Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (32)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Reed, V.
Right arrow Articles by Boyd, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reed, V.
Right arrow Articles by Boyd, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 417-423

Mutation analysis provides additional proof that mottled is the mouse homologue of Menkes' disease
Introduction
Results
   Atp7a transcripts are produced in a range of mottled males
   Mutation detection
   Atp7aMo-br has an amino acid substitution and a 6 bp deletion
   Atp7aMo-vbr has a mutation in the Atp7a phosphorylation domain
   No causal mutation was found in the coding region of Atp7aMo-13H
   Confirmation of the splice site mutation in Atp7aMo-blo
Discussion
Materials And Methods
   Mouse strains
   RNA preparation and RT-PCR
   Cloning of amplification products and sequence analysis
   Filter hybridisation
Acknowledgements
References

Mutation analysis provides additional proof that mottled is the mouse homologue of Menkes' disease

Mutation analysis provides additional proof that mottled is the mouse homologue of Menkes' disease Vivienne Reed and Yvonne Boyd*

MRC Mammalian Genetics Unit, Harwell, Oxon OX11 ORD, UK

Received October 28, 1996; Revised and Accepted November 28, 1996

Menkes' disease (MD) and occipital horn syndrome (OHS) are allelic X-linked disorders caused by mutations in the copper ion transporting ATPase, ATP7A. Genetic, phenotypic and biochemical data suggest that mottled mutants in the mouse, which range in severity and phenotype, are caused by mutations in Atp7a, the mouse homologue of ATP7A. As the only causal mutation in Atp7a has been reported in one very mild allele thought to be a model for OHS, Atp7aMo-blo (mottled blotchy), we sequenced the entire 4.5 kb coding region of three other mottled mutants, two of which are thought to be models for classical MD (AtpaMo-br, AtpaMo-13H) and one with a slightly milder phenotype (Atp7aMo-vbr). Although no causal mutation was found in Atp7aMo-13H, mutations which can be predicted to affect Atp7a function were identified in Atp7aMo-br and Atp7aMo-vbr. A 6 bp deletion of nucleotides 2478-2483, which can be predicted to affect the correct processing of the protein, was found in Atp7aMo-br and an A3189 -> C nucleotide change, which results in lysine -> threonine amino acid substitution in the phosphorylation domain, was found in Atp7aMo-vbr. Thus we provide further proof that mottled mutants will provide excellent models for MD as well as OHS.

INTRODUCTION

Menkes disease (MD) is an X-linked disorder, in which affected males die during the first few years of life, and is characterised by growth retardation, peculiar hair, hypopigmentation and neurological and connective tissue abnormalities (1 ,2 ). The underlying cause is a defect in the process by which dietary copper is distributed to dependent enzymes and proteins and as a result the overall clinical picture is one of copper deficiency. In 1993, exploitation of X chromosome rearrangements which disrupted the MD locus led to the cloning of the gene responsible (3 -5 ). It was shown to encode a P-type metal ion ATPase which had considerable homology to bacterial transporting ATPases. Qualitative and quantitative changes in ATP7A RNA levels were reported in many patients (3 -5 ) and 20% of patients were found to possess large gene deletions (6 ). The ATP7A transcript is 8.5 kb and covers >100 kb of genomic DNA (3 -5 ). The 4.5 kb coding region is organised into 23 exons with the first exon, which is untranslated, separated from exon 2 by an intron of ~40 kb (6 ,7 ). Mutation analyses of 12 patients with severe MD identified 10 independent lesions, six splicing abnormalities which were distributed throughout the gene and four basepair substitutions or small deletions (8 ). Aberrant splicing of ATP7A was also shown to be responsible for the phenotype of three independent patients with the milder X-linked disorder cutis laxa, or occipital horn syndrome (OHS), thus providing formal proof that MD and OHS are allelic (9 ,10 ).

