The mottled mouse as a model for human Menkes disease: identification of mutations in the Atp7a gene
The mottled mouse as a model for human Menkes disease: identification of mutations in the Atp7a geneChiara Cecchi1,*, Michel Biasotto2, Mario Tosi2 and Philip Avner1
1Unité de Génétique Moléculaire Murine and 2Unité d'Immunogénétique, Institut Pasteur, 75015 Paris, France
Received November 1, 1996;Revised and Accepted December 17, 1996
Mutations in the Atp7a gene, the mouse homologue of the MNK (ATP7A) gene, have been suggested to be responsible for the mottled phenotype. To date, despite considerable effort, changes associated with the mottled mutations have been detected in only two such mutants. In this study, we identify changes in the level of Atp7a transcript and mutations which could explain the mottled phenotype in nine out of the 10 mutants analysed. The fluorescence-assisted mismatch analysis method used here has proved particularly well suited for mRNA scanning of heterozygous carrier animals, because of its ability to detect mutations even in the presence of an excess of wild-type mRNA. The three new underlying mutations identified at the Atp7a locus include a splice mutation and two missense mutations. While the spectrum of mutations detected in the Atp7a murine gene provides an explanation for at least part of the wide phenotypic variation observed in mottled mutant mice, there is a singular absence of deletions which are associated with a sizeable fraction of human Menkes syndrome cases.
Copper homeostasis in mammals is a highly complex process, involving the control of both copper uptake and efflux (1 ,2 ). To date, two membrane P-type Cu2+-transport ATPases participating in this process have been identified. One is the product of the Wilson disease gene (WD; ATP7B) (3 ,4 ), the other the product of the Menkes disease gene (MNK; ATP7A) (5 -7 ). Mutations in the MNK gene cause a rare but severe X-linked metabolic disease, Menkes syndrome (8 ), and a milder viable form of the disease, the occipital horn syndrome (OHS) (9 ). The symptoms of the disease manifest themselves at birth, through neurological degeneration and associated mental retardation, hair depigmentation and arterial and bone lesions. The MNK gene is transcribed as a 8.5 kb mRNA containing 4 kb of 3'-untranslated region (10 ,11 ), which translates into a protein containing 1500 amino acids. This protein, recently shown to have a role in transmembrane copper efflux (12 ), shares a high degree of homology with known bacterial and yeast heavy metal transporters (13 ,14 ), as well as with the protein encoded by the Wilson disease gene (3 ,15 ).
The mouse Mnk gene (16 ,17 ) has been shown to map to a region of the mouse X chromosome syntenic to Xq13.3 in man, where the human MNK gene localizes. The genomic structure of the mouse Atp7a (Mnk) gene is highly homologous to that of the human gene (18 ). The mottled locus in mice has been suggested to be associated with mutations in the Atp7a gene on the basis of phenotypic similarities to symptoms of MNK patients (20 -22 ). Some 20 independent alleles at the mottled locus have been identified (19 ,23 -32 , and L. Russell, personal communication). Ten of these mutations arose spontaneously, while 14 originated after [gamma]-irradiation, X-irradiation or chemical mutagenesis. The severity of the phenotype exhibited is influenced by the allele carried. The names given to the various mutant alleles at this locus: mottled (Atp7amo), pewter (Atp7amopew), mosaic (Atp7amoms),brindled (Atp7amobr), viable brindled (Atp7amovbr), blotchy (Atp7amoblo), tortoiseshell (Atp7amoto) and dappled (Atp7amodp), reflect the pattern of coat pigmentation seen in the heterozygous state. In the hemizygous state, the phenotype is always much more severe, although spontaneous mutations in males have been observed to have highly variable effects on viability. While Atp7amo and Atp7amoto are in utero male lethals, the time of death can vary from a few days after birth, as in the Atp7amoms and Atp7amobr mutants,to several months post-partumas in the case of Atp7amovbrand Atp7amoblo. Induced mutations on the other hand are almost always associated in males with in utero lethality. Indeed only a single induced mutation has been reported which is not male lethal in utero (30 ).
