Murine mucopolysaccharidosis type I: targeted disruption of the murine [alpha]-L-iduronidase gene
Murine mucopolysaccharidosis type I: targeted disruption of the murine [alpha]-L-iduronidase gene <underline><i> </i></underline>Lorne A. Clarke*, Christopher S. Russell, Scott Pownall1, Cara L. Warrington, Anita Borowski1, James E. Dimmick2, Jennifer Toone2 and Frank R. Jirik1
Department of Medical Genetics, University of British Columbia, The British Columbia Institute for Child and Family Health, 178-950 West 28th Avenue, Vancouver, British Columbia V5Z 4H4, Canada, 1Department of Medicine, University of British Columbia, The Biomedical Research Center and the Center for Molecular Medicine and Therapeutics, Vancouver, British Columbia, Canada and 2Department of Pathology, University of British Columbia, The British Columbia Children's Hospital, Vancouver, British Columbia, Canada
Received November 13, 1996;Revised and Accepted January 16, 1997
Mucopolysaccharidosis type I (MPS I) is considered to represent the prototypical mucopolysaccharide storage disorder. Although a spectrum of severity is seen within the MPS I subgroup, Hurler syndrome represents the most severe and frequent manifestation of MPS I. We describe here the generation of a murine model for Hurler syndrome by targeted disruption of the murine Idua gene. Homozygous Idua -/- mice have no detectable [alpha]-L-iduronidase enzyme activity and show increased urinary glycosaminoglycan levels. Although normal appearing at birth, Idua -/- mice develop a flattened facial profile and thickening of the digits discernible by 3 weeks of age. No obvious growth deficiency nor mortality is seen within the first 20 weeks of life. Radiographs reveal anterior flaring of the ribs and thickening of the facial bones as early as 4 weeks of age with more extensive dysostosis detectable by 15 weeks of age. At 4 weeks of age, lysosomal storage is noted primarily within reticuloendothelial cells with abundant lysosomes noted in Kupffer cells, splenic sinusoidal lining cells, and glial cells. More widespread lysosomal storage is noted by 8 weeks of age in hepatocytes, chondrocytes, neurons, as well as renal tubular cells. Thus, targeted disruption of the murine Idua locus has produced a murine strain representative of the severe form of MPS I. This model should permit detailed evaluation of the pathophysiology of lysosomal storage disorders and provide a small animal model for the testing and development of enzyme replacement and gene therapy regimes.
Deficiency of [alpha]-L-iduronidase (IDUA, mucopolysaccharide [alpha]-L-idurono-hydrolase; EC 3.2.1.76) underlies a group of autosomal recessive lysosomal storage disorders termed mucopolysaccharidosis type I (MPS I) (1 ). MPS I is considered to be the prototypical MPS disorder and represents the most common severe MPS subtype, occurring at a frequency of approximately 1/100 000 in most populations (2 ). The spectrum of clinical features in MPS I ranges from severe mental retardation with hepatosplenomegaly, dysostosis multiplex, corneal clouding, cardiac involvement and death in early childhood to milder symptoms consisting of corneal clouding, hearing loss, and mild visceral involvement with normal intelligence and life span. Hurler syndrome (MPS I H) represents the most common and severe manifestation of this enzyme deficiency with Scheie syndrome (MPS I S) representing the more mild form of the disease. Many patients follow an intermediate phenotype between that of Hurler and Scheie syndromes (3 ). The isolation and identification of human IDUA has led to the identification of mutations underlying MPS I in humans (4 ,5 ). Genotype/phenotype correlation exists for many of the mutations described (6 -8 ).
Although initially described in humans, deficiency of IDUA has also been noted in both a canine (9 ) and feline (10 ) model. The canine model has been extensively characterized and has been useful in testing the efficacy of direct enzyme replacement regimes (11 ,12 ). Unfortunately due to the size and life span of the animals, the canine model has limited the development and testing of novel and long term enzyme replacement regimes for MPS I. The development of a murine model for MPS I will thus serve as an important model system for the development of both enzyme replacement and gene therapy regimes for this disorder. The availability of a well characterized canine model will aid in the subsequent up-scaling of therapy prior to human application.
