Pituitary homeobox 2, a novel member of the bicoid-related family of homeobox genes, is a potential regulator of anterior structure formation
Pituitary homeobox 2, a novel member of the bicoid -related family of homeobox genes, is a potential regulator of anterior structure formationPhilip J. Gage1 and Sally A. Camper1,2,*
1Department of Human Genetics and 2Program in Cellular and Molecular Biology, University of Michigan Medical School, Ann Arbor, MI 48109-0618, USA
Received October 29, 1996;Revised and Accepted December 6, 1996
Genetic analysis of mouse mutants has demonstrated the importance of the homeobox genes Rpx, Lhx3 and Pit1 for anterior pituitary gland development. Pit1 mutations have also been identified in several human families with multiple pituitary hormone deficiencies. To identify additional homeobox regulators of pituitary development, we screened an adult pituitary gland cDNA library for homeobox sequences. Here, we report the identification of a novel bicoid-related homeodomain gene expressing two alternatively spliced mRNA products, which encode proteins of 271 and 317 amino acids, respectively. The proteins have been named Ptx2a and Ptx2b since they are highly related to Ptx1/P-OTX. Ptx2 is expressed in both developing and adult pituitary gland, eye and brain tissues, suggesting an important role in development and maintenance of anterior structures. Ptx2 was mapped close to Egf on mouse chromosome 3, in a region having extensive synteny homology with HSA 4q. These data make the human Ptx2 homologue a candidate gene for Rieger syndrome, an autosomal-dominant disorder with variable craniofacial, dental, eye and pituitary anomalies.
Remarkable progress has been made in recent years towards identifying the genes regulating development and placing them into genetic hierarchies. A fundamental tenet to emerge from this work is the central role mediated by homeobox genes, which encode transcription factors that bind to cognate DNA sequences through their conserved homeodomain regions (1 ). In Drosophila, mouse and man, the clustered Hox genes are expressed in overlapping patterns that impose a Hox code which specifies regional and positional identity within the hind brain and trunk regions of the developing embryo (2 ). However, genes within the Hox clusters are not expressed anterior to the hind brain (1 ). A small number of non-clustered homeodomain genes with more anterior expression patterns have now been described, including the Drosophila genes Distalless (3 ), orthodenticle (4 ), and empty spiracles (5 ) and their vertebrate homologues Dlx1 and -2 (6 -9 ), Otx1 and -2 (10 ,11 ), and Emx1 and -2 (11 ). Like other homeobox genes, these genes exhibit overlapping but regionally-specific gene expression that likely conveys positional information during the development of anterior head structures (12 ). The ongoing identification and analysis of novel homeobox genes with anterior expression patterns is crucial for understanding the basic units of organization of the mammalian brain and face.
The central role of homeobox genes in development makes them excellent candidate genes for growth and birth defects. Already, mutations in several homeobox genes have been identified as the molecular defects in several human anomalies, including PAX2 (renal-coloboma syndrome), PAX3 (Waardenberg syndrome type I), PAX6 (aniridia), MSX1 (selective tooth agenesis), MSX2 (craniostynostosis), HOXD13 (limb deformities), and PIT1 (hypopituitarism and combined hormone deficiencies) (13 -21 ). Several of these genes were initially identified and characterized in the mouse (22 ,23 ).
The peptide WFQNRR, within helix 3 of the homeodomain, is highly conserved within all homeodomain proteins (1 ). A degenerate antisense oligonucleotide primer encoding this peptide was designed and used together with a sense vector-specific primer in a PCR-based screen to clone novel homeobox-containing sequences from an adult mouse pituitary cDNA library in [lambda]gt11. Two independent clones were obtained which encode the 5' end of a novel homeobox gene. Phage clones containing additional cDNA sequence from this gene were purified from the library using a PCR-based screen with gene specific primers designed from the partial cDNA clones. Inserts from purified phage clones were subcloned into pBLUESCRIPT and their nucleotide sequences determined.
DNA sequence analysis of distinct phage clones revealed the existence of two cDNA isoforms for this putative pituitary transcription factor (Fig. 1 ). The isoforms, designated Ptx2a and Ptx2b, differ in two respects: the larger isoform, Ptx2b, includes a 138 bp insertion within the coding region that is not present in Ptx2a, and Ptx2a includes 18 nucleotides at the 5' end that are not present in Ptx2b. Analysis of genomic DNA demonstrated that the 138 bp insertion in Ptx2b results from the inclusion of a single alternatively spliced exon (data not shown). The presumed initiation codon for the two proteins is the first AUG from the 5' end of the mRNA. It matches the Kozak consensus sequence (33 ) well, with a G at both positions -3 and +4 relative to the A, and is immediately preceded by an inframe stop codon. The other two reading frames contain multiple stop codons. The proteins predicted by the nucleotide sequence of each cDNA isoform contain a homeodomain. The alternatively spliced exon results in a 46 amino acid insertion within the N-terminus of the protein encoded by Ptx2b. Thus, the two protein isoforms are 271 and 317 amino acids in length.