Because of phenotypic and biochemical similarities and of comparative map position, the X-linked mouse mutant mottled was proposed as the homologue of MD (11 ,12 ). Many mottled mutants have arisen both spontaneously and after chemical and radiation mutagenesis and all are assumed to be alleles on the basis of their X-linked inheritance and their similar phenotypes (13 ). The one exception is yellow mottled (Ym) which lies close to mottled but which has been separated from it by recombination (14 ). However, there are phenotypic and severity differences between the various mottled alleles which enables them to be assigned into one of three groups. The first group of alleles have a phenotype similar to OHS in that affected males suffer mainly from connective tissue problems and are viable and fertile, for example mottled blotchy (13 ). The second group of alleles, of which mottled brindled (13 ) is an example, have severe neurological problems and are thought to be the most similar to classical MD as affected males die ~7-10 days after birth, with the exception of mottled viable brindled, in which affected males survive beyond weaning. The third group of alleles can be represented by mottled dappled (15 ), have been reported to have skeletal abnormalities and are the most severely affected with mutant males dying in utero. Although phenotypic symptoms vary between alleles, copper tissue levels and the kinetics of cellular copper accumulation are similar in all alleles tested and are the same as seen in MD patients (12 ,16 , Masson et al., in preparation). As mouse mutants can be maintained on identical genetic backgrounds, mottled alleles provide an unprecedented opportunity to analyse the phenotypic effect of different mutationsin Atp7a.

Atp7a, the mouse homologue of ATP7A, was cloned in 1994 and has a high degree of homology to the human locus (17 -19 ). A genomic deletion was reported as the mutational event in the dappled allele (17 ,18 ); however, this was pointed out to be a strain-specific restriction fragment length variant (20 ). Furthermore, a search for deletions in a range of 12 mottled alleles using both pulsed field and conventional gel electrophoresis failed to detect any genomic rearrangements in Atp7a despite the fact that several of the mutations arose in radiation mutagenesis experiments (21 ,22 ). There is some molecular evidence that mutations in Atp7a are the cause of the mottled phenotype. A splice site mutation, which leads to the occasional skipping of exon 11 and a subsequent frameshift of the remainder of the transcript, has been demonstrated in mottled blotchy (9 ) and Atp7a transcripts cannot be detected in embryonic fibroblasts of mottled dappled origin (17 ,18 ). However, a significant, although reduced amount of the normal transcript is present in addition to the truncated form in mottled blotchy (7 -9 ), and no genomic mutation has yet been described in mottled dappled. To provide additional proof that mutations in Atp7a cause the mottled phenotype, we have sequenced the entire Atp7a coding region in three alleles of mottled and confirmed that the splice site mutation reported in mottled blotchy is not present in 15 other strains. The alleles chosen for sequencing were one which resembles the clinical picture seen in mild Menkes' disease and two in which affected males die ~10 days after birth and are thought to most closely resemble classical Menkes' disease.

RESULTS

Atp7a transcripts are produced in a range of mottled males

The Atp7a coding region was amplified in four overlapping segments using RT-PCR and primers designed from the published mouse cDNA sequence (accession number U03434). For all four segments, products of equal size and intensity were amplified from RT products prepared from affected males and control male littermates from stocks that carried eight independent mottled alleles: Atp7aMo-blo (mottled blotchy), Atp7aMo-pew (mottled pewter), Atp7aMo-vbr (mottled viable brindled), Atp7aMo-br (mottled brindled), Atp7aMo-brJ (mottled brindledJ), Atp7aMo-8J (mottled 8J), Atp7aMo-13H (mottled 13H) (Fig. 1 ). In addition to the expected product, smaller allele-specific products were consistently seen in segment 1 reactions amplified from mottled blotchy, brindled and 13H (Fig. 1 ). Both larger and smaller products were amplified in segment 3 reactions when mottled blotchy cDNA was used as a template as described previously (9 ). All RT-PCR products were shown to hybridise to relevant portions of human ATP7A cDNA and this (and subsequent sequence analysis) confirmed that they had been amplified from the Atp7a locus (data not shown). When the smaller segment 1 products were cloned and sequenced they were found to contain deletions which ran from nucleotides 137-991 (blotchy), 267-335 (brindled) and 440-1162 (mottled 13H). In each case, a unique sequence identity of 4-9 bp was found at both ends of the deletion. Sequence analysis of these products, the normal RT-PCR product and the full genomic exonic and intronic DNA regions deleted revealed that there were no causal genomic changes in the deleted region and it was assumed that these RNA fragments resulted from a perturbation of the normal splicing of the primary transcript by a downstream mutation. A similar situation has been described at the DHPR locus (23 ). It is unclear whether any of the aberrant segment 1 products, which were never observed in controls, has a direct effect on Atp7a transcription.


