 exons ranging in size from 40 (exon 32) to 493 bp (exon 33) and introns ranging from 71 bp (intron 25) to 21.4 kb (intron 2) (Table 1 ). All splice acceptor sites contain the nearly invariant AG, with the exception of intron 9, which contains `GG'. All splice donor sites contain the nearly invariant GT, except for intron 22, which contains `TA'. (Full information is available in the GenBank entry.) Analysis of the 5' region of CLTCL revealed a 1 kb CpG island containing exon 1 and ~ 450 bp 5' and 3'. The putative promoter region contains nine SpI elements, but no TATA or CAAT box.
By Northern blot analysis, CLTCL is expressed most abundantly in adult skeletal muscle, and at a low level in adult heart, fetal liver and fetal kidney (8 ). We have also used RT-PCR to examine expression of CLTCL in 9-12-week human fetal tissue, using primers covering exons 6-14. Expression is seen in various tissues, including the heart and cephalic region (data not shown). Expression was not detected in placenta. Products were sequenced to confirm their identity as CLTCL.
We have examined the expression of CLTCL in fibroblast and lymphoblastoid cell lines from TOH and a control individual. Northern blots probed with the PCR probe covering exons 6-14 revealed a transcript of the expected size. The abundance of the transcript is greater in fibroblast than in lymphoblastoid cell lines. An abnormally sized transcript was not detected in TOH cell lines, indicating that any transcript derived from the disrupted copy of CLTCL is either unstable, produced at undetectably low levels or not distinguishable in size from the full-length transcript. Preliminary results show that the expression level of CLTCL in TOH fibroblasts is approximately half that seen in a control individual, suggesting that the truncated transcript is unstable, and the detected signal represents mRNA transcribed from TOH's intact chromosome 22 (Fig. 4 ).
An abnormal phenotype in a patient with a balanced chromosomal rearrangement is an uncommon finding, occurring in <10% of individuals who present with a de novo translocation (21 ). Our patient, TOH, has a unique phenotype which includes some but not all of the features seen in DGS/VCFS. He carries a de novo t(21;22)(p12;q11) with a breakpoint distal to the rDNA on 21p and a chromosome 22 breakpoint which disrupts the CLTCL gene in the MDGCR. TOH represents the second reported patient with a balanced translocation within the MDGCR and features of DGS or VCFS, the first being ADU (10 ). TOH's breakpoint is 160.4 kb distal to ADU's breakpoint and interrupts a gene whose 3' end is 151.8 kb distal to the ADU breakpoint, suggesting the involvement of more than one gene from within the MDGCR in the etiology of the full phenotype of DGS/VCFS. We propose that interruption of the CLTCL gene, resulting in haploinsufficiency for the gene product in TOH, plays a major role in the expression of his phenotype. Thus, the CLTCL gene should be considered a strong candidate for the features shared between this patient and deleted DGS/VCFS patients.
It is unlikely that TOH's phenotype is the result of disruption of the sequences on chromosome 21. Translocations within the acrocentric short arms have not been associated with phenotypic abnormalities, and the only known functional genes in this region are tandem arrays of ribosomal genes (16 ). The 21p12 sequence disrupted by the 21;22 translocation is duplicated on all five pairs of acrocentric chromosomes, and thus even if it were functional, loss of one copy would be unlikely to lead to phenotypic consequences. Furthermore, since carriers of Robertsonian (21;21) translocations are phenotypically normal, it is more likely that TOH's phenotype is associated with the disruption of sequences on chromosome 22 than with those on 21.
Although the breakpoint in this patient falls within the CLTCL gene, the possibility exists that TOH's phenotype could be due to a position effect on another nearby gene or genes. The MDGCR is very gene rich, and the repositioning of heterochromatic sequences from 21p could have an effect on nearby transcript(s). Rearrangements up to several hundred kilobases from a gene have been reported to affect its expression (review: 22 ). However, our preliminary Northern analysis of TOH, as compared with a normal control, did not detect altered levels of transcription of CTP or HIRA. These are the closest known genes proximal (CTP) and distal (HIRA) to the TOH breakpoint. Although it may be difficult to detect subtle changes in mRNA levels by this approach, a 50% reduction in expression would be predicted for a translocation-mediated position effect to mimic a DGS/VCFS deletion. However, as these studies were performed in fibroblast and lymphoblastoid cell lines, we cannot rule out the possibility that some position effects may have occurred during embryonic development in this patient. Nonetheless, the (21;22) rearrangement measurably reduces the expression of the CLTCL gene, making it quite likely that TOH's phenotype is related, at least in part, to insufficient gene product.