Comparison of the novel proteins with other proteins revealed a high degree of similarity to the recently described mouse pituitary transcription factor, Ptx1 (gene symbol: Pitx1, also known as P-OTX) (34 ,35 ). This similarity was the basis for naming the 271 and 317 amino acid protein isoforms Ptx2a and Ptx2b, respectively (gene symbol: Pitx2). The Ptx2 homeodomain is 97% identical to the homeodomain of Ptx1, differing by only two substitutions (Fig. 2 ). The similarity with Ptx1 extends beyond the homeodomain to the respective C-termini of the proteins, where there is 67% overall identity (Fig. 2 B). N-terminal to the homeodomain there is no identity with Ptx1 or any other proteins in the database. Further DNA sequence comparisons by BLAST analysis (36 ) using the non-repetitive and DBEST databases (11/26/96) revealed one unpublished mouse EST that represents a partial clone of Ptx2b and several unpublished human ESTs that probably represent human Ptx2 homologues.
RNA was isolated from Rathke's pouch at embryonic day 13.5 (e13.5), adult pituitary gland and pituitary cell lines representing prethyrotropes ([alpha]TSH), pregonadotropes ([alpha]T3-1), somatomammotropes (GH3 and GH4), and corticotropes (AtT20). Using primers that bracket the alternatively spliced exon (Fig. 1 ), Ptx2 expression in these tissues was assessed by RT-PCR. Ptx2 was expressed within the nascent pituitary gland by e13.5 and in the adult pituitary gland (Fig. 3 ). Ptx2 was also expressed in the [alpha]TSH, [alpha]T3-1, GH3 and GH4 cell lines. No Ptx2 transcripts were detected in the corticotrope (AtT20) cell line (Fig. 3 ). The lack of Ptx2 expression in the AtT20 cell line confirmed the specificity of the RT-PCR assay since Ptx1 is highly expressed in these cells (34 ). Generally, the 388 and 526 bp products specific for mRNA isoforms A and B were detected in each tissue or cell line where Ptx2 is expressed. All of the cell lines used are derived from mouse except the GH3 and GH4 cell lines which are derived from rat (41 ). Therefore, the reduced signal in the GH3 and GH4 cells could result from less efficient amplification due to divergence of the mouse and rat Ptx2 sequences. No products were observed when reverse transcriptase was omitted from the first-strand synthesis reactions or when PCR amplifications were programmed with genomic DNA (data not shown). Detection of the hypoxanthine phophoribosyl transferase (Hprt) gene product was used as a positive control for all samples except GH3 and GH4, which apparently do not express Hprt (Fig. 3 ). For these, detection of c-abl (Fig. 3 ) or Pit1 (data not shown) transcripts served as positive controls. These data demonstrate that Ptx2 expression is activated early in pituitary development and that expression is maintained in the adult pituitary gland. Expression within the anterior pituitary gland is specific to cell lines representing the thyrotrope, gonadotrope and somatotrope lineages, suggesting that Ptx2 may be important for differentiation or maintenance of these anterior pituitary cell types.
The breadth of Ptx2 expression within a panel of adult tissues was assessed by both RT-PCR and Northern analysis. In addition to the adult pituitary gland, Ptx2 expression was observed by RT-PCR in adult brain, eye, kidney, lung, testis and tongue (Fig. 4 , left panel). Both mRNA isoforms were detected wherever Ptx2 was expressed. The smaller 388 bp product derived from isoform A was generally more abundant than the 526 bp product derived from isoform B (Figs 3 and 4 ). Northern analysis of adult tissues confirmed the presence of Ptx2 transcripts in brain, kidney, lung, testis and skeletal muscle (Fig. 4 , right panel). Eye tissue was not examined by Northern blot analysis. No Ptx2 expression was observed in the adrenal gland, liver, ovary or pancreas by either assay (Fig. 4 ). Transcripts of 2.0 and 2.15 kb were observed in brain, lung, skeletal muscle, kidney and testis (Fig. 4 , right panel), which correlate well with the sizes predicted from the cloned 1.8 and 1.9 kb cDNA isoforms with ~200 nucleotides of poly A sequences (Fig. 1 ). A third transcript of ~2.55 kb was detected in kidney and skeletal muscle and a fourth form of 1.65 kb was present in testis (Fig. 4 , right panel). While we cannot exclude cross-hybridization with related sequences, the probe used does not contain the homeobox and the nucleotide sequence is not highly homologous to Ptx1. Thus, four distinct Ptx2 transcripts exist, and some transcripts are tissue specific.