The murine Idua locus is unique in that it contains a gene, Sat-1,which is contained within and overlaps that of Idua (manuscript in preparation). Sat-1 represents a canalicular sulfate transporter recently characterized in rat hepatocytes (13 ). Therefore, selective disruption was required to produce the MPS I murine model. This paper describes the targeted disruption of murine Idua, the characterization of the resulting deficiency of iduronidase, and our initial characterization of the severe lysosomal pathology that results. In addition, we discuss our initial phenotypic observations in light of other animal models of MPS disorders. The availability of a small animal model for MPS I will be useful in providing a model to further advance the understanding of the pathophysiology of lysosomal storage disorders as well as allowing for the development of novel therapeutic strategies.
IDUA-deficient mice were generated by gene targeting in R1 murine embryo stem cells. Genomic fragments containing murine Idua were isolated and cloned into the vector Bluescript T. The genomic region surrounding IDUA was fully characterized prior to the construction of the targeting vector. This characterization included the complete sequencing of 15 kb of genomic sequence containing murine Idua (manuscript in preparation). Sequence analysis revealed the presence of an overlapping sulfate transport gene (13 ) contained within the Idua locus (Fig. 1 A). Beginning within Idua intron II lies murine Sat-1, which is transcribed from the opposite DNA strand and is completely contained within Idua. Exon II of Idua and part of Sat-1 exon III represent overlapping regions of cDNAs (manuscript in preparation). The overlapped region of these two genes is represented by a portion of the 3' UTR of Sat-1 and the entire coding region of Idua exon II. Due to the presence of the overlapping gene, we chose to disrupt Idua with the use of an interruption construct directed to a more distal exon. Idua exon VI was targeted using an interruption type construct rather than a deletion construct, primarily to minimize potential effects on Sat-1 expression. A targeting vector, containing both Pgk-Neo and Pgk-TK, was made with Idua exon VI interrupted by the neomycin resistance cassette (Fig. 1 A). A unique BstEII site within exon VI was used to introduce, by blunt-end cloning, the PGK-Neo cassette. After double drug selection, ES clones that had undergone homologous recombination were identified by PCR analysis, and confirmed by Southern blot (Fig. 1 B). The frequency of homologous recombination seen with this targeting construct was ~1:10 after double selection.
A single clone of ES cells that had undergone homologous recombination was microinjected into blastocysts and 10 chimeric mice were generated. Six of the chimeras demonstrated 90% chimerism by coat color and were bred further. Five chimeric males transmitted the mutated allele through the germline. Heterozygote offspring were identified by both PCR and Southern analysis of genomic DNA (Fig. 1 B). Heterozygotes exhibited a grossly normal phenotype and normal fertility. Genotyping 124 offspring from heterozygote crosses revealed the expected Mendelian ratios (+/+ 37/124, 29.8%; +/- 54/124, 43.5% and -/- 33/124, 26.6%) indicating no significant effect on embryo development.
Expression of both Idua and Sat-1 was analyzed in Idua +/+, +/- and -/- mice. Poly A+ RNA was isolated from liver and kidney of 4 week old mice. Due to the low level of Idua expression in tissues (4 ), RT-PCR was used to detect its expression. Approximately 200 ng of poly-A+ RNA was used as the template for first strand synthesis using a primer specific for Idua. This was then followed by PCR using Idua specific primers ID2 (exon II GTTGGGACCAGCAACTGAAC) and ID5 (exon VII ATAGGGGTATCCTTGAACTC). The expected PCR product size from the non-targeted allele is 680 bp. No specific Idua transcript was detected in liver (Fig. 2 A) or kidney (data not shown) from Idua -/- mice. The same RNA was used to detect Sat-1 expression.