An alternative hypothesis to explain his phenotype is that gene disruption could produce an abnormal protein with a `dominant-negative' effect. Although several aberrantly spliced forms of the CLTCL transcript were detected by RT-PCR, these were not seen on Northern blots, suggesting that they are unstable and/or present at very low levels. These data further support the hypothesis that dosage for the CLTCL gene is responsible for the patient's phenotype.
Although CLTCL is present in various species by zoo blot analysis, little is known about the function of the gene product beyond what can be predicted based on its homology to clathrin heavy chain (CLTC). While the similarity is high (CLTCL is 85% identical to human clathrin CLTC at the amino acid level), the expression pattern of CLTCL is much more restricted in the adult, suggesting that CLTCL may have a specialized function. CLTC is a ubiquitous structural protein that is conserved across mammals, and has been shown to be essential for viability in yeast and Drosophila (23 ,24 ). It plays a central role in endocytosis and membrane receptor trafficking, forming a lattice on the cytoplasmic face of clathrin-coated pits and vesicles (reviews: 25 ,26 ). The lattice is formed by overlapping triskelion units which are composed of three heavy chains and three light chains. The three heavy chains comprise the `legs' and are associated via non-covalent bonds at their carboxy termini, forming the vertex or center of the complex (27 ). It has been shown that truncation of the 1675 amino acid CLTC product prior to amino acid 1608 disrupts trimerization (28 ). CLTCL is predicted to encode a 1640 amino acid protein product, whereas TOH's truncated CLTCL is interrupted at 1496. If like CLTC, the CLTCL gene product forms a triskelion, the predicted truncated CLTCL protein in TOH would be unable to fulfill its normal role in triskelion assembly. Thus, the aberrant transcripts are unlikely to generate `suicide proteins', further supporting the hypothesis that TOH's phenotype is related to haploinsufficiency for CLTCL.
Northern blot analysis of CLTCL revealed a high level of expression in human skeletal muscle, a much lower level of expression in heart and other adult tissues and low levels in fetal kidney and liver (8 ). We have also detected expression in early (9-12 week) fetal tissue using RT-PCR. These varied expression patterns are not surprising, as many gene products are utilized in multiple tissues and at different times during development (29 ). If, like clathrin, CLTCL is involved in receptor-mediated endocytosis, it could play a vital role in the intercellular signaling processes important in early developmental pathways. In addition to a possible role in early development, high levels of expression in adult skeletal muscle suggest that CLTCL could be playing a structural role in this tissue. Disruption or deletion of CLTCL could thus be etiologic for the hypotonia seen in TOH and in other DGS/VCFS patients.
TOH appears to have some but not all of the features commonly associated with DGS/VCFS (30 ). His DGS/VCFS-related findings include: hooded upper eyelids, prominent nasal root, narrow alae nasi with prominent nasal tip, protuberant ears with overfolded helices, scoliosis, long slender fingers with hyperextensible joints and cryptorchidism with hypospadias. In addition, a verbal IQ greater than performance IQ has been seen in other patients with 22q11.2 deletions (31 ). He does not have the palatal or cardiac abnormalities commonly seen in VCFS. The macrocephaly and cataracts (posterior subcapsular) have not been reported in the 22q11.2 deletion. [There are two patients reported with VCFS and cataract, one of which was thought to be secondary to hypocalcemia (32 ) and the other (33 ) in whom the diagnosis is in question (34 ,35 ).]
