Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (85)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Zeschnigk, M.
Right arrow Articles by Doerfler, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zeschnigk, M.
Right arrow Articles by Doerfler, W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 387-395

Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method
Introduction
Results
   The genomic sequencing method: analysis of in vitro premethylated plasmid DNA
   Methylation patterns in the putative promoter and exon 1 regions of the SNRPN gene
   Methylation patterns in the PWCFOA segment
Discussion
Materials And Methods
   Patients
   DNA preparation
   Genomic sequencing technique
   Methylation of plasmid DNA
   Plasmids
Acknowledgements
References


Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method

Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method Michael Zeschnigk, Birgit Schmitz, Bärbel Dittrich1, Karin Buiting1, Bernhard Horsthemke1 and Walter Doerfler*

Institute for Genetics, University of Cologne, D-50931 Cologne, Germany and 1Institute for Human Genetics, University of Essen, D-45122 Essen, Germany

Received September 17, 1996; Revised and Accepted December 4, 1996

A deletion of 15q11-q13 and uniparental disomy 15 lead to Prader-Labhart-Willi syndrome (PWS) or Angelman syndrome (AS) because this region contains genes expressed exclusively from the paternal (PWS) or maternal (AS) chromosome, respectively. DNA methylation plays a role in the control of imprinted gene expression, but so far only a few 5'-CG-3' dinucleotides within the recognition sites of the methylation sensitive enzymes have been studied. As part of a study on DNA methylation patterns in the human genome, we have applied the bisulfite protocol of genomic sequencing to study all 5'-CG-3' dinucleotides around exon 1 of SNRPN and at the D15S63 locus, which contains a start site for alternative SNRPN transcripts possibly involved in imprint switching during gametogenesis. At least 17 PCR products derived from single chromosomes of normal individuals as well as PWS and AS patients have been sequenced. We have found that cytosine residues outside 5'-CG-3' dinucleotides are always unmethylated. However, >96% of all of the 23 5'-CG-3' dinucleotides around SNRPN exon 1 are methylated on the maternal chromosome and completely devoid of methylation on the paternal chromosome. This finding is in contrast to the D15S63 locus, where only the two CfoI/HhaI sites are methylated on the maternal chromosome at the same frequency as seen for the SNRPN segment. At the other five 5'-CG-3' dinucleotides, differential methylation is less pronounced, i.e. 45-70% on the maternal chromosome and 5-14% on the paternal chromosome. The differences between SNRPN and D15S63 methylation may reflect different biological functions of the alternative SNRPN transcripts. The systematic investigation of 5'-CG-3' methylation patterns as reported here will provide the basis for a PCR-based methylation test to diagnose PWS and AS.

INTRODUCTION

The nucleotide sequence on human chromosome 15q11-13 is functionally non-equivalent on the paternal and maternal chromosomes and represents one of the well characterized genetically imprinted segments in the human genome. Deletions in this genome region lead to clinically completely different phenotypes depending on whether the deletion is located on the paternally or the maternally inherited chromosome. The Prader-Labhart-Willi syndrome (PWS) (1 ) is characterized by a deletion in 15q11-13 on the paternal chromosome. Deletions of the same region on the maternal chromosome cause the Angelman syndrome (AS) (2 -5 ). About 25% of the PWS and 2% of the AS cases are due to uniparental disomy with two maternal and paternal chromosomes, respectively (6 ). From the paternally inherited chromosome only, at least four transcripts from the regions PAR-1, PAR-5, IPW, and SNRPN have so far been identified (7 -9 ). Genes involved in AS have not yet been characterized.

In ~1% of PWS and 4% of AS patients, the syndromes are associated with abnormal patterns of methylation in the segments D15S63, ZNF127, and SNRPN (10 -12 ), possibly due to the impairment of an imprinting (methylation) control element termed imprinting center which is located 5' of the SNRPN gene and its 5'-CG-3' rich region (12 ).

Studies on chromosomally integrated viral and on many mammalian promoter sequences have supported the concept that the sequence-specific methylation of promoters causes their long-term silencing (13 , contributions in ref. 14 ). The nucleotide positions decisive for methylation inactivation cannot be predicted but must be experimentally determined for each promoter. The proven association of promoter methylation with gene inactivation has played a major conceptual role in studies on the molecular mechanism underlying genetic imprinting. Additional factors may, of course, also be responsible for imprinting (15 ). The methylation status of some positions in the imprinted region 15q11-13, as defined by methylation sensitive restriction enzymes, correlates well with the parent-of-origin-specific expression of the SNRPN gene and has been developed as a diagnostic test for PWS and AS (16 -18 ). In all tissues analyzed the 5'-CG-3' rich region of the expressed paternally derived allele of the SNRPN gene is unmethylated, and the repressed maternally derived allele is highly methylated in these positions, except in intron 5 (18 ).

As methylation-sensitive restriction endonucleases provide only limited insights into the actually existing patterns of DNA methylation, we have analyzed the putative promoter and exon 1 regions of the SNRPN gene by genomic sequencing. In addition, we have investigated the D15S63 locus which maps 100 kb upstream of SNRPN. This locus contains a region (PWCFOA) from which an alternative SNRPN transcript is initiated (19 ). A protocol of genomic sequencing has been applied that treats the DNA with bisulfite and subsequently amplifies the relevant DNA segment by PCR using single strand-specific primers (20 -22 ). Individual PCR generated DNA molecules are then cloned and their nucleotide sequences are determined. Sodium bisulfite converts cytosine (C)-residues to uracil. Under the conditions employed, 5-methylcytosine (5-mC) does not react and remains unaltered (23 -25 ). In the ensuing PCR amplification, all unmethylated C-residues will be represented as thymine (T)-residues; only the original 5-mC positions will produce C-residues in the PCR products. Thus, the C-pattern in the nucleotide sequence of each PCR molecule reflects the 5-mC distribution in this segment on one of the human chromosomes.