Clinical observations. At birth and during the first 2-3 post-natal weeks there were no obvious distinguishing features between Idua -/- mice and their litter-mates. At ~4 weeks of age however, altered facial features as well as differences in the morphology of the paws were discernible. The facial characteristics noted were similar to those seen in patients with severe MPS I. There was broadness to the face with a loss of the fine tapered snout present in normal mice (Fig. 3 A). The paws were broadened and thickening of the digits and palmar regions were noted (Fig. 3 B). Corneal clouding has not been noted in slit lamb examination of two affected mice at 12 weeks of age. Radiographs at 4 weeks of age revealed features of dysostosis multiplex with widening and thickness to the ribs and zygomatic arches. At 15 weeks of age these features are more prominent (Fig. 4 ) with broadened and thickened long bones. The zygomatic arches of the face and the skull plates are thickened as are the fibulae bilaterally. No obvious weight differences nor mortality was seen in the first 20 weeks of life. Idua -/- males are fertile as indicated by normal litter sizes from mating Idua -/- males to Idua +/- females.
We describe here the generation of an IDUA-deficient mouse produced by targeted disruption of murine Idua using homologous recombination in embryo stem cells. A targeting construct was made after complete characterization of the murine Idua locus revealed the presence of a gene, Sat-1, contained within and overlapping that of Idua (manuscript in preparation). The presence of a gene overlapping Idua presented the unique problem of bringing about the selective inactivation of a single gene. We have accomplished this as demonstrated by the lack of altered Sat-1 expression after Idua inactivation. Disruption of Idua was complete as shown by the lack of expression of Idua mRNA and the absence of detectable [alpha]-L-iduronidase enzyme activity in Idua -/- mice. Clinical and pathologic characterization of Idua -/- mice revealed evidence of widespread lysosomal pathology, increased excretion of urinary GAGs and symptoms resembling that of severe MPS I in humans.
MPS I represents the most common of the severe MPS disorders and is considered the prototypical lysosomal storage disorder. In humans, MPS I is considered a syndrome that follows a continuum of clinical presentation from the severe form, Hurler syndrome, to the milder form, Scheie syndrome. In its most frequent form, there is presentation within the first year of life with progressive storage of glycosaminoglycans within all tissues, leading to hepatosplenomegaly, dysostosis multiplex, corneal clouding, cardiomyopathy and progressive mental retardation. The pathologic findings of lysosomal storage in many tissues, increased GAG excretion, early dysostosis multiplex, craniofacial dysmorphia and complete deficiency of [alpha]-L-iduronidase in the mouse model described here, closely resemble the findings in human MPS I. With the limited study of murine MPS I, it is difficult to comment on where the murine model fits in relation to the spectrum of clinical disease in humans. Nevertheless, the main features of MPS I in humans are noted in murine MPS I. In addition, both the clinical features and pathologic findings show progressive worsening with time. Facial coarseness is the most common early presenting feature in children with MPS I (14 ) and is one of the earliest features that is noted in our murine model. Severe MPS I in man leads to early and diffuse neuropathology with neuronal storage (15 ) whereas cases of mild MPS I show little evidence of neuronal cytoplasmic vacuolation (16 ). The finding of early and extensive neuronal and glial cell lysosomal storage in murine MPS I resembles that noted for severe MPS I in humans.
The fact that we have not observed early mortality in our initial analysis of 30 mutant mice ranging in age from 2 to 20 weeks of age, would indicate that the phenotype is somewhat attenuated in the murine model. This attenuation has been observed in the canine (17 ) and feline (10 ,18 ) MPS I model systems as well as the recently described MPS VI murine model (19 ). The reason for this phenotypic attenuation is not known but may be related to differential rates of storage of GAGs between species. In the case of MPS I, the role that the overlapping gene, SAT-1 may play in the phenotype has not been determined. We have evidence that the human counterpart of SAT-1 is indeed present within intron II of IDUA (manuscript in preparation). Whether alterations of SAT-1 underlie some features of MPS I in humans remain to be determined. The attenuation of the MPS I phenotype in our murine model, as well as other MPS I models, could thus be related to the lack of alteration of SAT-1 expression in these model systems.