We have postulated that the disruption of CLTCL is at least partially etiologic for TOH's phenotype, and that other candidate gene(s) in the MDGCR, which are not disrupted in TOH, are responsible for the additional findings seen in other DGS/VCFS patients. The differences in phenotype between TOH and patients with 22q11.2 deletions could thus be explained by his dizygosity for genes which are hemizygous in deleted patients. In addition, the unknown factors (genetic background, environmental effects) (36 ) which lead to variation in phenotype even between family members with identical deletions could play a role. A more complete understanding of the role of haploinsufficiency for CLTCL in determining the DGS/VCFS phenotype via mutational analysis of the gene will be difficult because of its size (33 exons), while the possible absence of this locus in the mouse might preclude targeted disruption of CLTCL to create a mouse model. Such studies will have to await the fortuitous identification of additional patients who, similarly to TOH, have a disruption of CLTCL or alternatively those who harbor a small intragenic deletion at this locus.
D22S75 was identified as a NotI linking phage clone (N25) and mapped to 22q11.2 using a somatic cell hybrid panel (37 ). A cosmid contig was generated by probing a chromosome 22-specific cosmid library (LL22NCO3, 38) with a 2.5 kb HindIII fragment from the N25 linking clone. The cosmids were ordered by restriction mapping using rare-cutting restriction enzymes. The most distal and proximal end fragments of the contig were used to reprobe the cosmid library and thus extend the contig in both directions. These cosmids were used as probes in FISH experiments. The D22S39 cosmid, which maps to the distal long arm of chromosome 22, was used to identify chromosome 22qter unambiguously in the metaphase spreads.
Cosmids were digested with Sau3A and biotin-labeled utilizing a non-isotopic nick translation kit (Oncor). Slides with metaphase spreads were made using the standard methodology and used within 48 h. FISH was performed as in (39 ) with minor modifications. Slides were treated with RNase and denatured at 70oC in 70% formamide, 2* SSC. Hybridization with biotin-labeled probes was performed in 50% formamide, 2* SSC, 10% dextran sulfate at 37oC overnight. Slides were then washed at 43oC in 50% formamide/1* SSC, 1* SSC and 0.1* SSC, respectively, before detecting with fluorescein isothiocyanate (FITC)-labeled avidin. Chromosomes were visualized by counter staining with propidium iodide/antifade (Oncor). From 25 to 35 metaphase spreads were examined for each probe. Slides were observed using a Zeiss Axiophot photomicroscope with a standard FITC filter.
PCR was performed in 20 [mu]l reactions using ~100 ng of genomic DNA or 1 ng of cloned DNA in standard 1* buffer (Boehringer-Mannheim): 10 mM Tris-HCl, 1.5 mM Mg2+, 50 mM KCl, pH 8.3, with 0.5 U Taq polymerase (Boehringer-Mannheim) and 1 [mu]M primers. Templates were denatured at 95oC for 5 min, followed by 30 cycles of 95oC for 15 s, 60oC for 15 s, and 72oC for 1 min 22 s. A final extension was performed for 7 min at 72oC. Reactions were performed using a Perkin Elmer 9600 thermal cycler. PCR products were analyzed using gel electrophoresis in 1-1.5% agarose. PCR products for sequencing were isolated from LMP agarose using the Spinbind purification kit (FMC), and sequenced on an ABI373A sequencer. Primer sequences: TOH2F, ACTTGTCAGGCAGGTCAGCT; TOH2R, GAAACTCACACAAAACTGCTGC; TOH3F, GATTTGAAATGTTCCCAACACA; TOH3R, TAAGACATCAATGAGGTTTGCC; TOH4F, TCCCCAGCAAAAAGATTACG; TOH4R, GGCATCGATAGATGCCCTTA; 21.BRKF, CATGCAGCAAAAGAAGTACA GC; 21.BRKR, GGTGAAATGTCATTGCATGC; 21.PROBF, CAGCATTAATCGTTGCTGGA; 21.PROBR, TCATCGGTCTCATCCC-AAGT; 2C2W2F, ACCAACCTCTGGGATTATTGG; 2C2-W2R, TGCCCTGTCTTACAGGCAG; D21260F, ATCAGTGAAAAGCATGATGTGG; D21260R, TCTTCAGCACCGGCTAAGTT; INT27F, ACCCTCATGGATAACTTTGGG; INT27R, ACCACTCTGGACTTGTGTTGC. RT-PCR was performed using an RT-PCR kit (Stratagene), as previously described (8 ).