Here, we report the exact patterns of DNA methylation on both strands for a number of 5'-CG-3' dinucleotides in imprinted regions on human chromosome 15. To the best of our knowledge, this analysis is the first in this imprinted region of the human genome based on the genomic sequencing method. The patterns have been determined for healthy control probands, for PWS and AS patients with deletions, uniparental disomy or imprinting center mutations. In PWS patients of any etiology, nearly all 5'-CG-3' dinucleotides in the SNRPN gene segment analyzed are methylated. The same dinucleotides are unmethylated in the AS patients studied. In contrast to the SNRPN region, the DNA in the PWCFOA segment is hypermethylated (60-75%) in PWS patients and hypomethylated (5-14%) in AS patients. In imprinting center mutations, the PWCFOA segment exhibits lower overall methylation frequencies in AS and PWS patients.

RESULTS

The genomic sequencing method: analysis of in vitro premethylated plasmid DNA

The plasmid p71.13.6 (Fig. 1 ) was in vitro premethylated by using the HhaI (5'-GCGC-3') or the SssI (5'-CG-3') DNA methyltransferase to test the reliability of the bisulfite modification and PCR methods as used in this laboratory. The methylated or the unmethylated p71.13.6 plasmid preparation was treated with bisulfite as described in Materials and Methods, and the DNA segment to be analyzed was amplified by PCR. The amplified nucleotide sequences and the primers used for PCR are indicated in Figure 2 b and Table 1 , respectively. PCR products were cloned, and the nucleotide sequence was determined in five clones from each of the in vitro premethylated plasmids. The results are schematically presented in Figure 3 . The horizontal bar in the center of the graph represents the investigated nucleotide sequence with the centromeric and telomeric termini. The letters A to G indicate the 5'-CG-3' positions in the nucleotide sequence; A and B correspond to the two HhaI sites in the p71.13.6 sequence. In a number of clones investigated, the nucleotide sequences in both strands were determined. Each horizontal row of filled (methylated 5'-CG-3') or open (unmethylated 5'-CG-3') squares refers to the results of sequencing in one isolated clone. The data indicate that the HhaI enzyme methylates only the 5'-GCGC-3' sites; the SssI DNA methyltransferase modifies almost all 5'-CG-3' dinucleotides. The few exceptions at random locations in this and all subsequently presented experiments could be explained by variance in DNA methyltransferase activity, in the bisulfite reaction or by mutations artificially introduced by the Taq polymerase.


Figure 1. EcoRI (|) restriction map of the PWS/AS region on human chromosome 15q11-13 between the markers PW71 and SNRPN (modified from ref. 12). The sites of the two regions analyzed by genomic sequencing have been enlarged. The plasmid p71.13.6 is a HindIII subclone from phage clone [lambda]71.13 (24). The SNRPN promoter and exon 1 sequences have been described elsewhere (18). In the upper part of the graph several markers are shown, SRO PWS/AS indicates the smallest region of overlap from deletions which impair the imprinting process in several PWS/AS patients (12).

The results demonstrate that maximally three out of 90 (3.3%) 5-mC residues could have remained undetected by the methods employed (20 ,22 ,26 ). In unmethylated control DNA, 5-mC nucleotides have never been found. Lastly, 5-mC in positions outside 5'-CG-3' residues have not been observed.

Table 1 Primers used for PCR on bisulfite-treated DNAa
(i)

PCR on SNRPN-gene exon 1 and putative promoter, top strand

Sequence positions

First PCR:

 

 

SNPI32 top

CTCCAAAACAAAAAACTTTAAAACCCAAATTC

384-415

SNPI51 top

GGTTTTTTTTTATTGTAATAGTGTTGTGGGG

7-37

Second PCR:

 

 

SNPI31 top

CAATACTCCAAATCCTAAAAACTTAAAATATC

344-375

SNPI52 top

GGTTTTAGGGGTTTAGTAGTTTTTTTTTTTTTGG

35-69

(ii)

PCR on SNRPN-gene exon 1 and putative promoter, bottom strand

 

First PCR:

 

 

SNPI32 bottom

GGAATTGGTTTTTTAGAATAAAGGATTTTAGGG

393-425

SNPI51 bottom

CCCCCTCTCATTACAACAATACTATAAAACCC

9-40

Second PCR:

 

 

SNPI31 bottom

GGGTTTAAATTTXGTTTATTTAGTATTTTAAGb

364-395

SNPI52 bottom

CCCTAAAAATCCAATAACCCCCTCCCCC

38-65

(iii)

PCR on PWCFOA segment, bottom strand

 

First PCR:

 

 

PWHhaI32 bottom

TACCTTAAACCTACACCAATATTCTCAATTATCCC

1-35

PWHhaI51 bottom

GAATGXGAATATGXGAAGTTGGTTTTAGATGATGT

613-647

Second PCR:

 

 

PWHhaI53 bottom

GAATTGTATTTTTTAAATAGTTTTAGAGGGAAGAT

410-444

PWHhaI31 bottom

AACAACCCCCACAACATCATTCCCTACTTTATTTAC

109-144

(iv)

PCR on PWCFOA segment, top strand

 

First PCR:

 

 

PWHhaI31 top

GGTGGATTTTATGAGATGTTAATATTTTTTATTAGG

158-193

PWHhaI51 top

CTTAAAACAAAAACACAAAAACAAAAATAAATATTACC

521-558

Second PCR:

 

 

PWHhaI52 top

AAACTACATTCCTCAAACAACTCCAAAAAAAAAAC

410-444

PWHhaI31 top

 

 

aNucleotide positions refer to the 5'-3' oriented nucleotide sequences in Figure 2a, b.
bX: A 1:1 mixture of C and T was offered during primer syntheses.

Methylation patterns in the putative promoter and exon 1 regions of the SNRPN gene


Figure 2. Nucleotide sequences analyzed by the bisulfite protocol for the genomic sequencing procedure. (a) Human SNRPN sequence in the putative promoter, exon 1 and 5'-part of intron 1 regions. All 5'-CG-3' dinucleotides examined for their methylation status by genomic sequencing are marked by frames and by the bold-type letters A to W. The position of exon 1 has been indicated. The nucleotide sequence of one DNA strand in the 5' (centromere) to 3' (tel = telomere) orientation has been reproduced. The HpaII (5'-CCGG-3') sites are located in A, P, and V, the HhaI (5'-GCGC-3') sites in D, G, H, and M. (b) Nucleotide sequence of the PWCFOA segment. The analyzed 5'-CG-3' dinucleotides are marked by frames and by the bold-typed letters A to G. The orientation of the sequence is as in (a). The HhaI (CfoI) restriction sites used for molecular diagnostics of PWS or AS are located in positions A and B (29). All primer locations can be derived from Table 1.