Two mutations at the mottled locus have been characterized to date. The first, a splice mutation in the blotchy mouse, Atp7amoblo (16 ,17 ,33 ), gives rise to two mRNA extra bands detectable by Northern analysis. The second, associated with an absence of Atp7a mRNA, occurs in the dappled mutant, Atp7amodp (16 ,17 ), although the precise mutation underlying the loss of transcript is still unknown.
Here we report the systematic analysis at the cDNA level of 10 independent mouse mottled mutants, aimed at detecting further mutations and correlating them with the spectrum of mutational changes identified in human MNK patients, and with the physiological function of the product of the Atp7a as a copper transporter.
Table 1 lists the mottled mutants characterized in this study. For the three spontaneous mutants, viability is normal for Atp7amoblo, reduced for Atp7amovbr, while Atp7amoXm is lethal in the hemizygous state. The other seven mutations studied were induced by either chemical treatment or irradiation. The origin of the mutants (see Materials and Methods) is indicated where known. Previously described length polymorphisms (18 ) associated respectively with a variation in the number of the 57 bp long repeat units in intron 8 and a duplication of the 34 bp repeat unit in the 3'-untranslated region (UTR) (exon 23) were used to identify the parental origin of the mutant chromosome in the Atp7amovbr, Atp7amo11H and Atp7amo1Pub strains. The difference in the number of repeat units in intron 8 allowed us to ascribe the origin of the Atp7amovbr mutation to the JU/Ct allele, and the Atp7amo11H and the Atp7amo1Pub mutations to the 101 chromosome (Table 1 ).
The in utero lethality of the majority of the mottled mutants in the hemizygous state suggests that the Cu-transporting protein plays an essential role during embryogenesis. This is in agreement with data from Northern blot analysis indicating not only that Atp7a is expressed in embryonic stem cells (ES cells), but that it can be detected from day 7 p.c. (post-coitum) onwards in the mouse embryo (data not shown).
All mutants were first characterized for possible differences in the levels of the Atp7a gene expression. The two viable mottled mutants were analysed as hemizygous males (Atp7amovbr and Atp7amoblo ). The eight male lethal mutants were analysed as F1 heterozygous females, where the normal allele in the F1 was of feral origin, being derived either from the Mus spretus SEG strain (Atp7amoXm , Atp7amo1Pub and Atp7amo7ENURF) or from Hprtbm-4Pgk1a (Atp7amo11H , Atp7amo2Acre, Atp7amo12DFiOD, Atp7amo32DFiOD and Atp7amo3MLPl), a mouse carrying an X chromosome containing the Pgk1a allele derived from a feral Mus musculus musculus stock (see Materials and Methods).
The relative level of expression of the presumed mutant allele was estimated in the heterozygous F1 animals by fluorescent RT-PCR analysis of region VI (Table 2 ). The 3' UTR portion of this region contains a 34 pb length polymorphism (18 ) between the short allele associated with feral-derived strains (SEG and Hprtbm-4Pgk1a) and the long allele associated with the laboratory strains 101 and C3H. Products corresponding to the polymorphic alleles were separated on an automated ABI 373A sequencer and quantified using the GENESCANT software after amplification with dye-labelled primers.
In animals from our control (C3HxHprtbm-4Pgk1a) or (101*SEG)F1 crosses, 60% of the total Atp7a mRNA was expressed by the feral-derived chromosomes, SEG and Hprtbm-4Pgk1a, and 40% by the laboratory strains 101 and C3H (data not shown), presumably due to non-random inactivation in such F1 progeny, which could be linked to the Xce locus (34 ).