The chromosome 21 breakpoint region was shown to be repeated on all of the acrocentric chromosomes by hybridization of radiolabeled 21.PROB (430 nucleotide PCR probe of the sequence adjacent to the breakpoint) to a Southern blot of BamHI- and HindIII-digested hybrid and control samples. Total genomic samples were CEPH individuals GM6990, GM7029 and GM7019. Somatic cell hybrids containing single human chromosomes on mouse or hamster background were as follows: GM10898 (chromosome 13), GM11418 (chromosome 15), GM8854 (chromosome 21), GM10888 (chromosome 22), GM10791 (chromosome 7), GM10612 (chromosome 19) and PHL17 (X chromosome). Hamster-only and mouse-only control cells were RJK88 and Clone 1-D, respectively. Somatic cell hybrid GM10479 contains human chromosome 14 lacking rDNA. To verify that the repeat is on chromosome 14, PCR was performed on a chromosome 14 regional mapping panel and product was obtained from hybrid M44, containing the short arm, but not from hybrid AB3, which lacks the short arm.
A gridded total human genomic PAC library was obtained from Dr Pieter de Jong (Roswell Park, Buffalo, NY). Filters for screening the PAC library were kindly provided by The Sanger Centre (Cambridge, UK). The library was screened by hybridization of filters with radiolabeled 21.PROB (see above). The library contains 3* coverage, and 40-45 primary positives were identified, suggesting that the probe contains repeated sequence. DNA was prepared from seven of the PACs and subjected to PCR and also to Southern blotting and hybridization to verify positives.
Radiolabeled RT-PCR probes containing exons 6-14 of CLTCL (2C2W2), and the same region of CLTC (D21260), were hybridized to an interspecies blot (Clontech) as previously described (8 ).
A lymphoblastoid cell line was established from the patient TOH. TOH fibroblasts (GM1700) and normal human male (GM05565) fibroblast and lymphoblast cell lines are available from the NIGMS Human Genetic Mutant Cell Repository. Approximately 1*108 cells were harvested for each RNA preparation. Poly(A)+ RNA was islolated using the FastTrack 2.0 kit (Invitrogen) according to the manufacturer's directions for Tissue Cultured Cells.
RNA was run on denaturing RNA gels and blotted as described (40 ,41 ). Northern blots were hybridized with radiolabeled probes 2C2W2, INT27, CTP cDNA clone #1 (kindly provided by E. Goldmuntz) (20 ), HIRA probe HST3 and control probe G3PDH (Clontech) as described (8 ).
5' RACE was performed using the Marathon-ReadyT human and skeletal muscle cDNA (Clontech) as described (8 ). CLTCL-specific nested primers used were 5'39E-1, GGCTGGATTCATGATGGC, and 5'39E-2, GCCTGCTCACCAACTTTCTCT.
3' RACE was performed on fibroblast and lymphoblastoid mRNA samples from TOH and a normal control using the 3'-AmpliFINDER RACE Kit (Clontech) according to the manufacturer's directions. CLTCL-specific nested primers used were 26.1, GAGCTGGTGTTCCTCTATGACAAGTAC, and 26.2, GTACGAGGAGTATGACAATGCTGTG. PCR products were analyzed on 1 and 1.5% agarose gels and cloned using the TA cloning kit (Invitrogen) according to the manufacturer's directions.
The authors would like to thank Dr Jim Sylvester for helpful discussions and Dr H.H. Kazazian Jr for helpful discussions and critical reading of the manuscript. We would also like to acknowledge Karen Romanyk, Jennifer Feuer, Yvonne Tatsumura, Joelle Collins and John Russell for their technical help, and Dr Vahe Bedian at the University of Pennsylvania Sequencing Facility for sequencing of plasmid and phage clones and PCR products. The chromosome 22 cosmid library, LL22NCO3, was obtained from Lawrence Livermore National Laboratory, and the Sanger Center provided the fosmid f39E1. S.E.H. was partially supported by a postdoctoral fellowship from Sandoz Corporation. Further funding for this research was provided by the Medical Research Council of Canada (H.E.M.), the Mental Retardation and Disabilities Research center (HD26979) (B.S.E.) and grants from the National Center for Human Genome Research (HG00425) (B.S.E., M.L.B.), National Institute for Deafness and Communication Disorders (DC02027) (M.L.B., B.S.E., B.R.) and National Heart, Lung, and Blood Institute (HL51533) (M.L.B., B.S.E., B.R.), of the NIH, USA.