Figure 3. Control experiment: distribution of 5-mC residues in in vitro premethylated plasmid DNA (p71.13.6) in the PWCFOA segment. For nucleotide sequence see Figure 2b. Amounts of 50 pg of either HhaI- (clones 6-15) or SssI-methylated (clones 1-5 and 16-20) plasmid DNA were mixed with 5 [mu]g salmon sperm DNA in separate assays and subjected to bisulfite treatment and PCR as described under Materials and Methods. Both DNA strands were analyzed. The DNA methyltransferases used in the premethylation experiments are indicated in the right margin of the scheme. Five clones for each set of primers from each plasmid with in vitro imposed methylation patterns were isolated and sequenced. Data from 20 individual clones have been presented. Each horizontal set of squares (1-20) represents the methylation pattern of a single cloned PCR product. Filled squares indicate methylated 5'-CG-3' dinucleotides, open squares unmethylated 5'-CG-3' dinucleotides.

The DNA sequence of exon 1 and the 5' flanking region is rich in 5'-CG-3' dinucleotides (27 ,28 ). Since the sequence-specific methylation of mammalian promoters is frequently associated with long term promoter inactivation, it is of interest to study the precise patterns of DNA methylation in the promoter and exon 1 regions of the SNRPN gene (for sequence, see Fig. 2 a), which have been shown to be long-term inactivated on the maternally derived chromosome in PWS patients. In PWS patients with imprinting center mutations, the paternally derived chromosome has been shown to be hypermethylated by using methylation-sensitive restriction endonucleases (12 ).

The results of the genomic sequencing analyses in the putative SNRPN promoter sequence are summarized in Figure 4 . The promoter and exon 1 segments of the SNRPN gene are methylated to an extent between 94 and 97% in PWS caused by a deletion, by uniparental disomy or by an imprinting center mutation (Fig. 4 a, panels I, II, or III, respectively). It should be noted that the SNRPN gene is deleted in the patient with a PWS imprinting mutation. In comparison to the results obtained on in vitro methylated plasmid DNA, the degree of methylation in the analyzed region on genomic DNA might be close to 100% of all 5'-CG-3' dinucleotides present in this region. In this methylated region there are no significant variations in the degree of methylation between PWS patients with different etiologies of the disease, deletion, uniparental disomy or imprinting center mutations. Very similar results have been obtained on the putatively maternally derived chromosome in DNA isolated from blood cells of healthy donors (Fig. 4 c). The sites on the allelic, presumably the paternally derived, chromosome are all unmethylated (Fig. 4 c). In these controls, we cannot rigorously prove that the methylated DNA segment has actually been from the maternal allele. We infer this interpretation from the results with DNA from PWS patients.


Figure 4. Distribution of 5-mC residues in the region of the putative promoter and exon 1 regions of the human SNRPN gene in genomic DNA isolated from total blood cells of PWS (a), AS (b) patients, or a male healthy donor (c). The organization and presentation of data and the use of symbols are as described in Figure 3 and its legend. For each patient, data from at least 8, often from 10 clones from each pair of primers on either DNA strand have been presented. Putative promoter, exon 1, and intron 1 regions are indicated. Every column (A to W) represents the position of a 5'-CG-3' dinucleotide in the genomic sequence according to Figure 2a. Filled symbols, methylated; open symbols, unmethylated 5'-CG-3' positions. The top strand represents the plus- or sense-strand, the bottom strand the minus- or anti-sense strand.

In one clone derived from a PWS patient with uniparental disomy (Fig. 4 a, panel II, clone 1), exon 1 and the analyzed part of intron 1 are unmethylated (sites M to W) on one strand, while the promoter sequence on the same chromosome and strand is methylated (sites B to L). Conversely, the methylation patterns on one chromosome derived from a PWS patient with an imprinting center mutation (panel III) reveal the putative promoter sequence on one strand to be nearly completely unmethylated (sites A to J and L), whereas the 5'-CG-3' sites in the exon 1 and intron 1 regions (sites M to W) are all methylated. Similar results have been adduced with genomic DNA from healthy donors. The opposite strand seems to be consistently methylated in almost all 5'-CG-3' sites in all clones. At present, we have no explanation for this finding.

In contrast, in the genomic DNA isolated from blood cells from AS patients only two methylated cytosines have been detected in all the clones derived from the SNRPN putative promoter and exon 1 regions (Fig. 4 b). We conclude that the SNRPN gene promoter and exon 1 regions can be regarded as completely unmethylated in AS patients. These results agree with data obtained by using several methylation-sensitive restriction enzymes in the same region (18 ).

Methylation patterns in the PWCFOA segment

Next, we have investigated the PWCFOA region, from which an alternative SNRPN transcript is initiated (19 ). The sequence (Fig. 2 b) presents two HhaI restriction sites (positions A and B) which have been successfully used for methylation-detecting molecular diagnostics of PWS and AS in clinical genetics (29 ). The frequency of 5'-CG-3' dinucleotides in this sequence segment is considerably lower when compared to the sequence of the putative promoter and exon 1 regions in the SNRPN gene. In these experiments, we have genomically sequenced the same DNA from the same patients as used for the analyses of the SNRPN putative promoter and exon 1 regions. The sequences of at least eight PCR products from each of the patients and each pair of primers are compiled in Figure 5 .

The highest density of 5-mC residues in this DNA segment derived from PWS patients is observed in the two HhaI restriction sites (positions A and B in Fig. 5 a, panels I, II, and III). These C-residues are almost completely methylated, while local frequencies of C-methylation in the other 5'-CG-3' dinucleotides (positions C to G in Fig. 5 a) vary between 33% (panel III, position E) and 85% (panel I, positions C and F). The overall frequency of DNA methylation in positions C to G is 68% for the PWS patient with a chromosome 15q deletion (Fig. 5 a, panel I), 60% for the PWS patient with uniparental disomy (panel II), and 44% for the PWS patient with an imprinting center mutation (panel III). The results of our control experiment (Fig. 3 ) suggest that the genomic sequencing procedure as applied in these experiments might underestimate the 5-mC levels by ~3.3%. Since the frequency of methylation in several 5'-CG-3' dinucleotide positions (position D in panel I, and position E in panel III) of one DNA strand is not identical to the methylation pattern in the same positions on the complementary strand, it is likely that these positions are hemimethylated (Fig. 5 a).