Although lysosomal storage of GAGs represents the primary defect in the mucopolysaccharidoses, there is a poor understanding of the true pathophysiology of disease. We have observed evidence of progression of storage from early involvement of reticuloendothelial cells to later involvement of other somatic cells. This feature has been noted in murine MPS VII (20 ) and indicates that one aspect of disease progression in the mucopolysaccharidoses likely relates to sequential involvement of various cell types with the reticuloendothelial cell lines affected early. Whether this feature is present in human MPS I is not known but this finding may relate to the observation that early therapy provides more benefit to patients. Clearly, both direct factors, related to the type of GAG stored and indirect factors relating to massive cytoplasmic vacuolation, also play a role in the MPS disease phenotype. This role of secondary factors has been highlighted by analysis of gangliosides in brain from MPS I humans (21 ), dogs (17 ) and MPS III goats (22 ) revealing evidence of altered concentrations of GM3 GM2 and GD3. These studies indicate that lysosomal storage of glycosaminoglycans does indeed affect other pathways that are present within the lysosome. The finding of radiographic, dysmorphic and pathologic features of lysosomal storage at an early stage in our model, indicates that the MPS I mouse represents a useful model for the study of primary and secondary factors that may be related to the progressive clinical features of the disorder.
There have been many animal models of mucopolysaccharidoses described to date, including the MPS VII mouse (20 ,23 ), MPS VI rat (24 ), MPS VI mouse (19 ) and MPS I dog (17 ) and cat (18 ). The MPS I mouse described here shows similar pathologic features to those described in these model systems. The facial dysmorphia and skeletal lesions seen in murine MPS I are similar in severity to the MPS VII and VI mouse and are more severe than that noted for both feline and canine MPS I. The molecular basis of feline MPS I deficiency is not known whereas canine MPS I is caused by a donor splice site mutation resulting in a translational frame shift and thus is predicted to not allow any [alpha]-L-iduronidase expression (25 ). Therefore it is unlikely that the differences noted between canine and murine MPS I are related to different molecular lesions of IDUA.
Potential therapies for lysosomal storage disorders include bone marrow transplantation, somatic gene therapy, and various methods for direct enzyme replacement. These therapeutic approaches were devised out of the discovery that lysosomal enzymes can be secreted and taken up through a mannose-6-phosphate receptor mediated mechanism (26 ,27 ). The reversibility of some of the features of MPS I is highlighted by the results of early bone marrow transplantation in humans (28 -30 ). These studies reveal that hepatosplenomegaly, facial and oral storage as well as somatic storage in MPS I may be reversible, whereas the skeletal and central nervous system complications may be more refractory to such therapy. Similar observations are also noted with long term direct enzyme replacment (11 ) and bone marrow transplantation (31 ,32 ) in the MPS I dog as well as early bone marrow transplantation (33 -35 ) and enzyme replacement (36 -38 ) in the MPS VII mouse. The factors responsible for the limited responsiveness of these forms of therapy are not known but may relate to the degree of pathology that has occurred prior to the commencement of therapy or to continued pathology related to inefficiency of enzyme delivery to the brain and skeleton. Enzyme delivery using neo-organs producing [beta]-glucuronidase has shown limited response in the MPS VII murine model (39 ,40 ). Neo-organs capable of producing human iduronidase have been implanted in the nude mouse and have shown stable production of iduronidase and delivery of enzyme to distant tissues (41 ). The availability of a murine model for MPS I will be useful in the development and testing of novel treatment strategies for this common lysosomal storage disease. In addition, the provision of a small animal model will be helpful in both the determination of factors related to the pathophysiology of disease and the reversibility of early pathology.
A targeting vector of the replacement type was constructed from genomic fragments of murine Idua that had been isolated from a 129/Sv genomic library (Lambda DASH II) and subsequently cloned into the vector BlueScriptTM. The library was screened with fragments of the murine Idua cDNA, the isolation of which has been previously described (42 ). A cassette containing PGK-Neo was introduced into the coding sequence of Idua by blunt cloning and a PGK-TK cassette was subsequently introduced into the BlueScript TM backbone.