Figure 1. (a) Schematic diagram of the Atp7a gene showing the extent and location of the four nested PCR products. Exons are drawn approximately to scale (19). (b) RT-PCR reactions from seven mottled mutants and control 3H1 cDNA analysed by gel electrophoresis. Note that products of the expected size were seen in all reactions and that additional products can be seen in segment 1 amplifications (blo,br,13H) and segment 3 (blo). ATP7A probes hybridised to all visible bands and detected no additional amplification products. Although amplification products of the same size and intensity were observed in all samples, no conclusions can be drawn concerning the level of transcription from the Atp7a gene in the various mutants as the PCR conditions were not optimised to produce quantitative results. Mottled alleles are as follows: blo, mottled blotchy; br, brindled; brJ, remutation to brindled discovered at the Jackson Laboratory; pew, pewter; vbr, viable brindled; 13H and 8J (see Materials and Methods). RT-PCR reactions were also carried out on RNA prepared from C57BL/6 and PT strains of mice and these yielded identical size products (data not shown).

Mutation detection

As Atp7a was transcribed in all alleles and no products which could be attributed to aberrant splicing were observed other than in blotchy (see below), it was likely that any mutational lesions would be small changes in the coding sequence. We therefore undertook to sequence the entire Atp7a coding region in four mutants, two of which were thought to be appropriate models for classical MD (brindled and 13H), one of intermediate severity (viable brindled) and mottled blotchy which is thought to be an appropriate model for OHS.

Discrepancies from the published mouse Atp7a sequence were considered significant if they led to nonsense or frameshift mutations, or when they led to amino acid substitutions different from those published in the mouse or human protein sequences. Five such changes from the published sequence were found with two of these associated with strain-specific amino acid substitutions. A T1491 -> C nucleotide change which led to the substitution of a leucine by a proline at residue 71 was found in stocks of C3H/HeH, 101/H and Mus spretus origin and an A3840 -> G nucleotide change which led to the substitution of a glutamine by an arginine at residue 1254 was found in stocks of C57BL/6 origin. The remaining three significant changes were specific to the mottled stock being analysed.

Atp7aMo-br has an amino acid substitution and a 6 bp deletion

Two significant nucleotide changes were found in RT-PCR and genomic DNA products amplified from mottled brindled. A G1619 -> A nucleotide change was found which results in the substitution of alanine by threonine at position 514. This change lies in the interval between the last two copper binding domains which is significantly different in mouse and man and therefore is unlikely to be a critical region for protein function. A better candidate for the causal mutation is the 6 bp deletion found when sequencing the cloned RT-PCR containing exon 11 from mottled brindled (Fig. 2 ). The deletion removes nucleotides 2478-2483, which encode a leucine and an alanine, but leaves the remainder of the transcript in frame. To verify that this change was a genuine mutation and unique to mottled brindled, primers (MO3eF and MO3int) were designed to amplify exon 11 from genomic DNA. Amplification products of the expected size of 195 bp were generated in PCR reactions from DNA prepared from affected males of the five other mottled alleles and three strains of mice, including the strain of origin C57BL/6 (21 ). Only when DNA from mottled brindled males was used as a template was a smaller size (189 bp) fragment produced (Fig. 2 ).


Figure 2. Mutations in the Atp7a gene of three mottled mutants. Note that the mutation in mottled blotchy was first identified and characterised by Das et al. (9). (a) PCR analysis of DNA prepared from mottled blotchy and an extensive range of mouse stocks/strains. (b) Schematic diagram depicting the position of the mutations found in mottled brindled, blotchy and viable brindled.(c) Mutation detected in mottled brindled by acrylamide gel and sequence analysis.(d) Mutation detected in mottled viable brindled by sequence analysis.

Atp7aMo-vbr has a mutation in the Atp7a phosphorylation domain

An A -> C substitution was found at nucleotide 3189 when the amplification product of segment 3 from mottled viable brindled was sequenced (Fig. 2 ). Nucleotide 3189 lies in exon 16 which can be amplified directly from genomic DNA using primers Moex16F and Moex16R. This nucleotide change was present in no other sequence data obtained from RT-PCR or genomic DNA products. It was also found in genomic DNA amplified from mottled viable brindled, and as no other unique change was found in the entire coding sequence, we suggest that this is the molecular lesion responsible for the mottled brindled phenotype. This transition results in a lysine (K) residue being replaced by a threonine (T) in the phosphorylation domain of the ATPase (see below).