The time-course of Ptx2 expression in embryonic head tissue was surveyed by RT-PCR. The Ptx2 transcripts were detected as early as e8.5 and continued through postnatal day 0.5 (Fig. 5 ). Both isoforms A and B were detected at all time points examined. Thus, Ptx2 is activated early, when critical developmental decisions contributing to determination of body plan and organogenesis are being made.
A single-strand conformational polymorphism between C57BL/6J and M.spretus was identified after PCR amplification of a 235 bp product from genomic DNA using primers specific for the Ptx2 3'-UTR (Fig. 1 ). Primer sites were selected within the 3'-UTR to avoid cross reactivity with any other gene, including Ptx1. A well-characterized interspecific backcross panel from Jackson Laboratories, (C57BL/6J * M.spretus) F1 * M.spretus, was used to map Ptx2 within the mouse genome. This panel contains 94 backcross animals plus parental controls (42 ). Haplotype analysis placed Ptx2 on the distal half of mouse chromosome 3 (Fig. 6 ). Ptx2 does not introduce any double crossovers into the data. Complete haplotype data for this cross are available electronically at http://www.jax.org/resources/documents/cmdata. Within this cross, the following gene order and distances were observed: Rch1-3.2+-1.8-Glclr-4.3+-2.1-Ptx2-8.5+-2.9-D3Mit16-4.3+-2.1-Ddit1. Integration of this data into the consensus map for MMU 3 (43 ) allows for estimation of Ptx2 position relative to other loci not typed on this cross. This places Ptx2 very near Egf, within a region that contains Lef1 (44 ), Nfkb1 (45 ), and Adh1 (46 ) (Fig. 6 ). These four genes each map to human chromosome 4q, defining a region of synteny homology between MMU 3 and HSA 4q. Thus, we predict that the human Ptx2 homologue will be located on HSA 4q.
We report the isolation and initial characterization of a novel murine bicoid-related homeobox gene that is expressed in the fetal and adult pituitary gland. This gene has been named Ptx2 due to the close relationship of its homeodomain (97% identity) and C-terminus (67% identity) with the recently described pituitary homeodomain transcription factor, Ptx1 (34 ,35 ). Ptx1 and the two Ptx2 isoforms define a new subfamily of bicoid-related homeodomain proteins. Coexpression of Ptx1 and Ptx2 in fetal and adult pituitary gland suggests that members of this gene family may have complementary functions in the development and function of this tissue, similar to the central role mediated by Pax2 and Pax6 in eye development (23 ). Ptx2 is expressed in the thyrotrope, gonadotrope and somatotrope lactotrope cell lineages, but not in corticotropes where Ptx1 is expressed (34 ). Ptx1 activates Pomc transcription and may be required for Pomc expression in corticotropes (Pomc encodes the peptide from which ACTH is cleaved in corticotropes) (47 -49 ).
Ptx2 may be determinative for one or more of the anterior pituitary cell types. Alternatively, Ptx2 may function by acting in concert with other transcription factors such as Pit-1 (50 ,51 ). Pit-1 is necessary but insufficient for specifying the unique identities of thyrotropes, somatotropes and lactotropes (51 ). Interestingly, the minimal promoters required for tissue-specific expression of the Gh (52 ) and Prl (52 ) promoters in somatotropes and lactotropes, respectively, each contain bicoid-like DNA sequences. In addition, a bicoid-like target sequence is present in the minimal cell-specific promoter required for expression of the [alpha]-subunit gene in thyrotropes and gonadotropes (53 ). Each of these promoters can be synergistically transactivated by Pit-1 and Ptx1 in heterologous cells (35 ). However, Ptx1 expression has only been demonstrated in the corticotropes of the pituitary gland (34 ). The expression of Ptx2 in these cell types suggests that Ptx2 isoforms may be the true partners of Pit-1 in tissue-specific activation of these promoters. Thus, the expression of Ptx1, Ptx2, Pit1 and other genes in unique combinations may exert a combinatorial code that regulates the ontogeny of the different anterior pituitary cell types.
Comparison of Ptx1 and Ptx2 reveals regions that are highly conserved as well as several significant differences in the proteins and the expression patterns of the genes. Sequence conservation within portions of the respective C-termini suggests that these regions have similar functions, such as interacting with related proteins. Both C-termini are enriched in proline, serine and threonine, consistent with a transcription activation function. However, the Ptx2 proteins and Ptx1 are completely divergent within their N-termini. Moreover, Ptx2b differs from Ptx2a by the inclusion of 46 unique amino acids near its N-terminus. If the N-termini of each protein are involved in protein-protein interactions, then they are likely to interact with quite distinct sets of accessory proteins. Finally, Ptx2 is expressed in the adult brain, eye, kidney, lung, testis and tongue. Ptx1 transcripts are specific for the adult pituitary gland and intestine (34 ), and embryonic expression data suggest that Ptx1 is not expressed in several tissues that exhibit strong Ptx2 expression, including the eye and the brain (35 ). Thus, Ptx2 and Ptx1 appear to have distinct but overlapping expression patterns.