Five of the eight mutants examined, Atp7amoXm, Atp7amo2Acre, Atp7amo32DFiOD, Atp7amo3MLPl and Atp7amo7ENURF, showed strongly reduced levels of Atp7a transcript associated with the mutant allele. Mutant mRNA in these animals constituted between 3 and 11% of total RNA (Table 1 ). No absolutely clear-cut effect on transcription was observed for the remaining two mutants, Atp7amo11H andAtp7amo1Pub, although a reduction in transcript levels (22%) compared with the control levels was noted in the case of Atp7amo11H. The mRNA ratio could not be estimated for the Atp7amo12DFiOD mutant, as the two alleles carried by this F1 animal had the short form of the mRNA, indicating a parental origin for the unknown mutated chromosome different from either 101 or C3H.
aEstimated from RT-PCR of region VI, see Materials and Methods. Percentages are the ratios of the mutant mRNA to total Atp7a mRNA. Note that transcripts from the 101 and C3H allele constitute ~40% of the total Atp7a RNA in both (C3H*Hprtbm-4Pgk1a)F1 and (101*SEG)F1 females, presumably due to non-random X chromosome inactivation (34). bND: not determined, because lacking the length polymorphism in region VI.cPhosphorylation.dPT: inbred mouse strain; T: mouse tester stock.eThis F1 does not carry the length polymorphism allowing the quantification.
. Primer sequences used for amplification of Atp7a cDNA regions
Region and primer
Sequence (5' -> 3')
Length (bp)
I
mo61
CCAGGAATGTAAAGACATCA
1300
mo817
GGTTAGTAGAGGATCAAATTC
moF153
mGGACCATTGAACAGCAGATTGGGA
994
moF1124
hGGCGGTACTTTCAACTTCACTTGC
II
mo355
GGATCTCAGCAAAAGAGCCC
1155
mo1496
ACAGGCTCACAAGGAAAGAC
moF968
mGAAAGTGCTTTATCTACACTCCAGT
945
moF1888
hGGATAATATCTCTGGGACCAATAATT
III
mo1199
TATGGTGATGGAAAACGCTG
1001
mo2697
CTGCCAGGTTTCTTAGCCA
moF1736
mGAAGGCAACGGCATCTTGGAACTTGT
939
moF2652
hGAGGGACTCGTCCACCATAGAAT
IV
mo2511
AAGCCACTATTGTAACTCTG
996
mo3488
TCAATTTGAACCAGGGATGC
moF2629
mGGATGGCCGTGTTATTGAAGGACA
776
moF3381
hAGCCTGGTACAACCTGGAAATCTG
V
mo3260
TCACGCAATAAGATCCTGG
992
mo4235
AGAGACAGATGAAGCGGC
moF3349
mGGAGCTGGACACTGAAACCCTG
864
moF4190
hGGGTTGTAAAACCAAACCGATGGG
VI
mo3892
TTCCCACAAAGTTGCTAAG
990
mo4860
AAAAATGATCTGCCATATAGCA
moF3930
mAGGGCAAACGTGTAGCAATGGTAG
906
moF4812
hAGAGCTTGTTCTAACTCACTGTTCT
Nomenclature of the primers refer to the nucleotide position of the cDNA sequence (accession number U03434), except from the underlined numbers which correspond to the mocD.1 cDNA sequence (18). Fluorescent primers are indicated by moF.
The presence of alternative transcripts in the mutants was also investigated. Northern analysis failed to reveal the presence of novel alternative transcripts for the mutants examined, except for Atp7amoblo. Two extra forms of Atp7a mRNA were detected in this mutant, confirming the results previously reported by Levinson et al. (16 ) and Mercer et al. (17 ).
In order to investigate the possibility that changes in mRNA levels in mottled mice were associated with either genomic rearrangements or distant changes in the DNA, exerting a position effect (35 ) on the Atp7a locus, we performed extensive pulsed-field gel electrophoresis (PFGE) and Southern analysis on those mutants showing decreased levels of Atp7a mRNA, for which no mutations in the Atp7a gene had been found at the cDNA level (see later). Blots were hybridized using probes detecting Xnp and Pgk1, genes immediately flanking the Atp7a locus. No genomic rearrangements could be detected in a region spanning >200 kb upstream and 100 kb downstream of the Atp7a locus. The same analysis performed on the rest of the mutants showed similar results, confirming and extending previous data of George et al. (32 ), obtained using a collection of nine mottled mutants that partially overlaps our present collection.