No causal mutation was found in the coding region of Atp7aMo-13H

The strain-specific change T1491 -> C, which caused the substitution of a leucine by a proline, was identified during the sequencing of clones from two independent RT-PCR reactions using DNA from mottled 13H as a template and was initially a candidate for a causal mutation until it was found to be present in the inbred mouse strains C3H/HeH and 101/H (data not shown). As this amino acid substitution introduces a proline into the region between the 4th and 5th metal binding sites of Atp7a, we can conclude that the tertiary structure of protein in this region is not critical for efficient copper binding and delivery. No other sequence alteration was found in the entire coding region of mottled 13H and we therefore suggest that the causal mutation lies outside the coding region.

Confirmation of the splice site mutation in Atp7aMo-blo

During the course of sequencing cloned RT-PCR products from the mottled blotchy mutant, a +3 splice-donor mutation was reported in exon 11 of this mutant (9 ). As the strain of origin for mottled blotchy is unknown, we confirmed that the published A -> C substitution was unique to mottled blotchy by testing for the presence of the diagnostic AvaII site in 15 additional mottled alleles (data not shown) and 12 additional strains/species of mice (Fig. 2 ). We therefore did not sequence segments 2-4 from this mutant.

DISCUSSION

For some time, mottled has been thought to be the mouse homologue of Menkes disease and the identification of a molecular lesion in Atp7a in three independent mottled mutants now provides further proof that this is the case (Table 1 ). The two novel lesions described here can be predicted to have an effect on the function of this P-type ATPase. The characteristic feature of the superfamily of P-type ATPases is the use of the energy of ATP hydrolysis to pump substrate across a membrane (24 -26 ). Atp7a has the basic domain structure of this group of proteins, with multiple copper binding motifs at the N-terminal end of the protein, followed by a transmembranous region and two cytoplasmic domains, a small one thought to be responsible for energy transduction and a larger one which contains highly conserved phosphorylation and ATP binding motifs (Fig. 3 ). The new mutations reported here lie in these two cytoplasmic domains.


Figure 3. The positions of mutations at mottled in relationship to the protein structure of Atp7a. The positions of the two strain/stock-specific amino acid changes are also indicated.

Table 1 . Summary of mutation analyses
Mutant symbol

Mutant name

Phenotype

Nucleotide change

Consequence

Atp7aMo-br

mottled brindled

similar to classical MD

CTCTTG deletion, exon 11

in-frame removal of leucine and

 

 

 

nucleotides 2478-2483

alanine in transduction domain

Atp7aMo-vbr

mottled viable brindled

similar to mild MD

A3189 -> C, exon 16

lysine -> threonine substitution in

 

 

 

 

ATP phosphorylation motif

Atp7aMo-blo

mottled blotchy

OHS

+3 splice donor A -> C

occasional skipping of exon 11

 

 

 

exon 11

reduced levels of normal transcript (Das et al. 1995)

Atp7aMo-13H

mottled 13H

similar to classical MD

no unique change observed

 

 

 

 

in coding region

 

The 6 bp in-frame deletion in mottled brindled removes residues 801 and 802 from the small cytoplasmic loop which lies between the 4th and 5th transmembrane regions (Fig. 3 ). This domain appears to be essential for the communication of conformational signals between the enzyme catalytic site and the cation binding sites and contains a highly conserved TGES motif thought to be essential for phosphatase activity (24 ). A clue to the effect of this deletion on the function of Atp7a comes from comparing the position of the deleted residues in the Atp7a with the mutations in another P-type ATPase, the cystic fibrosis transmembrane conductance regulator (CFTR) which is an ABC transporter (24 ). The 2 amino acid deletion found in Atp7aMo-br lies in a region of the ATPase analogous to the region that contains two separate single amino acid deletions in CFTR, the rare [Delta]I507 mutation and the common [Delta]F508 mutation (27 ). The [Delta]F508 mutation is thought to cause CTFR to adopt an abnormal conformation, which prevents it from being correctly glycosylated and delivered to its site of action, the plasma membrane (28 ). If the Atp7aMo-br mutation has a similar effect on Atp7a, then the mutant protein will have very little, if any, functional activity. The point mutation identified in mottled viable brindled lies in the large cytoplasmic domain and leads to an amino acid substitution in the critical DKTGT(I,L)T motif which includes the phosphorylatable aspartate (D) residue. This phosphorylation motif is highly conserved throughout evolution in a wide range of ATPases and the substitution of T (threonine) for K (lysine) would be expected to have a detrimental effect on the phosphorylation reaction, and therefore the energy available for cation transport.