R1 embryo stem cells (a gift from A. Nagy, Mount Sinai Hospital Research Institute, Toronto) (43 ) at passage 13 were cultured on primary embryonic fibroblasts. Cells (1 × 107) were electroporated in a 1 ml cuvette at 240 V and 500 µF. Cells were then plated onto gelatin coated dishes and selected for resistance to neomycin and gancyclovir. Individual clones were then expanded and screened by PCR to identify clones that had undergone homologous recombination. Positive clones identified by PCR were then confirmed by Southern analysis (44 ). The PCR primers used were: Neo PCR primer A, GGAAGACAATAGCAGGATGCT; primer B, outside of recombination site, AAGATGGCTTGTCACCTGTCTCAC. The Idua Southern probe was a 1.2 kb PstI fragment from the EcoRI-HindIII genomic fragment shown in Figure 1 .Targeted clones were expanded and used to inject 9-10 cells into 3.5 day p.c. blastocysts from C57BL/6 mice. The resulting chimaeric males were then mated with C57BL/6 females. The resulting offspring were analyzed by Southern analysis of tail DNA to identify heterozygotes. Male and female heterozygotes were then mated to produce homozygous `null' mice.
IDUA activity was measured using a sensitive fluorometric assay (45 ). Tissues were homogenized in distilled water (25:1 volume to weight ratio) using a motor driven pestle in a chilled 10 ml glass tube. Enzyme assays were performed in buffer consisting of 0.01% formic acid, 77 mM NaCl, 7.7 mM sodium azide, 0.1% Triton X-100 and 25 µM 4-methylumbelliferyl-[alpha]-L-iduronide (Sigma) pH 3.5 in a final volume of 50 µl. Samples were incubated at 37oC for 3-4 h for liver homogenates and 16 h for tail clippings. The reaction was stopped with 2 ml of 1 M glycine NaOH buffer, pH 10.5. Fluorescence was measured with a Hoeffer Scientific Florometer model TKO 100 and expressed in relation to protein mass as determined using the Lowry assay (46 ). Activity was expressed as nanomoles of 4-methyl-umbelliferone released per milligram of protein per hour.
Urinary glycosaminoglycans were assayed by colorimetric assay using dimethylmethylene blue (Aldrich Chemical Co.) as described previously (47 ) with heparan sulfate standards. Urinary creatinine was assayed as described (47 ).
DNA was isolated from ES cell clones or mouse tail samples after overnight digestion with protease K followed by chloroform extraction and ethanol precipitation (48 ). After uptake in 10 mM Tris pH 7.4, DNA was either digested and used for Southern analysis or analysis by PCR. Genomic DNAs were digested with restriction enzymes, electrophoresed on 0.7% agarose gels and transferred to Hybond N filters by the Southern method.
Total RNA was prepared from mouse tissues using Trizol® (BRL) reagent according to the manufacturer's protocol. Poly-A+ RNA was isolated using oligo dT cellulose chromatography. Northern blots were prepared after formaldehyde-agarose gel electrophoresis of the RNA and transfer to Hybond N filters. [32P]dCTP radiolabelled DNA probes were prepared from cloned DNA fragments and labeled by the random hexamer method (49 ). RT-PCR analysis was carried out using Superscript II (BRL) with first strand synthesis using an Idua specific primer (exon IX, CCACTGTATGATTGCTGTCC). PCR was carried out using an Amplitron II PCR instrument (Barnstead Thermolyne Corporation).
Tissues were minced and fixed in 3% glutaraldehyde 0.1 M cacodylate buffer, pH 7.4, post-fixed in 1% osmium tetroxide and stained with 0.5% uranyl acetate. Thick sections were stained with Toluidine blue with ultra thin sections stained with uranyl acetate-lead citrate.
X-ray studies of the mice were performed using a Hewlett Packard Faxitron at 50 kVP and 34 mA. Animals were anesthetised using methoxyfluorane during radiographic examinations.