The same DNA segment close to the marker PW71 has been analyzed in DNA preparations obtained from blood cells from Angelman patients (Fig. 5 b). Although the frequency of 5'-CG-3' methylation is markedly lower than in DNA from PWS patients, the region is not completely unmethylated as seen in the promoter region of the SNRPN gene in the same AS patients (cf. Fig. 4 b). The local frequencies in methylation of individual 5'-CG-3' dinucleotides can reach ~40% (panel II, position C). The overall frequency of methylation in this DNA segment is 13% for the AS patients with a deletion, and for the patient with uniparental disomy, whereas only 5% of all 5'-CG-3' dinucleotides have been found to be methylated in the AS patient with an imprinting center mutation. Considering the patterns observed in all patients, 85% of all 5-mC residues are located in positions A to D (Fig. 5 b).

In AS patients, except for two cases (clones 2 and 5 in panel I of Fig. 5 b), at least one out of the two HhaI restriction sites (positions A and B) has remained unmethylated on the same DNA strand resulting in a cleavable CfoI or HhaI restriction site. This finding confirms the reliability of the DNA methylation test developed for the molecular diagnostics of PWS and AS patients (29 ). The results of genomic sequencing with the DNA from a male healthy donor are reminiscent of those in Figure 4 c (data not shown).

DISCUSSION

Patterns of DNA methylation in the human genome are characterized by a high degree of specificity and, at least in several segments, by interindividual concordance (30 -32 ). There is much evidence that sequence-specific methylation is part of the mechanism of genomic imprinting in mammalian genomes and also in the human genome (33 -35 ). One of the most intensely investigated imprinted regions in the human genome is the region on chromosome 15q11-13 with a medically relevant, highly interesting differentiation in clinical phenotypes depending on the parental origin of the deletion, of uniparental disomy or imprinting center mutation (3 ,6 ,12 ,29 ). Differences in the levels of DNA methylation in restriction sites in the PWS/AS segment have been documented (16 ,18 ) in that the maternal chromosome seems to be hypermethylated in this region. A very reliable test based on Southern blotting has been developed which exploits these findings to assess unequivocally the clinical diagnoses (11 ,16 ,18 ).

As detailed in this report, one subsegment of the PWS/AS region, i.e., the 5'-part of the SNRPN region, exhibits almost complete methylation on the maternally derived chromosome, as evidenced by studies on the DNA from patients with PWS caused by any of the three etiologic factors discussed (Fig. 4 a). In AS patients with an intact paternal chromosome, the same DNA segment has been shown to be almost completely unmethylated (Fig. 4 b). In healthy control donors ~50% of the cloned PCR products are methylated, 50% unmethylated (Fig. 4 c). This finding is consistent with the data derived from PWS and AS patients. A less uniform methylation pattern has been found on the maternal and paternal alleles in a second segment, close to the marker PW71, in the PWS/AS part of the genome (Fig. 5 a-c). This finding may reflect different biological functions of the different SNRPN transcripts. The SNRPN gene is ubiquitously expressed at a high level. In contrast, the alternative SNRPN transcripts initiated at D15S63 and another site 30 kb centromeric to D15S63 are much less abundant, present in fewer tissues and possibly involved in imprint switching during gametogenesis (19 ). The diagnostically exploited HhaI sites in the PWCFOA segment, however, conform to strict uniformity in complete methylation on the maternal, and absence of methylation on the paternal chromosome. It is possible that the HhaI sites are the most important part of a genetic element controlling the parent-of-origin specific expression of the alternative SNRPN transcripts.

Slight deviations in methylation from a generally distinct pattern might be due to some low degree of polymorphism, which appears likely in biology, or to technical imperfections which cannot be completely ruled out. None of the chemical or enzymatic reaction steps, the bisulfite reaction, the Taq polymerase-mediated PCR amplification or the cloning and sequencing steps in the protocol can be guaranteed to be devoid of minor deviations.

This study presents the first analysis of DNA methylation patterns of this imprinted region in the human genome by applying the genomic sequencing technique. Before one can interpret the biological significance of DNA methylation patterns in complex genomes, like the human, and assess their role in the mechanism of genetic imprinting, these patterns have to be determined in detail. It will no longer suffice to base, sometimes far-reaching, conclusions on the results of restriction enzyme analyses which may not encompass more than 20-30% of the methylatable, 5'-CG-3' containing sequences.

By using the bisulfite genomic sequencing protocol in the mouse Igf2 upstream region, which contains 12 5'-CG-3' dinucleotides, Feil et al. (36 ) have found that the expressed paternal allele is more methylated than the repressed maternal allele, but individual chromosomes revealed diverse patterns of DNA methylation. The results of the single-chromosome analyses have been taken as evidence against simple clonality of methylation patterns in this region.

It is interesting to note that a well established imprinted region in the human genome is uniformly and completely methylated on one and unmethylated on the other allele. Again, distinct patterns of methylation characterize this DNA segment in the human genome. In terms of the long-term silencing of the imprinted region on one of the chromosomes, it will be useful to recall that it is not necessarily the complete methylation of a eukaryotic promoter region that is responsible for promoter inactivation, but a highly promoter-specific methylation pattern in a 5'-CG-3'-rich imprinted region. As a case in point, we recall findings on a late frog virus 3 (FV3) promoter that is methylated in all of its 5'-CG-3' dinucleotides and transcriptionally active. The same promoter can, however, be experimentally inactivated by the selective methylation of its eight 5'-CCGG-3' (HpaII) sites, at least when a construct of this promoter has been used in transfection experiments (37 ).


Figure 5. Distribution of 5-mC residues in the PWCFOA segment in genomic DNA isolated from total blood cells of PWS patients (a) or AS patients (b) with a deletion (panel I), uniparental disomy (panel II) or with imprinting center mutations (panel III). For each patient data from 8 to 10 clones from each pair of primers on either DNA strand have been included. Columns A-G represent the positions of 5'-CG-3' dinucleotides in the genomic sequence according to Figure 2b. Positions A and B locate the HhaI (5'-GCGC-3') sites. For further details see legends to Figures 3 and 4.