The three mottled alleles with identified mutations all have different phenotypic features (Table 1 ) and as they are kept on identical genetic backgrounds, the differences in phenotype are likely to be caused by differences in the effect of the mutation on Atp7a function. The most severe phenotype studied here is that found in mottled brindled in which males die at 7-10 days, have profound neurological problems and can be described as one of the alleles which is associated with a phenotype similar to classical MD. This could be explained by defective processing of the nascent protein with a potential loss of most functional activity. Affected males from mottled viable brindled are less severely affected than brindled males but more severely affected than blotchy males. We would predict that the protein produced by mottled viable brindled, which can be predicted to have impaired phosphorylating activity, may retain some functional activity and this would explain the milder phenotype seen in these animals. The mottled blotchy mutant has a milder phenotype than that of mottled viable brindled and is similar to OHS. As in OHS patients and mottled blotchy mice normal Atp7a transcripts are produced, presumably some functional copper transport takes place. It is of interest to note that one OHS patient has been described with a mutation which also results in the occasional skipping of exon 11 (10 ).

Current data indicate that there are differences in the mutation spectrum at the Atp7a locus in man and mouse. In a survey of 230 patients with classical MD, ~45 had ATP7A deletions or genomic rearrangements that were detectable by Southern blotting (6 ). Although the data is more limited in the mouse, no genomic rearrangements have been detected in a survey of 14 mottled alleles associated with various phenotypes (21 ,22 ). The absence of large deletions at Atp7a in the mouse is intriguing as it would appear that, in man, a null allele at ATP7A does not lead to prenatal death. This is of interest in the context that the two new mutations identified here are both changes which maintain the reading frame of the transcript and can be predicted to produce an aberrant protein, rather than no protein at all. It is possible that the subset of mouse mutants in which affected males die in utero may have mutations, including deletions, which fail to produce Atp7a protein as these are under-represented in the collection of alleles studied. In a study of 12 patients with classical MD, six of the mutations were associated with aberrant splicing, two with separate 6 bp deletions in exon 4 which led to frameshifts and two with nucleotide changes which led to an amino acid substitution in exon 10 and to a nonsense mutation in exon 3 (8 ). Again this reveals a difference between the mutation spectrum in man and mouse as the RT-PCR results reported here indicate that aberrant splicing is not a common mutation in mottled alleles associated with early postnatal death of affected males.

Table 2 . Primers used to amplify sections of Atp7a
Primer name

Sequence (5' -> 3')

cDNA region amplified

Mnk1aF

CTGCGGACGTCCAGAGCTCG

nucleotides 23-42

Mnk1cF

AGCCCTGGAAACCCAGGAATG

nucleotides 49-69

Mnk1bR

GATCAAATTCAATAGTCCCT

nucleotides 1349-1330

Mnk1dR

GCTGTTTGCGAGGGACACGTG

nucleotides 1327-1307

Mnk2aF

CCAGTATGTAAGCAGTATAG

nucleotides 987-1007

Mnk2cF

ATTGCAAGTGAAGTTGAAAG

nucleotides 1122-1140

Mnk2bR

AGCCATCGTCCTAGTGCGAT

nucleotides 2435-2426

Mnk3aF

TATTATGTCTACCTGTACAG

nucleotides 2208-2227

Mnk3cF

CGGCTGGTACTTCTACATTC

nucleotides 2236-2255

Mnk3dR

TCTTCTATCTTCAAGTTACTC

nucleotides 3471-3451

Mnk3bR

CCATGAGGACTTTGTACTGC

nucleotides 3603-3584

Mnk4aF

TGTGGGGACTGCAGAAAGTA

nucleotides 3283-3302

Mnk4cF

GAACATCCTTTAGGAGCAGC

nucleotides 3308-3327

Mnk4bR

CCTGCACGTAACAGCATGAG

nucleotides 4694-4675

Primer pairs from Atp7a used in these studies were designed either from the mouse cDNA sequence held in the databases (accession number U03434) or from sequence data produced in our laboratory during the course of these studies.