The Idua cloned DNAs used to make probes for the Northern and Southern blots were obtained from fragments isolated from a genomic 129J/Sv library. The Sat-1 clones were obtained from both genomic clones from the 129J/Sv library as well as murine Sat-1 cDNA fragments isolated from a mouse liver cDNA library (Stratagene, La Jolla, cat #935302).
We thank Sharon Middler for the electronmicrographs and Bryce Ford and Shannon Sing for their technical assistance. This work was supported by the British Columbia Health Research Foundation (LAC), the British Columbia Institute for Child and Family Health (LAC), the Canadian Society for Clinical Investigation (LAC), the Medical Research Council of Canada (LAC) and The Networks of Centers of Excellence (FRJ). LAC is an established investigator of the British Columbia Institute for Child and Family Health.
1 Neufeld,E.F. and Muenzer,J. (1994) The mucopolysaccharidoses. In Scriver,C.R., Beaudet, A.L., Sly,W.S. and Valle,D. (eds), The Metabolic Basis of Inherited Disease. 7th edition.. McGraw-Hill, New York, pp. 2465-2498.
2 Lowry,R.B., Applegarth,D.A., Toone,J.R., MacDonald,E. and Thunem,N.Y. (1990) An update on the frequency of mucopolysaccharide syndromes in British Columbia. Hum. Genet., 85, 389-390.MEDLINE Abstract
3 Roubicek,M., Gehler,J. and Spranger,J. (1985) The clinical spectrum of [alpha]-L-iduronidase deficiency. Am. J. Med. Genet., 20, 471-481.MEDLINE Abstract
4 Scott,H.S., Anson,D.A., Orsborn,A.M., Nelson,P.V., Clements,P.R., Morris,C.P. and Hopwood,J.J. (1991) Human [alpha]-L-iduronidase: cDNA isolation and expression. Proc. Natl. Acad. Sci. USA., 88, 9695-9699.MEDLINE Abstract
5 Scott,H.S., Guo,X.H., Hopwood,J.J. and Morris,C.P. (1992) Structure and sequence of the human [alpha]-L-iduronidase gene. Genomics.13, 1311-1313.MEDLINE Abstract
6 Clarke,L.A., Nelson,P.V., Warrington,C.L., Morris,C.P., Hopwood,J.J. and Scott,H.S. (1994) Mutation analysis of 19 North American MPS I patients: Identification of two additional common mutations. Hum. Mutat., 3, 275-282.MEDLINE Abstract
7 Clarke,L.A. and Scott,H.S. (1993) Two novel mutations causing mucopolysaccharidosis type I detected by single strand conformational analysis of the [alpha]-L-iduronidase gene. Hum. Mol. Genet., 2, 1311-1312.MEDLINE Abstract
8 Scott,H.S., Bunge,S., Gal,A., Clarke,L.A., Morris,C.P. and Hopwood,J.J. (1995) Molecular genetics of mucopolysaccharidosis type I: Diagnostic, clinical, and biological implications. Hum. Mutat., 6, 288-302.MEDLINE Abstract
9 Spellacy,E., Schull,R.M., Constantopoulos,G. and Neufeld,E.F. (1983) A canine model of human [alpha]-L-iduronidase deficiency. Proc. Natl. Acad. Sci. USA., 80, 6091-6095.MEDLINE Abstract
10 Haskins,M.E., Jezyk,P.F., Desnick,R.J. McDonough,S.K. and Patterson,D.F. (1979) Alpha-L-iduronidase deficiency in a cat: a model of mucopolysaccharidosis I. Ped. Res., 13, 1294-1297.