The viable spontaneous mutants Atp7amovbr and Atp7amoblo were examined in the hemizygous state. All other mutants were examined exclusively as heterozygous females. Anomalous RT-PCR amplification products were obtained for both the Atp7amo1Pub (Fig. 1 A), and Atp7amoblo mutants in addition to the normal size product, suggesting the presence of splice site mutations. Sequencing of PCR products amplified from cDNA of the heterozygous Atp7amo1Pub/SEG mouse, containing the normal SEG and the mutant Atp7amo1Pub alleles, revealed that in one copy of the gene the 135 bp long exon 14 was missing, causing skipping of the entire putative fifth transmembrane domain (TMD). Flanking introns were analysed to look for the mutation(s) responsible for this exon skipping. Sequencing of clones corresponding to intron 13 (209 bp), detected various intronic polymorphic base changes, also variant in the parental SEG and 101 strains. We conclude therefore that the mutation responsible for the skipping in Atp7amo1Pub was not present in this intron. Given the large size of intron 14 (>5 kb of as yet undetermined sequence), vectorette-PCR was used to analyze the 5' portion of this intron (18 ). The only nucleotide change found in the first 200 bp of intron sequence was a G -> A transition at position +1 of the splice donor site (Fig. 1 B). A polymorphic insertion of 9 bp (AAACTTTTG) at intron position +46 in the 101 allele (Fig. 1 B) allowed us to confirm the parental origin of the chromosome carrying the Atp7amo1Pub mutation (Table 1 ).
In this study, mottled mutations were analysed directly at the mRNA level using both RT-PCR and the FAMA method. Mutations or low levels of transcript were found for nine out of the 10 mutants analysed. The identification of polymorphisms detected even at a ratio of mutant to normal transcription product below 1:10 (Fig. 2 ), provides validation of the use of the FAMA technique for the analysis of heterozygous mutations at the mRNA level and opens up the exploitation of such an approach in other clinical and experimental investigations.
Two missense mutations have been identified. The first, detected in the Atp7amo11Hallele (A1364D), is associated with the introduction of a positively charged amino acid into one of the hydrophobic transmembrane regions (Fig. 4 ), creating a difficulty in inserting this region into the cell membrane. A similar type of mutation (G727R) has been described for a MNK patient (37 ), where a missense mutation converting a hydrophobic amino acid to a hydrophilic one occurred in the second TMD. The second missense mutation (K1036T) was found in the Atp7amovbr mutant within the phosphorylation motif DKTGT (Fig. 4 ). This domain is highly conserved among several heavy metal-transporting P-type ATPases, from bacteria through yeast, to various eucaryotic species, including the Cu transporters in human, rat and rabbit (38 ,39 ). Since this mutation is partially male viable, a reduction in rather than abolition of function of the mutated transporter is suggested.
This study was based on 10 independent mouse mottled mutants, obtained from the Harwell and the Oak Ridge laboratories. Heterozygous mutants were identified by their `mottled' coat. Three are of spontaneous origin: Atp7amovbr, Atp7amoblo and Atp7amoXm, whereas seven were obtained by chemical treatment or irradiation: Atp7amo1Pub, Atp7amo7ENURF, Atp7amo11H, Atp7amo2Acre, Atp7amo12DFiOD, Atp7amo32DFiOD and Atp7amo3MLPl. In order to maintain the mutations in this form, interspecies F1 hybrids were obtained by mating the Atp7amo/+ female mutants (Atp7amo12DFiOD, Atp7amo32DFiOD, Atp7amo3MLPl, Atp7amo11H and Atp7amo2Acre) to the feral-derived SEG (M.spretus) or the inbred Hprtbm-4Pgk1a males. The latter is a strain obtained in our laboratory, derived from the 129 Hprtbm-4 strain and containing an X chromosome carrying a mutation in the Hprt locus along with a M.musculus musculus-derived region for the Pgk1a gene. The other mutations (Atp7amovbr, Atp7amoblo, Atp7amoXm, Atp7amo1Pub and Atp7amo7ENURF) were analysed directly on DNAs or frozen organs derived from the mutant mice.