Ptx2 expresses distinct mRNA isoforms by virtue of alternative mRNA splicing. In addition, Northern analysis suggests that four sizes of transcripts are expressed in some tissues. The developmental and functional significance of alternative splicing of the Ptx2 transcript remains to be determined. Distinct protein isoforms may interact with distinct protein partners or have different DNA binding affinity for homeodomain target sequences.
The bicoid-related family of homeobox genes includes the Drosophila genes orthodenticle (otd), vertebrate homologues, Otx1 and Otx2, and the vertebrate genes goosecoid (gsc) and Ptx1 (4 ,10 ,11 ,34 ,35 ,54 ). Each gene has an anterior expression pattern, and mutation analyses in fly and mouse have demonstrated that bicoid-related homeobox genes are generally required for anterior structure formation (12 ). In this regard, it is interesting to note that the localization of Ptx2 on mouse Chr 3 in a region of extensive synteny homology with human Chr 4q predicts that the human homologue to Ptx2 will map very near EGF on HSA 4q. Rieger syndrome has recently been fine mapped to this location in some pedigrees (55 ). Rieger syndrome is an autosomal dominant condition with variable manifestations (56 ) and locus heterogeneity (57 ). The predominant feature is a heterogeneous eye malformation, anterior chamber dysgenesis (58 ). However, patients may also exhibit dental abnormalities, mental retardation and pituitary alterations (56 ). The documentation of pituitary growth hormone insufficiency in a subset of affecteds (56 ) is particularly interesting in light of the hypothesized role for Ptx2 in activation of the Gh gene. RT-PCR (Fig. 4 ) and preliminary in situ hybridization (data not shown) demonstrate Ptx2 expression in the adult eye. The correlation of the Ptx2 expression pattern in the mouse with the human patient abnormalities in brain, eye and pituitary gland augments the genetic mapping data that implicate PTX2 as a candidate gene for Rieger syndrome.
The homeobox gene Ptx2 has been identified as a potential developmental regulator of the anterior pituitary gland and other anterior structures. Ultimately, generation of a targeted disruption mutation will be required to determine the role of Ptx2 in pituitary development and to assess its interaction, if any, with the other homeobox genes, Rpx, Lhx3, Ptx1 and Pit1, in establishing the positional identity of precursors to the five major anterior pituitary cell types.
CD-1 mice (Charles River; Wilmington, MA) were used for the isolation of all adult and fetal tissues. The timed pregnancies were based on the presence of a copulation plug and designated as embryonic day 0.5 (e0.5).
These experiments were approved by the University of Michigan Committee on Use and Care of Animals (AAALAC accredited, Animal Welfare Assistance no. A3114-01) and all mice were housed and cared for according to NIH guidelines.
A [lambda]gt11 adult pituitary cDNA library containing 1 * 106 recombinants was obtained as a gift from J. Hoeffler (Invitrogen, San Diego, CA). DNA from 3 * 106 plaques was isolated by the rapid plate lysate method (59 ) and screened for homeodomain sequences by vector-insert PCR. Primers used were a [lambda]gt11 sense primer (5'-GATCGCGGCCGCGGTGGCGACGACTCCTGGAGCCCG) and a degenerate antisense primer (5'-CTAGGCGGCCGCGCICKICKRTTYTGRAACCA) (IUPAC code, I = inosine) targeted at the coding sequence for the highly conserved peptide, WFQNRRA, within helix 3 of the homeodomain (Fig. 1 ). Amplification reactions contained 10 mM Tris-HCl pH 8.3, 50 mM KCl, 2 mM MgCl2, 0.001% (wt/vol) gelatin, 0.2 mM each dNTP, 0.5 mM of each primer (University of Michigan DNA Synthesis Facility), 1-200 ng of isolated [lambda] library genomic DNA as template and 1-2 U Taq DNA polymerase. Products were amplified during 30 cycles of 94oC/1 min, 50oC/2 min and 72oC/2-3 min (2 s extension/cycle). Phenol-extracted reaction products were ligated into pBLUESCRIPT KS- (Stratagene) at the EcoRV site which had been modified by the T-tailed method (60 ). Inserts of resulting transformants were sequenced and those containing homeobox sequences were identified using BLASTN (36 ).
The nucleotide sequence from the initial clone was used to generate Ptx2-specific primers (5'-GATCCCCGCAGTTCCACCCAGAC and 5'-ACCCGGACTCGGGCTTCCGTAAGG, Fig. 1 ) for use in purifying Ptx2 phage clones from the adult pituitary cDNA library. Inserts from purified clones were subcloned into pBLUESCRIPT KS- as EcoRI fragments and resulting inserts were sequenced using both vector and Ptx2 specific primers. Multiple isolates of each clone were sequenced in both directions. Phage DNA was also sequenced across the EcoRI sites. Sequence files were assembled into complete cDNAs using AssemblyLIGN (Eastman Kodak, Rochester, NY).