1 Driscoll, D.A., Budarf, M.L. and Emanuel, B.S. (1992a) A genetic etiology for DiGeorge syndrome: consistent deletions and microdeletions of 22q11. Am. J. Hum. Genet., 50, 924-933.MEDLINE Abstract
2 Carey, A.H., Kelley, D., Halford, S., et al. (1992) Molecular genetic study of the frequency of monosomy 22q11 in DiGeorge syndrome. Am. J. Hum. Genet., 51, 964-970. MEDLINE Abstract
3 Driscoll, D.A., Spinner, N.B., Budarf, M.L., McDonald-McGinn, D.M., Zackai, E.H., Goldberg, R.B., Shprintzen, R.J., Saal, H.M., Zonana, J., Jones, M.C., Mascarello, J.T. and Emanuel,B.S. (1992b) Deletions and microdeletions of 22q11.2 in velo-cardio-facial syndrome. Am. J. Med. Genet., 44, 261-268.MEDLINE Abstract
4 Burn, J., Takao, A., Wilson, D., Cross, I., Momma, K., Wadey, R., Scambler, P., Goodship, J. (1993) Conotruncal anomaly face syndrome is associated with a deletion within chromosome 22q11. J. Med. Genet., 30, 822-824.MEDLINE Abstract
5 Stevens, C.A., Carey, J.C. and Shigeoka, A.O. (1990) DiGeorge anomaly and velo-cardio-facial syndrome. Pediatrics, 85, 526-530.MEDLINE Abstract
6 Jaquez, M., Driscoll, D.A., Li, M., Emanuel, B.S., Hernandez, I., Jaquez, F., Lembert, N., Ramirez, J. and Matalon, R. (1997) Brief clinical report: unbalanced 15;22 translocation in a patient with both features of DiGeorge and velocardiofacial syndrome. Am. J. Med. Genet.,in press.
7 Levy, A., Demczuk, S., Aurias, A., Depetris, D., Matttei, M. and Philip, N. (1995) Interstitial 22q11 microdeletion excluding the ADU breakpoint in a patient with DiGeorge syndrome. Hum. Mol. Genet., 4, 2417-2419. MEDLINE Abstract
8 Gong, W., Emanuel, B.S., Collins, J., Kim, D.H., Wang, Z., Chen, F., Zhang, G., Roe, B. and Budarf, M.L. (1996) A transcription map of the DiGeorge and velo-cardio-facial syndrome minimal critical region on 22q11. Hum. Mol. Genet., 5, 789-800.MEDLINE Abstract
9 Sutherland, H.G., Wadey, R., McKie, J.M., Taylor, C., Atif, U., Johnstone, K.A., Halford, S., Kim, U.-J., Goodship, J., Baldini, A. and Scambler, P.J. (1996) Identification of a novel transcript disrupted by a balanced translocation associated with DiGeorge Syndrome. Am. J. Hum. Genet., 59, 23-31.
10 Augusseau, S., Jouk, S., Jalbert, P. and Prieur, M. (1986) DiGeorge syndrome and 22q11 rearrangements. Hum. Genet., 74, 206.MEDLINE Abstract
11 Budarf, M.L., Collins, J., Gong, W., Roe, B., Wang, Z., Bailey, L.C., Sellinger, B., Michaud, D., Driscoll, D.A. and Emanuel, B.S. (1995) Cloning a balanced translocation associated with DiGeorge syndrome and identification of a disrupted candidate gene. Nature Genet., 10, 269-278.MEDLINE Abstract
12 Demczuk, S., Aledo, R., Zucman, J., Delattre, O., Desmaze, C. and Dauphinot, L. (1995) Cloning of a balanced translocation breakpoint in the DiGeorge syndrome critical region and isolation of a novel potential adhesion receptor gene in its vicinity. Hum. Mol. Genet., 4, 551-558.MEDLINE Abstract
13 Wadey, R., Daw, S., Taylor, C., Atif, U., Kamath, S., Halford, S., O'Donnell, H., Wilson, D., Goodship, J., Burn, J. and Scambler, P. (1995) Isolation of a gene encoding an integral membrane protein from the vicinity of a balanced translocation breakpoint associated with the DiGeorge syndrome. Hum. Mol. Genet.,4, 1027-1034.MEDLINE Abstract
14 Cannizzaro, A.L., Aronson, M.M. and Emanuel, B.S. (1995) In situ hybridization and translocation breakpoint mapping II. Two unusual t(21;22) translocations. Cytogenet. Cell Genet., 39, 173-178.