Mouse genomic DNA was isolated from liver and spleen according to standard protocols and prepared in agarose plugs. Each plug was digested with the BssHII, EagI, NarI and SalI restriction enzymes, electrophoresed and blotted to Hybond N+ membranes (Amersham) for PFGE analysis. Probes corresponding to the 5' and 3' regions of the Atp7a cDNA were used. For Southern analysis, 20 [mu]g of genomic DNA were digested with the appropriate restriction enzymes, and high stringency hybridizations (18 ) were performed using probes corresponding to each of the six regions listed in Table 2 .
Kidney RNA was prepared according to the method described by Auffray et al. (49 ). Twenty [mu]g of total kidney RNA were analysed by Northern blot using standard procedures and clone mocD.1 as probe (18 ).
First strand cDNA was synthesized from 2 [mu]g of total RNA, using M-MLV reverse transcriptase (Gibco BRL), in a 20 [mu]l reaction volume. One [mu]l of cDNA was used for all PCR reactions with specific primers. PCR reactions were carried out as previously described (18 ).
To estimate the amount of Atp7a transcript derived from the mutant allele relatively to that derived from the normal allele, fluorescent RT-PCR was performed on region VI of the Atp7a cDNA, containing the 3' UTR length polymorphism. One [mu]l of cDNA was used for the RT-PCR reaction, using fluorescent primers moF3930 and moF4812 (Table 2 ), in a volume of 50 [mu]l, as previously described (18 ). PCR conditions were 30 repetitions of a 94oC 30 s, 58oC 30 s and a 72oC 1 min cycle, followed by a single 10 min elongation step at 72oC.
The relative amount of mutant transcripts was estimated from the fluorescence intensities, obtained using the GENESCANT software, of each strand of the short and the long PCR products of region VI. The mRNA ratio (Table 1 ) is expressed as the ratio of the long PCR product (mutant mRNA) to the total PCR product.
The protocol and the reagents used for the FAMA technique have been described (36 ,50 ,51 ). Briefly, 100 ng of cDNA of each mouse mutant were subjected to 30 cycles of PCR amplification in a 50 [mu]l reaction volume using external overlapping pairs of primers. One [mu]l of this reaction was then reamplified for 30 cycles in a total volume of 100 [mu]l using internal fluorescent primers (nested PCR) labelled with the fluorescent dyes 6-FAM and HEX for the forward and reverse primer, respectively.
In the case of the two viable hemizygous mutations, an equimolar amount of wild-type-derived nested PCR product (JU/Ct) was added to the nested PCR product of these two mutants. Oligonucleotides used for the external (mo) and internal (moF) PCR amplification are listed in Table 2 .
Mutation-containing as well as control PCR products were subcloned into pGEM-T Vector (Promega). Both strands were sequenced with specific primers using the dideoxy chain termination method (52 ) (Sequenase Version 2.0, USB, Amersham).
This paper is dedicated to M. Biasotto who died on July 17th, 1995. We thank Catherine Bazzalli, Elisabeth Verpy and Tommy Meo for their help and discussion. This work could not have been carried out without the generous help of Dr Liane Russell, who provided us with the mutants derived at Oak Ridge, and Bruce Cattanach, who provided the 11H mutant isolated at Harwell. This work was financially supported by a grant to P.A. from the Association Française contre les Myopathies (AFM) who also awarded a studentship to C.C.
1 Petris, M.J., Mercer, J.F.B., Culvenor, J.G., Lockhart, P., Gleeson, P.A. and Camakaris, J. (1996) Ligand-regulated transport of the Menkes copper P-type ATPase efflux pump from the Golgi apparatus to the plasma membrane: a novel mechanism of regulated trafficking. EMBO J., 15, 6084-6095.