Pituitary cell lines were obtained from P. Mellon ([alpha]TSH, [alpha]T3-1) (UCSD, San Diego, CA) and A. Seasholtz (GH3, GH4, AtT20) (University of Michigan, Ann Arbor, MI). Cells were grown according to the recommended conditions (41 ,61 -63 ). RNA was isolated in Trizol as specified by the manufacturer (Gibco/BRL, Bethesda, MD).
Tissues were isolated and frozen on dry ice prior to storage. Embryos were removed from pregnant mothers and dissected free from extra embryonic tissues prior to decapitation. RNA was isolated in Trizol as specified by the manufacturer (Gibco/BRL, Bethesda, MD). First strand cDNA synthesis reactions were performed on 1-2 [mu]g total RNA using Superscript II reverse transcriptase (Gibco/BRL, Bethesda, MD) as described by the manufacturer. Reactions containing no reverse transcriptase (RT-) served as negative controls. Amplification reactions were performed as above, except they were programmed with 1/10 volume of first strand synthesis reactions, with or without reverse transcriptase. For each gene, primers sets were designed to amplify across introns to ensure that no product would be detected in amplifications programmed with RT- control reactions. Ptx2 primers used were as noted above. Hprt (5'-gctggtgaaaaggacctct, sense; CACAGGACTAGAACACCTGC, antisense) and Abl (5'-TTTATGGGGCAGCAGCCTGGAAAAGTACTTCGG, sense; 5'-TCACTG- GGTCCAGCGAGAAGGTTTTCCTTGGAGTT) were designed from published sequences (64 ).
A Northern blot filter was purchased from CLONTECH Laboratories, Inc. (Palo Alto, CA and probed with a 32P-labeled EcoRI fragment from Ptx2 (Fig. 1 ). After washing to high stringency, the filter was placed on a Phosphor screen (Molecular Dynamics) for 2.5 days.
The BSS interspecific backcross panel, (C57BL/6J * Spret/Ei) F1 * Spret/Ei, was purchased from Jackson Laboratories (Bar Harbor, ME). A 235 bp segment of the Ptx2 3'-UTR was amplified with the following primers: 5'-TGTCGGAGTGGGCAACTCTG, forward; 5'-cagagttgcccactccgaca, reverse. Primers were end-labeled with 32P as described previously (59 ). Products were amplified for 30 cycles (94oC/30 s, 60oC/30 s, 72oC/1 min), denatured, and fractionated by electrophoresis through 6% MDE polyacrylamide gels at room temperature (FCM BioProducts, Rockland, ME; Stock no. 50620). Bands were visualized by autoradiography. The Ptx2 genotypes for 94 backcross progeny were submitted to The Jackson Laboratories for interpretation.
We thank Thomas Glaser and Jacques Drouin for helpful discussions, Pamela Mellon and Audrey Seasholtz for providing pituitary cell lines, the Cell Biology Core Laboratory in the Department of Anatomy and Cell Biology for the use of their computer imaging equipment, and the University of Michigan DNA Sequencing Core Facility. This work was funded by the National Institutes of Health (HD30428 and HD34283, S.A.C.; DK0724518, P.J.G.).
1 Scott, M.P., Tamkun J.W. and Hartzell I., G. W. (1989) The structure and function of the homeodomain. Biochem. Biophys. Acta, 989, 25-48.
2 McGinnis, W. and Krumlauf R. (1992) Homeobox genes and axial patterning. Cell, 68, 283-302.MEDLINE Abstract
3 Cohen, S.M., Bronner G., Kuttner F., Jurgens G. and Jackle H. (1989) Distal-less encodes a homeodomain protein required for limb development in Drosophila. Nature, 338, 423-434.