In conclusion, we have demonstrated that mutations in Atp7a which can be predicted to affect functional copper transport are present in mutants at the mouse mottled locus. As many alleles maintained on identical genetic backgrounds are available, characterisation of further mutations will reveal more information about the relationship between genotype and the mutant phenotype as well as about the functional domains of the ATP7A.

MATERIALS AND METHODS

Mouse strains

Mottled blotchy (Atp7aMo-blo), mottled brindled (Atp7aMo-br), mottled viable brindled (Atp7aMo-vbr), and mottled 13H (Atp7aMo-13H), were maintained by mating Mo/+ females to 3H1 males, where 3H1 is an F1 hybrid stock produced by mating C3H/HeH females to 101/H males. Frozen tissues dissected from mottled pewter (Atp7aMo-pew), mottled brindled J (Atp7aMo-brJ), and mottled 8J (Atp7aMo-8J), were obtained from Hope Sweet and Muriel Davisson of the Jackson laboratory. Affected males from Atp7aMo-blo and AtpMo-pew have normal viability and fertility, and those from Atp7aMo-vbr have a reduced viability and are generally infertile. Affected males from the other mutant stocks (Atp7aMo-br, Atp7aMo-brJ, Atp7aMo-8J) all die ~7-12 days after birth. Mutant mottled alleles are described in refs 13 and 21 , except for mottled 8J which is a recent remutation discovered at the Jackson Laboratory.

RNA preparation and RT-PCR

Individual mouse tissues were dissected, flash frozen and stored in liquid nitrogen until needed. RNA was prepared from pulverised tissues by treatment with RNAzol (Biogenesis Ltd.). Nested RT-PCR was performed using brain RNA as a template for four overlapping segments of Atp7a (Fig. 1 ) using the appropriate primers (Table 2 ) in a standard PCR buffer (1.5 mM MgCl2) containing AmpliTaq (Perkin Elmer).

An initial round of PCR (30 cycles) was carried out using primers equivalent to the first and last ~20 bp for each segment, i.e. Mnk1aF/Mnk1bR for segment 1, Mnk2aF/Mnk2bR for segment 2, Mnk3aF/Mnk3bR for segment 3 and Mnk 4aF/Mnk4bR for segment 4. Amplification products from these reactions were then re-amplified (20 cycles of PCR) using nested primers as follows: Mnk1cF/Mnk1dR for segment 1, Mnk2cF/Mnk2bR for segment 2, Mnk3cF/Mnk3dR for segment 3 and Mnk4cF/Mnk4bR for segment 4.

Cloning of amplification products and sequence analysis

RT-PCR products from sections 1 and 4 were cloned directly into the EcoRV site of pBluescript but segments 2 and 3 could not be cloned directly therefore additional RT-PCR reactions were designed to yield smaller products which were cloned and sequenced in the same way as the larger segments. Sequencing was performed on purified double-stranded DNA using a Pharmacia T7 sequencing kit and both universal primers and internal primers designed from the mouse cDNA sequence.

All significant nucleotide changes (i.e. all those which would lead to nonsense, frameshift or missense mutations) were checked routinely by two or more of the following methods: an independent clone from the same PCR reaction was sequenced to identify PCR errors which occurred late in the amplification reaction, products from independent RT-PCR reactions were cloned and sequenced to identify PCR errors which occurred early in the amplification reaction, the same RT-PCR product was cloned and sequenced from control strains including the known or probable strain of origin and finally, primers were designed to amplify the equivalent genomic region, and the amplification product was cloned and sequenced. During the sequencing of a total of ~14 kb of DNA, 16 significant changes could be attributed to infidelities of the PCR reaction. Five nucleotide changes (C214 -> A, G389 -> A, G597 -> T, C1626 -> T and G3733 -> T) were found in all mottled stocks and control strains sequenced. The resultant amino acid changes substituted residues which were the same as that reported in the human protein sequence, and therefore these nucleotide changes were assumed to be errors in the published sequence or strain specific differences between Balb/c, the origin of the Atp7a published sequence, and the control strains used in this study (C57BL/6 and C3H/HeH). Four nucleotide changes were found which caused no change to the amino acid residues and these were assumed to be conservative strain/stock-specific changes.