2 Yamaguchi, Y., Heiny, M.E., Suzuki, M. and Gitlin, J.D. (1996) Biochemical characterization and intracellular localization of the Menkes disease protein. Proc. Natl Acad. Sci. USA, 93, 14030-14035.MEDLINE Abstract
3 Bull, P.C., Thomas, G.R., Rommens, J.M., Forbes, J.R. and Cox, D.W. (1993) The Wilson disease gene is a putative copper transporting P-type ATPase similar to the Menkes gene. Nature Genet., 5, 327-337.MEDLINE Abstract
4 Petrukhin, K., Fischer, S.G., Pirastu, M., Tanzi, R.E., Chernov, I., Devoto, M., Brzutowicz, L.M., Cayanis, E., Vitale, E., Russo, J.J., Matseoane, D., Boukhgalter, B., Wasco, W., Figus, A.L., Loudianos, J., Cao, A., Sternlieb, I., Evgrafov, O., Parano, E., Pavone, L., Warburton, D., Ott, J., Penchaszadeh, G.K., Scheinberg, I.H. and Gilliam, T.C. (1993) Mapping, cloning and genetic characterization of the region containing the Wilson disease gene. Nature Genet., 5, 338-343.MEDLINE Abstract
5 Chelly, J., Tümer, Z., Tonnesen, R., Petterson, A., Ishikawa-Brush, Y., Tommerup, N., Horn, N. and Monaco, A.P. (1993) Isolation of a candidate gene for Menkes disease that encodes a potential heavy metal binding protein. Nature Genet., 3, 14-19.MEDLINE Abstract
6 Mercer, J.F.B., Livingston, J., Hall, B., Paynter, J.A., Begy, C., Chandrasekharappa, S., Lockjart, P., Grimes, A., Bhave, M., Siemieniak, C. and Glover, T. (1993) Isolation of a partial candidate gene for Menkes disease by positional cloning. Nature Genet., 3, 20-25.
7 Vulpe, C., Levinson, B., Whitney, S., Packman, S. and Gitschier, J. (1993) Isolation of a candidate gene for Menkes disease and evidence that it encodes a copper-transporting ATPase. Nature Genet., 3, 7-13.MEDLINE Abstract
8 Menkes, J.H., Alter, M., Steigleder, G.K., Weakley, D.R. and Sung, J.H. (1962) A sex-linked recessive disorder with retardation of growth, peculiar hair and focal cerebral and cerebellar degeneration. Pediatrics, 29, 764-779.
9 Lazoff, S.G., Rybak, J.J., Parker, B.R. and Luzzatti, L. (1975) Skeletal dysplasia, occipital horns, diarrhoea and obstructive uropathy-a new hereditary syndrome. Birth Defects, 11, 71-74.MEDLINE Abstract
10 Tumer, Z., Vural, B., Tonnesen, T., Chelly, J., Monaco, A.P. and Horn, N. (1995) Characterization of the exon structure of the Menkes disease gene using vectorette PCR. Genomics, 26, 437-442.MEDLINE Abstract
11 Dierick, H.A., Ambrosini, L., Spencer, J., Glover, T.W. and Mercer, J.F.B. (1995) Molecular structure of the Menkes disease gene (ATP7A). Genomics, 28, 462-469.
12 Camakaris, J., Petris, M.J., Bailey, L., Shen, P., Lockhart, P., Glover, T.W., Barcroft, C.L., Patton, J. and Mercer, J.F.B. (1995) Gene amplification of the Menkes (MNK; ATP7A) P-type ATPase gene of CHO cells is associated with copper resistance and enhanced copper efflux. Hum. Mol. Genet., 4, 2117-2123.
13 Silver, S., Nucifora, G. and Phung, L. T. (1993) Human Menkes X-chromosome disease and the staphylococcal cadmium-resistance ATPase: a remarkable similarity in protein sequences. Mol. Biol., 10, 7-12.