We should also like to emphasize that the results presented here could be developed into an even more refined molecular test based on PCR to diagnose PWS and AS more rapidly and by using less DNA. Such a diagnostic test is important because a significant number of hypotonic newborns have the PWS (38 ).

MATERIALS AND METHODS

Patients

All patients with typical PWS or AS phenotypes were molecularly classified by DNA methylation and polymorphism studies (16 ,39 ). The imprinting mutation patients (PWS-S and AS-D) were described in references (12 ) and (40 ). The description of PWS deletion patient (M0049) was included in reference (38 ). The AS patient with uniparental disomy (G1244) was the patient presented in (41 ). The PWS patient with uniparental disomy (G1478) was introduced by Knoblauch (42 ). The AS deletion patient (AS23) was not reported before. A DNA sample from this patient was kindly provided by K. Schmidt, Berlin.

DNA preparation

Genomic DNA from peripheral blood was prepared as described in reference (43 ).

Genomic sequencing technique

Bisulfite treatment (21 ). Genomic DNA (5 [mu]g) or plasmid DNA (10 pg mixed with 5 [mu]g of salmon sperm DNA) was cleaved with the restriction enzyme BamHI in a reaction volume of 100 [mu]l and was denatured for 15 min at 37oC by adding 11 [mu]l of 3 M NaOH. For complete denaturation, samples were incubated at 95oC for 3 min and immediately cooled on ice. The bisulfite solution was prepared by dissolving 8.1 g of sodium bisulfite (Sigma) in 15 ml of degassed water, 1 ml of 40 mM hydrochinone was added, and the pH was adjusted to 5 by adding 600 [mu]l of 10 M NaOH. The denatured DNA solution (110 [mu]l) was mixed with 1 ml of the bisulfite solution, overlaid with mineral oil and incubated at 55oC for 16 h in a water bath in the dark. The DNA was recovered from the bisulfite solution by using glassmilk (GeneClean II Kit, Bio 101 Inc.) and eluted in 100 [mu]l of H2O. Subsequently, 11 [mu]l of 3 M NaOH was added, and the sample was incubated for 15 min at 37oC. The solution was then neutralized by adding 110 [mu]l of 6 M ammonium acetate, pH 7, and the DNA was ethanol-precipitated, washed in 70% ethanol, dried and redissolved in 20 [mu]l H2O.PCR (polymerase chain reaction). The methylation patterns of all sequences were determined for both strands in separate reactions. For PCR, 5 [mu]l of bisulfite-treated DNA (~500 ng) was used in a 100 [mu]l reaction mixture: 50 mM KCl, 1.7 mM MgCl2, 10 mM Tris-HCl (pH 9.0 at 25oC), 0.1% Triton X-100, 0.2 mM of each of the four dNTPs, 1 [mu]M of each primer, and 2.5 U Taq DNA polymerase (Promega). PCR was performed in a Perkin Elmer Cetus DNA Thermal Cycler 480 under the following cycle conditions: 94oC for 1 min, for 1 cycle; subsequently 94oC for 1 min, 51oC for 1 min, and 72oC for 1 min, for 35 cycles. A 5 [mu]l fraction of the PCR products was reamplified by using nested primers under the same conditions, except that the reaction proceeded through 25 cycles. The nucleotide sequences of all primer oligodeoxyribonucleotides used in this study were indicated in Table 1 .Cloning and sequencing. PCR products were ethanol-precipitated and dissolved in 10 [mu]l of H2O. A portion of 1 [mu]l was used for ligation into the vector pGEM-T (Promega) or the vector pT7Blue (Novagene) and transformed into competent E.coli XL1BlueMRF'cells (44 ). Recombinant plasmid DNA was prepared from white colonies by standard methods. Nucleotide sequences were determined in an automated Applied Biosystems DNA Sequencer 373A by using the chain termination method (45 ) and fluorescence-labeled dNTP for color detection in the automated sequencer. Sequencing primers: SP6 (pGEM-T) and universal primer (pT7Blue) were used as recommended by Promega and Novagene, respectively.

Methylation of plasmid DNA

To test the reliability of the bisulfite method, 1 [mu]g of the p71.13.6 plasmid DNA was in vitro methylated by using the SssI or HhaI DNA methyltransferase under the following conditions: 1 mM Tris-HCl, pH 7.9, 5 mM MgCl2, 5 mM NaCl, 1 mM dithiothreitol, 160 [mu]M S-adenosylmethionine, 10 U SssI- or HhaI-DNA methyltransferase (NEB). The mixture was incubated at 37oC for 16 h.

Plasmids

Plasmid p71.13.6 carried the 6.6 kbp HindIII fragment from phage clone [lambda]71.13 (29 ) in the HindIII site of plasmid pUc19.

ACKNOWLEDGEMENTS

M.Z. thanks Peter Meyer for technical help. This research was supported by the Deutsche Forschungsgemeinschaft through SFB274-A1 to W.D., by a stipend to M.Z., Ze 379/1-1 and by grant Ho 949/12-1 to B.H.

REFERENCES

1 Prader, A., Labhart, A. and Willi, H. (1956) Ein Syndrom von Adipositas, Kleinwuchs, Kryptorchismus und Oligophrenie nach myatonieartigem Zustand im Neugeborenenalter. Schweiz. Med. Wochenschrift, 86, 1260-1261.

2 Angelman, H. (1965) `Puppet children': a report of three cases. Dev. Med. Child Neurol., 7, 681-683.

3 Ledbetter, D.H., Riccardi, V.M., Airhart, S.D., Strobel, R.J., Keenan, B.S. and Crawford, J.D. (1981) Deletions of chromosome 15 as a cause of the Prader-Willi syndrome. N. Engl. J. Med., 304, 325-329. MEDLINE Abstract

4 Nicholls, R.D., Knoll, J.H., Butler, M.G., Karam, S. and Lalande, M. (1989) Genetic imprinting suggested by maternal uniparental heterodisomy in nondeletion Prader-Willi syndrome. Nature, 342, 281-285. MEDLINE Abstract

5 Robinson, W.P., Bottani, A., Yagang, X., Balakrishman, J., Binkert, F., Mächler, M., Prader, A. and Schinzel, A. (1991) Molecular, cytogenetic, and clinical investigations of Prader-Willi syndrome patients. Am. J. Hum. Genet., 49, 1219-1234. MEDLINE Abstract

6 Nicholls, R.D. (1994) New insights reveal complex mechanisms involved in genomic imprinting. Am. J. Hum. Genet., 54, 733-740. MEDLINE Abstract

7 Zieve, G.W. and Sauter, R.A. (1990) Cell biology of the snRNP particles. Crit. Rev. Biochem. Mol. Biol., 25, 1-46. MEDLINE Abstract

8 Nakao, M., Sutcliffe, J.S., Durtschi, B., Mutirangura, A., Ledbetter, D.H. and Beaudet, A.L. (1994) Imprinting analysis of three genes in the Prader-Willi Angelman region: SNRPN, E6-associated protein, and PAR-2 (D15S225E). Hum. Mol. Genet., 3, 309- 315.