Filter hybridisation

Probes were labelled with [32P]dCTP by nick-translation or multipriming using commercial kits (Amersham International) and hybridised to DNA blotted onto Hybond-N+ membranes using a standard hybridisation solution.

ACKNOWLEDGEMENTS

We are grateful to Drs Steve Hyde and Deborah Gill for helpful discussions and to Hope Sweet and Dr Muriel Davisson (Jackson Laboratory) for supplying frozen tissues from Atp7aMo-pew, Atp7aMo-brJ and Atp7aMo-8J animals. We thank Hester Hughes for assistance with animal care and Kevin Glover for assistance with photography.

REFERENCES

1 Menkes,J.H., Alter,M., Steigleder,G.K., Weakley,D.R. and Sung,J.H. (1962) A sex-linked recessive disorder with retardation of growth, peculiar hair and focal cerebral and cerebellar degeneration. Pediatrics 29, 764-769.

Horn,N., Tønnesen,T. and Tümer,Z. (1992) Menkes disease: an X-linked neurological disorder of the copper metabolism. Brain Pathol. 2, 351-362.

Chelly, J., Tümer,Z., Tønnesen,T., Petterson,A., Ishikawa-Brush,Y., Tommerup,N., Horn,N. and Monaco,A.P. (1993) Isolation of a candidate gene for Menkes disease that encodes a potential heavy metal binding protein. Nature Genet. 3, 14-19.

Mercer,J.F.B., Livingston,J., Hall,B., Paynter,J.A., Begy,C., Chandrasekharappa,S., Lockhart,P., Grimes,A., Bhave,M., Siemieniak,D. and Glover,T.W. (1993) Isolation of a partial candidate gene for Menkes' disease by positional cloning. Nature Genet. 3, 20-25.

Vulpe,C., Levinson,B., Whitney,S., Packman,S. and Gitschier,J. (1993) Isolation of a candidate gene for Menkes disease and evidence that encodes a copper-transporting ATPase. Nature Genet. 3, 7-13.

Tümer,Z., Vural,B., Tønnesen,T., Chelly,J., Monaco,A.P. and Horn,N. (1995) Characterization of the exon structure of the Menkes disease gene using vectorette PCR. Genomics 26, 437-442.

Dierick,H.A., Ambrosini,L., Spencer,J., Glover,T.W. and Mercer,J.F. (1995) Molecular structure of the Menkes Disease gene (ATP7A). Genomics 28, 462-469.

Das,S., Levinson,B., Whitney,S., Vulpe,C., Packman,S. and Gitschier,J. (1994) Diverse mutations in patients with Menkes disease often lead to exon skipping. Am. J. Hum. Genet. 55, 883-889.

Das,S., Levinson,B., Vulpe,C., Whitney,S., Gitschier,J. and Packman,S. (1995) Similar splicing mutations of the Menkes/mottled copper transporting ATPase gene in occipital horn syndrome and the blotchy mouse. Am. J. Hum. Genet. 56, 570-576.

10 Kaler,S.G., Gallo,L.K., Proud,V.K., Percy,A.K., Mark, Y., Segal,N.A., Goldstein,D.S., Holmes,C.S. and Gahl,W.A. (1994) Occipital horn syndrome and mild Menkes phenotype associated with splice site mutations at the MNK locus. Nature Genet. 8, 195-202.

11 Danks,D.M. (1977) Copper transport and utilisation in Menkes' syndrome and in mottled mice. Inorg. Perspect. Biol. Med. 1, 73-100.

12 Hunt,D.M. (1974) Primary defect in copper transport underlies mottled mutants in the mouse. Nature 249, 852-854.

13 Green,M.C. (1995) Catalog of mutant genes and polymorphic loci. In Rastan,S., Lyon,M.F. and Brown,S.D.M. (Eds) Genetic Variants and Strains of the Laboratory Mouse, Oxford University Press, Oxford, UK.

14 Hunsicker,P.R. (1969) Mouse News Lett. 40, 42.

15 Phillips,R.J.S. (1961) `Dappled', a new allele at the mottled locus in the house mouse. Genet. Res. 2, 290-295.

16 Horn, N. (1989) Menkes X-linked disease: prenatal diagnosis of hemizygous males and heterozygous females. Prenat. Diagn. 1, 107-120.