4 Finkelstein, R., Smouse D., Capaci T.M., Spradling A.C. and Perrimon N. (1990) The orthodenticle gene encodes a novel homeodomain protein involved in the development of the Drosophila nervous system and ocellar visual structures. Genes Dev., 4, 1516-1527.MEDLINE Abstract
5 Dalton, D., Chadwick R. and McGinnis W. (1989) Expression and embryonic function of empty spiracles: a Drosophila homeobox gene with two patterning functions on the anterior-posterior axis of the embryo. Genes Dev., 3, 1940-1956.MEDLINE Abstract
6 Price, M., Lemaistre M., Pischetola M., DiLauro R. and Deboule D. (1991) A mouse gene related to Distal-less shows restricted expression in the developing forebrain. Nature, 351, 748-751.MEDLINE Abstract
7 Robinson, G.W., Wray S. and Mahon K.A. (1991) Spatially restricted expression of a member of a new family of murine Distal-less homeobox genes in the developing forebrain. New Biol., 3, 1183-1194.MEDLINE Abstract
8 Porteus, M.H., Bulfone A., Ciaranello R.D. and Rubenstein J.L.R. (1991) Isolation and characterization of a novel cDNA clone encoding a homeodomain that is developmentally regulated in the ventral forebrain. Neuron, 7, 221-229.MEDLINE Abstract
9 Simeone, A., Acampora D., Pannese M., D'Esposito M., Stornaiuolo A., Gulisano M., Mallamaci A., Kastury K., Druck T., Huebner K. and Boncinelli E. (1994) Cloning and characterization of two members of the vertebrate Dlx gene family. Proc. Natl. Acad. Sci. USA, 91, 2250-2254.MEDLINE Abstract
10 Simeone, A., Acampora D., Mallamaci A., Stornaiuolo A., D'Apice M.R., Migro V. and Boncinelli E. (1993) A vertebrate gene related to orthodenticle contains a homeodomain of the bicoid class and demarcates anterior neuroectoderm in gastrulating mouse embryo. EMBO J., 12, 2735-2747.
11 Simeone, A., Acampora D., Gulisano M., Stornaiuolo A. and Boncinelli E. (1992) Nested expression domains of four homeobox gene is in developing rostral brain. Nature, 385, 687-690.
12 Finkelstein, R. and Boncinelli E. (1994) From fly head to mammalian forebrain: the story of otd and Otx. Trends Genet., 10, 310-314.
13 Baldwin, C.T., Hoth C.F., Amos J.A., da-Silva E.O. and Milunsky A. (1992) An exonic mutation in the HuP2 paired domain gene causes Waardenburg's syndrome [see comments]. Nature, 355, 637-638.MEDLINE Abstract
14 Glaser, T., Walton D.S. and Maas R.L. (1992) Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nature Genet., 2, 232-238.MEDLINE Abstract
15 Morell, R., Friedman T.B. and Asher J.H., Jr. (1993) A plus-one frameshift mutation in PAX3 alters the entire deduced amino acid sequence of the paired box in a Waardenburg syndrome type 1 (WS1) family. Hum. Mol. Genet., 2, 1487-1488.
16 Tassabehji, M., Read A.P., Newton V.E., Harris R., Balling R., Gruss P. and Strachan T. (1992) Waardenburg's syndrome patients have mutations in the human homologue of the Pax-3 paired box gene [see comments]. Nature, 355, 635-636.MEDLINE Abstract
17 Vastardis, H., Karimbux N., Guthua S.W., Seidman J.G. and Seidman C.E. (1996) A human MSX1 homeodomain missense mutation causes selective tooth agenesis [see comments]. Nature Genet., 13, 417-421.MEDLINE Abstract
18 Jabs, E.W., Muller U., Li X., Ma L., Luo W., Haworth I.S., Klisak I., Sparkes R., Warman M.L., Mulliken J.B., et al. (1993) A mutation in the homeodomain of the human MSX2 gene in a family affected with autosomal dominant craniosynostosis. Cell, 75, 443-450.MEDLINE Abstract
19 Muragaki, Y., Mundlos S., Upton J. and Olsen B.R. (1996) Altered growth and branching patterns in synpolydactyly caused by mutations in HOXD13. Science, 272, 548-551.MEDLINE Abstract
20 Pfäffle, R.W., DiMattia G.E., Parks J.S., Brown M.R., Wit J.M., Jansen M., Van der Nat H., Van den Brande J.L., Rosenfeld M.G. and Ingraham H.A. (1992) Mutation of the POU-specific domain of Pit-1 and hypopituitarism without pituitary hypoplasia. Science, 257, 1118-1121.
21 Radovick, S., Nations M., Du Y., Berg L.A., Weintraub B.D. and Wondisford F.E. (1992) A mutation in the POU-Homeodomain of Pit-1 responsible for combined pituitary hormone deficiency. Science, 257, 1115-1117.MEDLINE Abstract
22 Meisler, M.H. (1996) The role of the laboratory mouse in the human genome project. Am. J. Hum. Genet., 59, 764-771.MEDLINE Abstract
23 Freund, C., Horsford D.J. and McInnes R.R. (1996) Transcription factor genes and the developing eye: a genetic perspective. Hum. Mol. Genet., 5, 1471-1488.MEDLINE Abstract