9 Reed, M.L. and Leef, S.E. (1994) Maternal imprinting of human SNRPN, a gene deleted in Prader-Willi syndrome. Nature Genet., 6, 163-167. MEDLINE Abstract

10 Glenn, C.C., Nicholls, R.D., Robinson, W.P., Saitoh, S., Niikawa, N., Schinzel, A., Horsthemke, B. and Driscoll, D.J. (1993) Modification of 15q11-q13 DNA methylation imprints in unique Angelman and Prader-Willi patients. Hum. Mol. Genet., 2, 1377-1382. MEDLINE Abstract

11 Sutcliffe, J.S., Nakao, M., Christian, S., Östravik, K.H., Tommerup, N., Ledbetter, D.H. and Beaudet, A.L. (1994) Deletions of a differentially methylated CpG island at the SNRPN gene define a putative imprinting control region. Nature Genet., 8, 52-58. MEDLINE Abstract

12 Buiting, K., Saitoh, S., Gross, S., Dittrich, B., Schwartz, S., Nicholls, R.D. and Horsthemke, B. (1995) Inherited microdeletions in the Angelman and Prader-Willi syndromes define an imprinting centre on human chromosome 15. Nature Genet., 9, 395-400. MEDLINE Abstract

13 Doerfler, W. (1983) DNA methylation and gene activity. Annu. Rev. Biochem., 52, 93-124. MEDLINE Abstract

14 Munnes, M. and Doerfler, W. (1997) DNA methylation in mammalian genomes: promoter activity and genomic imprinting. In Encyclopedia of Human Biology, vol. 3, Academic Press, in press

15 Kitsberg, D., Selig, S., Brandeis, M., Simon, I., Keshet, I., Driscoll, D.J., Nicholls, R.D. and Cedar, H. (1993) Allele-specific replication timing of imprinted gene regions. Nature, 364, 459-463. MEDLINE Abstract

16 Dittrich, B., Robinson, W.P., Knoblauch, H., Buiting, K., Schmidt, K., Gillessen- Kaesbach, G. and Horsthemke, B. (1992) Molecular diagnosis of the Prader-Willi and Angelman syndromes by detection of parent-of-origin specific DNA methylation in 15q11-13. Hum. Genet., 90, 313-315. MEDLINE Abstract

17 Driscoll, D.J., Waters, M.F., Williams, C.A., Zori, R.T., Glenn, C.C., Avidano, K.M. and Nicholls, R.D. (1992) A DNA methylation imprint, determined by the sex of the parent, distinguishes the Angelman and Prader-Willi syndromes. Genomics, 13, 917-924. MEDLINE Abstract

18 Glenn, C.C., Saitoh, S., Jong, M.T.C., Filbrandt, M.M., Surti, U., Driscoll, D.J. and Nicholls, R.D. (1996) Gene structure, DNA methylation, and imprinted expression of the human SNRPN gene. Am. J. Hum. Genet., 58, 335-346. MEDLINE Abstract

19 Dittrich, B., Buiting, K., Korn, B., Rickard, S., Buxton, J., Saitoh, S., Nicholls, R.D., Poustka, A., Winterpacht, A., Zabel, B. and Horsthemke, B. (1996) Imprint switching on human chromosome 15 may involve alternative transcripts of the SNRPN gene. Nature Genet., 14, 163-173. MEDLINE Abstract

20 Frommer, M., McDonald, L.E., Millar, D.S., Collis, C.M., Watt, F., Grigg, G.W., Molloy, P.L. and Paul, C.L. (1992) A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. USA, 89,1827-1831. MEDLINE Abstract

21 Clark, S.J., Harrison, J., Paul, C.L. and Frommer, M. (1994) High sensitivity mapping of methylated cytosines. Nucleic Acids Res., 22, 2990-2997. MEDLINE Abstract

22 Meyer, P., Niedenhof, I. and ten Lohuis, M. (1994) Evidence for cytosine methylation of non-symmetrical sequences in transgenic Petunia hybrida. EMBO J., 13, 2084-2088.

23 Hayatsu, H., Wataya, Y., Kai, K. and Iida, S. (1970) Reaction of sodium bisulfite with uracil, cytosine, and their derivatives. Biochemistry, 9, 2858-2865. MEDLINE Abstract

24 Hayatsu, H. (1976) Bisulfite modification of nucleic acids and their constituents. Progr. Nucleic Acids Res. Mol. Biol., 16, 75-124.

25 Shapiro, R., Braverman, B., Louis, J.B. and Servis, R.E. (1973) Nucleic acid reactivity and conformation. J. Biol. Chem., 248, 4060-4064. MEDLINE Abstract

26 Wang, R.Y.H., Gehrke, C.W. and Ehrlich, M. (1980) Comparison of bisulfite modification of 5-methyldeoxycytidine and deoxycytidine residues. Nucleic Acids Res., 8, 4777-4790.

27 Özçelik, T., Leff, S., Robinson, W., Donlon, T., Lalande, M., Sanjines, E., Schinzel, A. and Franke, U. (1992) Small nuclear ribonucleoprotein polypeptide N (SNRPN), an expressed gene in the Prader-Willi syndrome critical region. Nature Genet., 2, 265-269.