15 Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990) Basic local alignment search tool. J. Mol. Biol., 215, 403-410.MEDLINE Abstract
16 Sylvester, J.E., Whiteman, D.A., Podolsky, R., Rozsgay, J.M., Respuss, J. and Schmickel, R.D. (1986). The human ribosomal RNA genes: structure and organization of the complete repeating unit. Hum. Genet., 73, 193-198. MEDLINE Abstract
17 Sirotkin, H., Morrow, B., DasGupta, R., Goldberg, R., Patanjali, S.R., Shi, G., Cannizzaro, L., Shprintzen, R., Weissman, S.M. and Kucherlapati, R. (1996) Isolation of a new clathrin heavy chain gene with muscle-specific expression from the region commonly deleted in velo-cardio-facial syndrome. Hum. Mol. Genet., 5, 617-624.MEDLINE Abstract
18 Kedra, D., Peyrard, M., Fransson, I., Collins, J.E., Dunham, I., Roe, B.A. and Dumanski, J.P. (1996) Characterization of a second human clathrin heavy chain polypeptide gene (CHL-22) from chromosome 22q11. Hum. Mol. Genet., 5, 625-631.
19 Rugarli, E.I., Lutz, B., Kuratani, S.C., Wawersik, S., Borsani, G., Ballabio, A. and Eichele, G. (1993) Expression pattern of the Kallmann syndrome gene in the olfactory system suggests a role in neuronal targeting. Nature Genet., 4, 19-25. MEDLINE Abstract
20 Goldmuntz, E., Wang Z., Roe, B.A. and Budarf, M.L. (1996) Cloning, genomic organization, and chromosomal localization of human citrate transport protein to the DiGeorge/velocardiofacial syndrome minimal critical region. Genomics, 33, 271-276.MEDLINE Abstract
21 Warburton, D. (1984) Outcome of cases of de novo structural rearrangements diagnosed at amniocentesis. Prenatal Diagnosis, 4, 69-80.MEDLINE Abstract
22 Bedell, M.A. Jenkins, N.A. and Copeland, N.G. (1996) Good genes in bad neighborhoods. Nature Genet., 12, 229-232 .
23 Lemmon, S.K., Pellicena-Palle, A., Conley,K. and Freund, C.L. (1991) Saccharomyces cerevisiae and requirement of the COOH terminus for clathrin function. J. Cell Biol., 112, 65-80.
24 Bazinet, C., Katzen, A.L., Morgan, M., Mahowald, A.P. and Lemmon, S.K. (1993) The Drosophila clathrin heavy chain gene: clathrin function is essential in a multicellular organism. Genetics, 134, 1119-1134.MEDLINE Abstract
25 Brodsky, F.M. (1988) Living with clathrin: its role in intracellular membrane traffic. Science, 242, 1396-1402. MEDLINE Abstract
26 Robinson, M.S. (1994) The role of clathrin, adaptors and dynamin in endocytosis. Curr. Opin. Cell Biol., 4, 538-544.
27 Kirchhausen, T., Harrison, S.C., Chow, E.P., Mattaliano, R.J., Ramachamdram, K.L., Smart, J. and Brosius, J. (1987) Clathrin heavy chain: molecular cloning and complete primary structure. Proc. Natl Acad. Sci. USA, 84, 8805-8809. MEDLINE Abstract
28 Liu, S., Wong, M.L., Craik, C.S. and Brodsky, F.M. (1995) Regulation of clathrin assembly and trimerization defined using recombinant triskelion hubs. Cell, 83, 257-267. MEDLINE Abstract
29 Miklos, G.L.G. and Rubin, G.M. (1996) The role of the Genome Project in determining gene function: insights from model organisms. Cell, 86, 521-529.