24 Kaufman, M.H. (1992) The Atlas of Mouse Development. Acadamic Press, San Diego.
25 Simmons, D.M., Voss J.W., Ingraham H.A., Holloway J.M., Broide R.S., Rosenfeld M.G. and Swanson L.W. (1990) Pituitary cell phenotypes involve cell-specific Pit-1 mRNA translation and synergistic interactions with other classes of transcription factors. Genes Dev., 4, 695-711.MEDLINE Abstract
26 Japon, M.A., Rubinstein M. and Low M.J. (1994) In situ hybridization analysis of anterior pituitary hormone gene expression during fetal mouse development. J. Histochem. Cytochem., 42, 1117-1125.MEDLINE Abstract
27 Gage, P.J., Brinkmeier M.L., Scarlett L.M., Knapp L.T., Camper S.A. and Mahon K.A. (1996) The Ames dwarf gene, df, is required early in pituitary ontogeny for the extinction of Rpx transcription and initiation of lineage specific cell proliferation. Mol. Endocrinol., 10, 1570-1581.MEDLINE Abstract
28 Hermesz, E., Mackem S. and Mahon K.A. (1996) Rpx: A novel anterior-restricted homeobox gene progressively activated in the prechordal plate, anterior neural plate, and Rathke's pouch of the mouse embryo. Development, 122, 41-52.
29 Sheng, H.Z., Zhadanov A.B., Mosinger B., Fujii T., Bertuzzi S., Grinberg A., Lee E.J., Huang S.-P., Mahon K.A. and Westphal H. (1996) The LIM-homeobox gene Lhx3 is essential for the specification and proliferation of pituitary cell lineages. Science, 272, 1004-1007.MEDLINE Abstract
30 Camper, S.A., Saunders T.L., Katz R.W. and Reeves R.H. (1990) The Pit-1 transcription factor gene is a candidate for the Snell dwarf mutation. Genomics, 8, 586-590.MEDLINE Abstract
31 Li, S., Crenshaw E.B., III, Rawson E.J., Simmons D.M., Swanson L.W. and Rosenfeld M.G. (1990) Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU-domain gene Pit-1. Nature, 347, 528-533.
32 Cohen, L.E., Wondisford F.E., Salvatoni A., Maghnie M., Brucker-Davis F., Weintraub B.D. and Radovick S. (1995) A `hot spot' in the Pit-1 gene responsible for combined pituitary hormone deficiency: Clinical and molecular correlates. J. Clin. Endocrinol. Metab., 80, 679-684.MEDLINE Abstract
33 Kozak, M. (1991) Structural features in eukaryotic mRNAs that modulate the initiation of transcription. J. Biol. Chem., 266, 19867-19870.MEDLINE Abstract
34 Lamonerie, T., Tremblay J.J., Lanctot C., Therrien M., Gauthier Y. and Drouin J. (1996) Ptx1: a bicoid-related homeo box transcription factor involved in the transcription of the pro-opiomelanocortin gene. Genes Dev., 10, 1284-1295.MEDLINE Abstract
35 Szeto, D.P., Ryan A.K., O'Connell S.M. and Rosenfeld M.G. (1996) P-OTX: a Pit-1-interacting homeodomain factor expressed during anterior pituitary gland development. Proc. Natl. Acad. Sci. USA, 93, 7706-7710.MEDLINE Abstract
36 Altschul, S., Gish W., Miller W., Myers E. and Lipman D. (1990) Basic local alignment search tool. J. Mol. Biol., 215, 403-410.MEDLINE Abstract
37 Deboule, D. (1994) Guidebook to the homeobox genes. Oxford University Press, Oxford, UK.
38 Hanes, S.D. and Brent R. (1989) DNA specificity of the bicoid activator protein is determined by homeodomain recognition helix residue 9. Cell, 57, 1275-1283.MEDLINE Abstract
39 Gehring, W.J., Qian Y.Q., Billeter M., Furukubo-Tokunaga K., Schier A.F., Resendez-Perez D., Affolter M., Otting G. and Wüthrich K. (1994) Homeodomain-DNA recognition. Cell, 78, 211-223.MEDLINE Abstract
40 Calkhoven, C.F. and Ab G. (1996) Multiple steps in the regulation of transcription-factor level and activity. Biochem. J., 317, 329-342.MEDLINE Abstract
41 Tashjian, A.H., Yasumura Y., Levine L., Sato G.H. and Parker M.L. (1968) Establishment of clonal strains of rat pituitary tumor cells that secrete growth hormone. Endocrinology, 82, 342-352.MEDLINE Abstract
42 Rowe, L.B., Nadeau J.H., Turner R., Frankel W.N., Letts V.A., Eppig J.T., Ko M.S.H., Thurston S.J. and Birkenmeier E.H. (1994) Maps from two interspecific backcross DNA panels available as a community genetic mapping resource. Mammalian Genome, 5, 253-274.MEDLINE Abstract
43 Wakeland, E.K. and Seldin M.F. (1996) Mouse chromosome 3. Mammalian Genome, 6, S64-S72.MEDLINE Abstract
44 Milatovich, A., Travis A., Grosschedl R. and Franke U. (1991) Gene for lymphoid enhancer-binding factor 1 (LEF1) mapped to human chromosome 4 (q23-q25) and mouse chromosome 3 near Egf. Genomics, 11, 1040-1048.