28 Schmauss, C., Brines, M.L. and Lerner, M.R. (1992) The gene encoding the small nuclear ribonucleoprotein-associated protein N is expressed at high levels in neurons. J. Biol. Chem., 267, 8521-8529. MEDLINE Abstract

29 Dittrich, B., Buiting, K., Gross, S. and Horsthemke, B. (1993) Characterization of a methylation imprint in the Prader-Willi syndrome chromosome region. Hum. Mol. Genet., 2, 1995-1999. MEDLINE Abstract

30 Kochanek, S., Toth, M., Dehmel, A., Renz, D. and Doerfler, W. (1990) Interindividual concordance of methylation profiles in human genes for tumor necrosis factors alpha and beta. Proc. Natl. Acad. Sci. USA, 87, 8830-8834. MEDLINE Abstract

31 Behn-Krappa, A., Hölker, I., Sandaradura de Silva, U. and Doerfler, W. (1991) Patterns of DNA methylation are indistinguishable in different individuals over a wide range of human DNA sequences. Genomics, 11, 1-7. MEDLINE Abstract

32 Kochanek, S., Renz, D. and Doerfler, W. (1993) DNA methylation in the Alu sequences of diploid and haploid primary human cells. EMBO J., 12, 1141-1151.

33 Reik, W., Collick, A., Norris, M.L., Barton, S.C. and Surani, M.A. (1987) Genomic imprinting determines methylation of parental alleles in transgenic mice. Nature, 328, 248-251. MEDLINE Abstract

34 Swain, J.L., Stewart, T.A. and Leder, P. (1987) Parental legacy determines methylation and expression of an autosomal transgene: a molecular mechanism for parental imprinting. Cell, 50, 719-727. MEDLINE Abstract

35 Sapienza, C., Paquette, J., Tran, T.H. and Peterson, A. (1989) Epigenetic and genetic factors affect transgene methylation imprinting. Development, 107, 165-168. MEDLINE Abstract

36 Feil, R., Walter, W., Allen, N.D. and Reik, W. (1994) Developmental control of allelic methylation in the imprinted mouse Igf2 and H19 genes. Development, 120, 2933- 2943. MEDLINE Abstract

37 Munnes, M., Schetter, C., Hölker, I. and Doerfler, W. (1995) A fully 5'-CG-3' but not a 5'-CCGG-3' methylated late frog virus 3 promoter retains activity. J. Virol., 69, 2240-2247. MEDLINE Abstract

38 Gillessen-Kaesbach, G., Groß, S., Kaya-Westerloh, S., Passarge, E. and Horsthemke, B. (1995b) DNA methylation based testing of 450 patients suspected of having Prader-Willi syndrome. J. Med. Genet., 32, 88-92. MEDLINE Abstract

39 Gillessen-Kaesbach, G., Robinson, W., Lohmann, D., Kaya-Westerloh, S., Passarge, E. and Horsthemke, B. (1995a) Genotype-phenotype correlation in a series of 167 deletion and non-deletion patients with Prader-Willi syndrome. Hum. Genet., 96, 638-643. MEDLINE Abstract

40 Reis, A., Dittrich, B., Greger, V., Buiting, K., Lalande, M., Gillessen-Kaesbach, G., Anvret, M. and Horsthemke, B. (1994) Imprinting mutations suggested by abnormal DNA methylation patterns in familial Angelman and Prader-Willi syndromes. Am. J. Hum. Genet., 54, 741-747. MEDLINE Abstract

41 Gillessen-Kaesbach, G., Albrecht, B., Horsthemke, B. and Passarge, E. (1995c) A further patient with Angelman syndrome due to paternal uniparental disomy with a mild phenotype. Am. J. Med. Genet., 56, 328-329. MEDLINE Abstract

42 Knoblauch, H. (1996) Molekulare Untersuchung von Patienten mit Verdacht auf Prader-Willi Syndrom. Dissertation Universität Essen.

43 Kunkel, I.M., Smith, K.D., Boyer, S.H., Borgaonkor, D.S., Wachtel, S.S., Miller, O.J., Breg, W.R., Jones, H.W. and Rary, J.M. (1977) Analysis of human y-chromosome-specific reiterated DNA in chromosome variants. Proc. Natl. Acad. Sci. USA, 74, 1245-1249.

44 Hanahan, D. (1985) Techniques for transformation of E.coli. In: D. Glover (ed.), DNA Cloning, vol. 1. IRL Press Ltd., Oxford, pp. 109-135.

45 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA, 74, 5463-5467. MEDLINE Abstract


*To whom correspondence should be addressed

-->


This page is maintained by OUP admin. Last updated Fri Feb 7 12:40:48 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Mol. Diagn.Home page
W. Wang, H.-Y. Law, and S. S. Chong
Detection and Discrimination between Deletional and Non-Deletional Prader-Willi and Angelman Syndromes by Methylation-Specific PCR and Quantitative Melting Curve Analysis
J. Mol. Diagn., September 1, 2009; 11(5): 446 - 449.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
W. Liu and X. Sun
Skewed X chromosome inactivation in diploid and triploid female human embryonic stem cells
Hum. Reprod., August 1, 2009; 24(8): 1834 - 1843.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Zeschnigk, M. Martin, G. Betzl, A. Kalbe, C. Sirsch, K. Buiting, S. Gross, E. Fritzilas, B. Frey, S. Rahmann, et al.
Massive parallel bisulfite sequencing of CG-rich DNA fragments reveals that methylation of many X-chromosomal CpG islands in female blood DNA is incomplete
Hum. Mol. Genet., April 15, 2009; 18(8): 1439 - 1448.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
X. Sun, X. Long, Y. Yin, Y. Jiang, X. Chen, W. Liu, W. Zhang, H. Du, S. Li, Y. Zheng, et al.
Similar biological characteristics of human embryonic stem cell lines with normal and abnormal karyotypes
Hum. Reprod., October 1, 2008; 23(10): 2185 - 2193.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
H. E. White, V. J. Hall, and N. C.P. Cross
Methylation-Sensitive High-Resolution Melting-Curve Analysis of the SNRPN Gene as a Diagnostic Screen for Prader-Willi and Angelman Syndromes
Clin. Chem., November 1, 2007; 53(11): 1960 - 1962.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Teller, I. Solovei, K. Buiting, B. Horsthemke, and T. Cremer
Maintenance of imprinting and nuclear architecture in cycling cells
PNAS, September 18, 2007; 104(38): 14970 - 14975.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Gebhard, L. Schwarzfischer, T.-H. Pham, E. Schilling, M. Klug, R. Andreesen, and M. Rehli
Genome-wide profiling of CpG methylation identifies novel targets of aberrant hypermethylation in myeloid leukemia.
Cancer Res., June 15, 2006; 66(12): 6118 - 6128.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
H. E. White, V. J. Durston, J. F. Harvey, and N. C.P. Cross
Quantitative Analysis of SRNPN Gene Methylation by Pyrosequencing as a Diagnostic Test for Prader-Willi Syndrome and Angelman Syndrome
Clin. Chem., June 1, 2006; 52(6): 1005 - 1013.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
B. Horsthemke and M. Ludwig
Assisted reproduction: the epigenetic perspective
Hum. Reprod. Update, September 1, 2005; 11(5): 473 - 482.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. Geuns, M. De Rycke, A. Van Steirteghem, and I. Liebaers
Methylation imprints of the imprint control region of the SNRPN-gene in human gametes and preimplantation embryos
Hum. Mol. Genet., November 15, 2003; 12(22): 2873 - 2879.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
E Pascale, E Battiloro, G C. Reale, R Pietrobono, M G Pomponi, P Chiurazzi, R Nicolai, M Calvani, G Neri, and E D'Ambrosio
Modulation of methylation in the FMR1 promoter region after long term treatment with L-carnitine and acetyl-L-carnitine
J. Med. Genet., June 1, 2003; 40(6): e76 - 76.
[Full Text] [PDF]