14 Dancis, A., Yuan, D.S., Haile, D., Askwith, C., Eide, D., Moehle, C., Kaplan, J. and Klausner, R.D. (1994) Molecular characterisation of a copper transport protein in S.cerevisiae: an unexpected role for copper in iron transport. Cell,76, 393-402.MEDLINE Abstract
15 Tanzi, R.E., Petrikhin, K., Chernov, I., Pellequer, J.L., Wasco, W., Ross, B., Romano, D.M., Parano, L., Pavone, L., Brzustowicz, L.M., Devoto, M., Peppercorn, J., Bush, A.I., Sternlieb, I., Pirastu, M.G.J.F., Evgrafov, O., Penchaszadeh,G. K., Honig, B., Edelman, I.S., Soares, M.B., Scheinberg, I.H. and Gilliam, T.C. (1993) The Wilson disease gene is a copper transporting ATPase with homology to the Menkes disease gene. Genetics,5, 344-350.
16 Levinson, B., Vulpe, C., Elder, B., Martin, C., Verley, F., Packman, S. and Gitschier, J. (1994) The mottled gene is the mouse homologue of the Menkes disease gene. Nature Genet., 6, 369-373.
17 Mercer, J.F.B., Grimes, A., Ambrosini, L., Lockhart, P., Paynter, J.A., Dierick, H. and Glover, T.W. (1994) Mutations in the murine homologue of the Menkes gene in dappled and blotchy mice. Nature Genet., 6, 374-378.
18 Cecchi, C. and Avner, P. (1996) Genomic organization of the mottled gene, the mouse homologue of the human Menkes disease gene. Genomics, 37, 96-104.MEDLINE Abstract
19 Fraser, A.S., Sobey S. and Spicer, C.C. (1953) Mottled, a sex-modified lethal in the house mouse. J. Genet.51, 217-221.
20 Hunt, D.M. (1974) Primary defect in copper transport underlies mottled mutants in the mouse. Nature, 249, 852-853.MEDLINE Abstract
21 Darwish, H.M., Hoke, J.E. and Ettinger, M.J. (1983) Kinetics of Cu(II) transport and accumulation by hepatocytes from copper-deficient mice and the brindled mouse model of Menkes disease. J. Biol. Chem., 258, 13621-13626.
22 Brown, R.M., Camakaris, J. and Danks, D.M. (1984) Observations of the Menkes' and Brindled mouse phenotypes in cell hybrids. Somat. Cell Mol. Genet., 10, 321-330.MEDLINE Abstract
23 Dickie, M.M. (1954) The tortoise shell house mouse. J. Hered., 45, 158-159.
32 George, A.M., Reed V., Glenister, P., Chelly, J., Tumer, Z., Horn, N., Monaco, A. P. and Boyd, Y. (1994) Analysis of MNK, the murine homologue of the locus for Menkes disease, in normal and mottled (Mo) mice. Genomics, 22, 27-35.
33 Das, S., Levinson, B., Vulpe, C., Whitney, S., Gitschier, J. and Packman, S. (1995) Similar splicing mutations of the Menkes/mottled copper-transporting ATPase gene in occipital horn syndrome and the blotchy mouse. Am. J. Hum. Genet., 56, 570-576.MEDLINE Abstract
34 Cattanach, B.M. and Williams, C.E. (1972) Evidence of non-random X-chromosome activity in the mouse. Genet. Res. Camb., 19, 229-240.