45 Morton, C., Bell G. and Shows T. (1985) Epidermal growth factor (EGF) is located at q25-q27 on human chromosome 4. Cytogenet. Cell Genet., 40, 702-703.
46 Smith, M., Duester G., Carlock L. and Wasmuth J. (1985) Assignment of ADH1, ADH2 and ADH3 genes (class I ADH) to human chromosome 4q21-4q25. Cytogenet. Cell Genet., 40, 748.
47 Tremblay, Y., Tretjakoff I., Peterson A., Antakly T., Zhang C.X. and Drouin J. (1988) Pituitary-specific expression and glucocorticoid regulation of proopoimelanocortin fusion gene in transgenic mice. Proc. Natl. Acad. Sci., 85, 8890-8894.MEDLINE Abstract
48 Therrien, M. and Drouin J. (1991) Pituitary pro-opiomelanocortin gene expression requires synergistic interactions of several regulatory elements. Mol. Cell. Biol., 11, 3492-3503.MEDLINE Abstract
49 Therrien, M. and Drouin J. (1993) Cell-specific helix-loop-helix factor required for pituitary expression of the pro-opiomelanocortin gene. Mol. Cell. Biol., 13, 2342-2353.MEDLINE Abstract
50 Krumlauf, R. (1993) Hox genes and pattern formation in the branchial region of the vertebrate head. Trends Genet., 9, 106-112.
52 Lira, S., Crenshaw E., Glass C., Swanson L. and Rosenfeld M. (1988) Identification of rat growth hormone genomic sequences targeting pituitary expression in transgenic mice. Proc. Natl. Acad. Sci. USA, 85, 4755-4759.MEDLINE Abstract
53 Kendall, S.K., Gordon D.F., Birkmeier T.S., Petrey D., Sarapura V.D., O'Shea K.S., Wood W.M., Lloyd R.V., Ridgway E.C. and Camper S.A. (1994) Enhancer-mediated high level expression of mouse pituitary glycoprotein hormone [alpha]-subunit transgene in thyrotropes, gonadotropes, and developing pituitary gland. Mol. Endocrinol., 8, 1420-1433.MEDLINE Abstract
54 Blum, M., Gaunt S., Cho K., Steinbeisser H., Bittner D., Blumberg B. and De Robertis E.M. (1992) Gastrulation in the mouse: the role of the homeobox gene goosecoid. Cell, 69, 1097-1106.MEDLINE Abstract
55 Murray, J.C. (1992) Linkage of Rieger syndrome to the region of the epidermal growth factor on chromosome 4. Nature Genet., 2, 46-49.MEDLINE Abstract
56 Feingold, M., Shiere F., Fogels H.R. and Donaldson D. (1969) Rieger's syndrome. Pediatrics, 44, 564.MEDLINE Abstract
57 Phillips, J.C., del Bono E.A., Haines J.L., Pralea A.M., Cohen J.S., Greff L.J. and Wiggs J.L. (1996) A second locus for Rieger syndrome maps to chromosome 13q14. Am. J. Hum. Genet., 59, 613-619.MEDLINE Abstract
58 Rieger, H. (1935) Bieträge zur Kenntnis seltener Missbindungen der Iris. Albrecht von Graefes Arch. Klin. Opthalmol., 133, 602.
59 Maniatis, T., Fritsch E.F. and Sambrook E.J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
60 Marchuk, D., Drumm M., Saulino A. and Collins F.S. (1991) Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res., 19, 1154.MEDLINE Abstract
61 Akerblom, I.E., Ridgway E. and Mellon P. (1990) An [alpha]-subunit-secreting cell line derived from a mouse thyrotrope tumor. Mol. Endocrinol., 4, 589-596.MEDLINE Abstract
62 Windle, J., Weiner R. and Mellon P. (1990) Cell lines of the pituitary gonadotrope lineage derived by targeted oncogenesis in transgenic mice. Mol. Endocrinol., 4, 597-603.MEDLINE Abstract
63 Gumbiner, B. and Kelly R. (1982) Two distinct intracellular pathways transport secretory and membrane glycoproteins to the surface of pituitary cells. Cell, 28, 51-59.MEDLINE Abstract
64 Wang, J., Ledley F., Goff S., Lee R., Groner Y. and Baltimore D. (1984) The mouse c-abl locus: molecular cloning and characterization. Cell, 36, 349-356.
The cloning and characterization of a novel human homeobox gene as a candidate for Rieger Syndrome has been recently described [Semina et al. (1996) Am. J. Hum. Genet., 59, A9 and Semina et al. (1996) Nature Genet.,14, 392-399].
*To whom correspondence should be addressed
-->
This page is maintained by OUP admin. Last updated Fri Feb 7 12:40:48 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