Home page
Cancer Res.Home page
F. Tschentscher, J. Husing, T. Holter, E. Kruse, I. G. Dresen, K.-H. Jockel, G. Anastassiou, H. Schilling, N. Bornfeld, B. Horsthemke, et al.
Tumor Classification Based on Gene Expression Profiling Shows That Uveal Melanomas with and without Monosomy 3 Represent Two Distinct Entities
Cancer Res., May 15, 2003; 63(10): 2578 - 2584.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
R. Peoples, H. Weltman, R. Van Atta, J. Wang, M. Wood, M. Ferrante-Raimondi, P. Cheng, and B. Huan
High-Throughput Detection of Submicroscopic Deletions and Methylation Status at 15q11-q13 by a Photo-Cross-Linking Oligonucleotide Hybridization Assay
Clin. Chem., October 1, 2002; 48(10): 1844 - 1850.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S Roberts, F Maggouta, R Thompson, S Price, and S Thomas
A patient with a supernumerary marker chromosome (15), Angelman syndrome, and uniparental disomy resulting from paternal meiosis II non-disjunction
J. Med. Genet., February 1, 2002; 39(2): e9 - 9.
[Full Text] [PDF]


Home page
Cancer Res.Home page
D. T. Schneider, A. E. Schuster, M. K. Fritsch, J. Hu, T. Olson, S. Lauer, U. Gobel, and E. J. Perlman
Multipoint Imprinting Analysis Indicates a Common Precursor Cell for Gonadal and Nongonadal Pediatric Germ Cell Tumors
Cancer Res., October 1, 2001; 61(19): 7268 - 7276.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
J. Worm, A. Aggerholm, and P. Guldberg
In-Tube DNA Methylation Profiling by Fluorescence Melting Curve Analysis
Clin. Chem., July 1, 2001; 47(7): 1183 - 1189.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
J. F Costello and C. Plass
Methylation matters
J. Med. Genet., May 1, 2001; 38(5): 285 - 303.
[Abstract] [Full Text]


Home page
Nucleic Acids ResHome page
P. Babinger, I. Kobl, W. Mages, and R. Schmitt
A link between DNA methylation and epigenetic silencing in transgenic Volvox carteri
Nucleic Acids Res., March 15, 2001; 29(6): 1261 - 1271.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
P. Ungaro, S. L Christian, J. A Fantes, A. Mutirangura, S. Black, J. Reynolds, S. Malcolm, W. B Dobyns, and D. H Ledbetter
Molecular characterisation of four cases of intrachromosomal triplication of chromosome 15q11-q14
J. Med. Genet., January 1, 2001; 38(1): 26 - 34.
[Abstract] [Full Text]


Home page
JEMHome page
N. Mathieu, W. M. Hempel, S. Spicuglia, C. Verthuy, and P. Ferrier
Chromatin Remodeling by the T Cell Receptor (Tcr)-{beta} Gene Enhancer during Early T Cell Development: Implications for the Control of Tcr-{beta} Locus Recombination
J. Exp. Med., September 5, 2000; 192(5): 625 - 636.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Liu, S. Yu, D. Litman, W. Chen, and L. S. Weinstein
Identification of a Methylation Imprint Mark within the Mouse Gnas Locus
Mol. Cell. Biol., August 15, 2000; 20(16): 5808 - 5817.
[Abstract] [Full Text]


Home page
Nucleic Acids ResHome page
B. Genc, H. Muller-Hartmann, M. Zeschnigk, H. Deissler, B. Schmitz, F. Majewski, A. v. Gontard, and W. Doerfler
Methylation mosaicism of 5'-(CGG)n-3' repeats in fragile X, premutation and normal individuals
Nucleic Acids Res., May 15, 2000; 28(10): 2141 - 2152.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. R. W. Mann and MarisaS. Bartolomei
Towards a molecular understandingof Prader-Willi and Angelman syndromes
Hum. Mol. Genet., September 1, 1999; 8(10): 1867 - 1873.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Remus, C. Kämmer, H. Heller, B. Schmitz, G. Schell, and W. Doerfler
Insertion of Foreign DNA into an Established Mammalian Genome Can Alter the Methylation of Cellular DNA Sequences
J. Virol., February 1, 1999; 73(2): 1010 - 1022.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. M. LaSalle, R. J. Ritchie, H. Glatt, and M. Lalande
Clonal heterogeneity at allelic methylation sites diagnostic for Prader-Willi and Angelman syndromes
PNAS, February 17, 1998; 95(4): 1675 - 1680.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
A.H.M. M. Huq, J. S. Sutcliffe, M. Nakao, Y. Shen, R. A. Gibbs, and A. L. Beaudet
Sequencing and Functional Analysis of the SNRPN Promoter: In Vitro Methylation Abolishes Promoter Activity
Genome Res., June 1, 1997; 7(6): 642 - 648.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (85)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Zeschnigk, M.
Right arrow Articles by Doerfler, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zeschnigk, M.
Right arrow Articles by Doerfler, W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?