35 Bedell, M.A., Jenkins, N.A. and Copeland, N.G. (1996) Good genes in bad neighbourhoods. Nature Genet., 12, 229-232.MEDLINE Abstract
36 Verpy, E., Biasotto, M., Meo, T. and Tosi, M. (1994) Efficient detection of point mutations on color-coded strands of target DNA. Proc. Natl Acad. Sci. USA, 91, 1873-1877.MEDLINE Abstract
37 Das, S., Levinson, B., Whitney, S., Vulpe, C., Packman, S. and Gitschier, J. (1994) Diverse mutations in patients with Menkes disease often lead to exon skipping. Am. J. Hum. Genet., 55, 883-889.MEDLINE Abstract
38 Silver, S., Nucifora, G., Chu, L. and Misra, T.K. (1989) Bacterial resistance ATPases: primary pumps for exporting toxic cations and anions. Trends Biochem Sci., 14, 76-80.MEDLINE Abstract
39 Phung, L.T., Ajlani, G. and Haselkorn, R. (1994) P-type ATPase from the cyanobacterium Synechoccus 7942 related to the human Menkes and Wilson disease gene products. Proc. Natl Acad. Sci. USA, 91, 9651-9654.MEDLINE Abstract
40 Kaler, S.G., Gallo, L.K., Proud, V.K., Percy, A.K., Mark, Y., Segal, N.A., Goldstein, D.S., Holmes, C.S. and Gahl, W.A. (1994) Occipital horn syndrome and a mild Menkes phenotype associated with splice site mutations at the MNK locus. Nature Genet., 8, 195-202.MEDLINE Abstract
41 Petrukhin, K., Lutsenko, S., Chernov, I., Ross, B.M., Kaplan, J.H. and Gilliam, T.C. (1994) Characterization of the Wilson disease gene encoding a P-type copper transporting ATPase: genomic organization, alternative splicing and structure/function predictions. Hum. Mol. Genet., 3, 1647-1656.MEDLINE Abstract
42 Cattanach, B.M., Burtenshaw, M.D., Rasberry, C. and Evans, E.P. (1993) Large deletions and other gross forms of chromosome imbalance compatible with viability and fertility in the mouse. Nature Genet., 3, 56-61.MEDLINE Abstract
43 Cattanach, B.M., Rasberry, C., Evans, E.P., Dandolo, L., Simmler, M.C. and Avner, P. (1991) Genetic and molecular evidence of an X-chromosome deletion spanning the tabby (Ta) and testicular feminization (Tfm) loci in the mouse. Cytogenet. Cell. Genet., 56, 137-143.
44 Lichtenauer-Kaligis, E.G., Thijssen, J.C., den Dulk, H., van de Putte, P., Giphart-Gassler, M. and Tasseron-de Jong, J.G. (1995) Spontaneous mutation spectrum in the hprt gene in human lymphoblastoid TK6 cells. Mutagenesis, 10, 137-143.MEDLINE Abstract
45 Tuchman, M. and Plante, R.J. (1995) Mutations and polymorphisms in the human ornithine transcarbamylase gene: mutation update addendum. Hum. Mutat., 5, 293-295.MEDLINE Abstract
46 Thomas, G.R., Forbes J.R., Roberts E.A., Walshe, J.M. and Cox, D.W. (1995) The Wilson disease gene: spectrum of mutations and their consequences. Nature Genet., 9, 210-217.MEDLINE Abstract
47 Waldenström, E., Lagerkvist, A., Dahlman, T., Westermark, K. and Landegren, U. (1996) Efficient detection of mutations in Wilson disease by manifold sequencing. Genomics, 37, 303-309.
48 Youil, R., Kemper, B.W. and Cotton, R.G. (1995) Screening for mutations by enzyme mismatch cleavage with T4 endonuclease VII. Proc. Natl Acad. Sci. USA, 92, 87-91.MEDLINE Abstract
49 Auffray, C. and Rougeon, F. (1980) Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur. J. Biochem.,107, 303-314.MEDLINE Abstract
50 Verpy, E., Biasotto, M., Brai, M., Misiano, G., Meo, T. and Tosi, M. (1996) Exhaustive mutation scanning by fluorescence-assisted mismatch analysis discloses new genotype-phenotype correlations in angioedema. Am. J. Hum. Genet., 59, 308-319.MEDLINE Abstract
51 Biasotto, M., Meo, T., Tosi, M. and Verpy, E. (1996) FAMA: fluorescence-assisted mismatch analysis by chemical cleavage. In Landegren U. (ed.), Laboratory Protocols for Mutation Detection. Oxford University Press, Oxford, pp. 54-60.
52 Reed, V. and Boyd, Y. (1997) Mutation analysis provides additional proof that mottled is the mouse homologue of Menkes disease. Hum. Mol. Genet. 6, 417-423.
*To whom correspondence should be addressed
-->
This page is maintained by OUP admin. Last updated Fri Feb 7 12:40:48 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