30 McDonald-McGinn, D.M., Driscoll, D.A., Bason, L., Christensen, K., Lynch, D., Sullivan, K., Canning, D., Zavod, W., Quinn, N., Rome, J., Paris, Y., Weinberg, P., Clark, B.J., Emanuel, B.S. and Zackai, E.H. (1995) Autosomal dominant `Opitz' GBBB syndrome due to a 22q11.2 deletion. Am. J. Med. Genet., 59, 103-113.
31 Moss, E.. Wang, P.P., McDonald-McGinn, D.M., Gerdes, M., DaCosta, A.M., Emanuel, B.S., Batshaw, M.L. and Zackai, E.H. (1995) Characteristic cognitive profile in patients with a 22q11.2 deletion: verbal IQ exceeds nonverbal IQ. Am. J. Hum. Genet., 57, A20.
32 Mansour, A.M., Goldberg, R.B., Wang, F.M. and Shprintzen, R.J. (1987) Ocular findings in the velo-cardio-facial syndrome. J. Ped. Ophthal. Stabismus, 24, 263-266.
33 Beemer, F.A., deNef, J.J.E.M., Delleman, J.W., Bleeker-Wagemakers, E.M. and Shprintzen, R.J. (1986) Letter to the editor: additional eye findings in a girl with velo-cardio-facial syndrome. Am. J. Med. Genet., 24, 541-542. MEDLINE Abstract
34 Lin, A.I. (1988) Letter to the editor: charge association vs. velo-cardio-facial syndrome. Am. J. Med. Genet., 29, 951-952.
35 Pagon, R.A. (1987). Letter to the editor: velo-cardio-facial syndrome vs. CHARGE `association'. Am. J. Med. Genet., 28, 751. MEDLINE Abstract
36 Driscoll, D.A., Salvin, J., Sellinger, B., Budarf, M.L., McDonald-McGinn, D.M., Zackai, E.H. and Emanuel, B.S. (1993) Prevalence of 22q11 microdeletions in DiGeorge and velocardiofacial syndromes: implications for genetic counseling and prenatal diagnosis. J. Med. Genet.,30, 813-817.MEDLINE Abstract
37 McDermid, H.E., Budarf, M.L. and Emanuel, B.S. (1989) Toward a long-range map of human chromosomal band 22q11. Genomics, 5, 1-8.MEDLINE Abstract
38 de Jong, P.J., Yokobata, K., Chen, C., Lohman, F., Pederson, L., McNich, J. and Van Dilla, M. (1989) Human chromosome-specific partial digest libraries in lambda and cosmid vectors. Cytogenet. Cell Genet., 51, 985.
39 Pinkel, D., Strame, T. and Gray, J.W. (1986) Cytogenetic analysis using quantitative, high-sensitivity, fluorescence hybridization. Proc. Natl Acad. Sci. USA, 83, 2934-2938.MEDLINE Abstract
40 Chirgwin, J.M., Pryzybyla, A.E., MacDonald, R.J. and Rutter, W.J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry, 18, 5294-5299.MEDLINE Abstract
41 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Second Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
42 Chissoe, S.L., Wang, Y.F., Clifton, S.W., Ma, N., Sun, H.J., Lobsinger, J.S., Denton, S.M., White, J.D. and Roe, B.A. (1991) Strategies for rapid and accurate DNA sequencing. Methods: Companion Methods Enzymol., 3, 55-65.
43 Bodenteich, A., Chissoe, S., Wang, Y.F. and Roe, B.A. (1993) Shotgun cloning as the strategy of choice to generate templates for high-throughput dideoxynucleotide sequencing. In Venter, J.C. (ed.), Automated DNA Sequencing and Analysis Techniques. Academic Press, London, pp. 42-50.
44 Chissoe, S.L., Bodenteich, A., Wang, Y.F., Wang, Y.P., Burian, D., Clifton, S.W., Crabtree, J., Freeman, A., Iyer, K., Jian, L. et al. (1995) Sequence and analysis of the human c-abl gene, the bcr gene, and regions involved in the Philadelphia chromosomal translocation. Genomics, 27, 67-82. MEDLINE Abstract
*To whom correspondence should be addressed
+These authors contributed equally to this work
-->
This page is maintained by OUP admin. Last updated Fri Feb 7 12:40:48 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