17 Levinson,B., Vulpe,C., Elder,B., Martin,C., Verley,F., Packman,S. and Gitschier,J. (1994) The mottled gene is the mouse homologue of the Menkes disease gene. Nature Genet. 6, 369-373.

18 Mercer,J.F.B., Grimes,A., Ambrosini,L., Lockhart,P., Paynter,J.A., Dierick,H. and Glover,T.W. (1994) Mutations in the murine homologue of the Menkes gene in dappled and blotchy mice. Nature Genet. 6, 374-378.

19 Cecchi,C. and Avner,P. (1996) Genomic organisation of the mottled gene, the mouse homologue of the human Menkes' disease gene. Genomics 37, 96-104.

20 Reed,V. and Boyd,Y. (1994) Mutations reported in mottled dappled are RFLVs. Nature Genet. 8, 11-12.

21 George,A.M., Reed,V., Glenister,P., Tümer,Z., Horn,N., Chelly,J., Monaco,A.P. and Boyd,Y. (1994) Analysis of Mnk, the murine homologue of the locus for Menkes disease, in normal and mottled (Mo) mice. Genomics 22, 27-35.

22 Masson,W., Holt,S., Reed,V. and Boyd,Y. (1996) The use of compound heterozygotes and Hprt selection to analyze X-linked mottled alleles associated with prenatal male lethality. Mamm. Genome 7, 486-489.

23 Smooker,P.M., Christodoulou,J., McInnes,R.R. and Cotton,R.G.H. (1995) A mutation causing DHPR deficiency results in a frameshift and a secondary splicing defect. J. Med. Genet. 32, 220-223.

24 Higgins,C.F. (1992) ABC transporters: from microorgansims to man. Annu. Rev. Cell Biol. 8, 67-113.

25 Solioz,M. and Vulpe,C. (1996) Cpx-type ATPases: a class of P-type ATPases that pump heavy metals. Trends Biol. Sci. 521, 237-241.

26 Møller,J.V., Juul,B., le Maire,M. (1996) Structural organisation, ion transport, and energy transduction of P-type ATPases. Biochim. Biophys. Acta 1286, 1-51.

27 Kerem,B-S., Zielenski,J., Markiewicz,D., Bozon,D., Gazit,E., Yahav,J., Kennedy,D., Riordan,J.R., Collins,F.S., Rommens,J.M. and Tsui,L-C. (1990) Identification of mutations in regions corresponding to the two putative nucleotide (ATP)-binding folds of the ccystic fibrosis gene. Proc. Natl. Acad. Sci. USA 87, 8447-84451.

28 Welsh,M.E. and Smith,A.E. (1993) Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis. Cell 73, 1251-1254.


*To whom correspondence should be addressed

-->


This page is maintained by OUP admin. Last updated Fri Feb 7 12:40:48 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Med. Genet.Home page
P de Bie, P Muller, C Wijmenga, and L W J Klomp
Molecular pathogenesis of Wilson and Menkes disease: correlation of mutations with molecular defects and disease phenotypes
J. Med. Genet., November 1, 2007; 44(11): 673 - 688.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
J. F. B. Mercer and R. M. Llanos
Molecular and Cellular Aspects of Copper Transport in Developing Mammals
J. Nutr., May 1, 2003; 133(5): 1481S - 1484.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. C. Steveson, G. D. Ciccotosto, X.-M. Ma, G. P. Mueller, R. E. Mains, and B. A. Eipper
Menkes Protein Contributes to the Function of Peptidylglycine {alpha}-Amidating Monooxygenase
Endocrinology, January 1, 2003; 144(1): 188 - 200.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
Y. Boyd, H. J. Blair, P. Cunliffe, W. K. Masson, and V. Reed
A Phenotype Map of the Mouse X Chromosome: Models for Human X-linked Disease
Genome Res., March 1, 2000; 10(3): 277 - 292.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. S. Payne, E. J. Kelly, and J. D. Gitlin
Functional expression of the Wilson disease protein reveals mislocalization and impaired copper-dependent trafficking of the common H1069Q mutation
PNAS, September 1, 1998; 95(18): 10854 - 10859.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (32)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Reed, V.
Right arrow Articles by Boyd, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reed, V.
Right arrow Articles by Boyd, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?