11 Kakkis,E.D., McEntree,M.F., Schmidtchen,A., Neufeld,E.F., Ward,D.A., Gompf,R.E., Kania,S., Bedolla,C., Chien,S.L. and Shull,R.M. (1996) Long term and high-dose trials of enzyme replacement therapy in the canine model of mucopolysaccharidosis I. Biochem. Mol. Med., 58, 156-167.MEDLINE Abstract
12 Shull,R.M., Kakkis,E.D., McEntee,M.F., Kania,S.A., Jonas,A.J. and Neufeld,E.F. (1994) Enzyme replacement in a canine model of Hurler syndrome. Proc. Natl. Acad. Sci. USA., 91,12937-12941.MEDLINE Abstract
13 Bissig,M., Hagenbuch,B., Steiger,B., Koller,T. and Meier,P.J. (1994) Functional expression cloning of the canalicular sulfate transport system of rat hepatocytes. J. Biol. Chem., 269, 3017-3021.MEDLINE Abstract
14 Colville,G.A. and Bax,M.A. (1996) Early presentation in the mucopolysaccharide disorders. Child: Care, Health Dev.22, 31-36.
15 Dekaban,A.S. and Constantopoulos,G. (1977) Mucopolysaccharidosis type I, II, IIIA and V. Pathological and biochemical abnormalities in the neural and mesenchymal elements of the brain. Acta Neuropath. 39, 1-7.
16 Dekaban,A.S., Constantopoulos,G., Herman,M.M. and Steusing,J.K. (1976) Muopolysaccharidosis type V (Scheie syndrome): A postmortem study by multidisciplinary techniques with emphasis on the brain. Arch. Pathol. Lab. Med., 100, 237-245.MEDLINE Abstract
17 Shull,R.M., Helman,R.G., Spellacy,E., Constantopoulos,G., Munger,R.J. and Neufeld,E.F. (1984) Morphologic and biochemical studies of canine mucopolysaccharidosis I. Am. J. Pathol., 114, 487-495.MEDLINE Abstract
18 Haskins,M.E., Aguirre,G.D., Jezyk,P.F., Desnick,R.J. and Patterson,D.F. (1983) The pathology of the feline model of mucopolysaccharidosis I. Am. J. Pathol.,112, 27-36.MEDLINE Abstract
19 Evers,M., Saftig,P., Schmidt,P., Hafner,A., McLoghlin,D.B., Schmahl,W., Hess,B.,Von Figura,K. and Peters,C. (1996) Targeted disruption of the arylsulfatase B gene results in mice resembling the phenotype of mucopolysaccharidosis VI. Proc. Natl. Acad. Sci. USA., 93, 8214-8219.MEDLINE Abstract
20 Vogler,C., Birkenmeier,E.H., Sly,W.S., Levy,B. Pegors,C., Kyle,J.W. and Beamer,W.G. (1990) A murine model of mucopolysaccharidosis VII: Gross and microscopic findings in beta-glucuronidase-deficient mice. Am. J. Pathol., 136, 207-217.MEDLINE Abstract
21 Constantopoulos,G., Iqbal,K. and Dekaban,A.S. (1980) Mucopolysaccharidosis types IH, IS, II, and IIIA: Glycosaminoglycans and lipids of isolated brain cells and other fractions from autopsied tissues. J. Neurochem.34, 1399-1411. MEDLINE Abstract
22 Thompson,J.N., Jones,M.Z., Dawson,G. and Huffman,P.S (1992) N-acetylglucosamine 6-sulphatase deficiency in a Nubian goat: a model of Sanfilippo syndrome type D (mucopolysaccharidosis IIID). J. Inher. Metab. Dis., 15, 760-768.MEDLINE Abstract
23 Birkenmeier,E.H., Davisson,M.T., Beamer,W.G., Ganschow,R.E., Vogler,C.A., Gwynn,B., Lyford,K.A., Maltais,L.M. and Wawrzyniak,C.J. (1989) Murine mucopolysaccharidosis type VII: Characterization of a mouse with [beta]-glucuronidase deficiency. J. Clin. Invest., 83, 1258-1266. MEDLINE Abstract
24 Yoshida,M., Noguchi,J., Ikadai,H., Takahashi,M. and Nagase,S. (1993) Arylsulfatase B-deficient mucopolysaccharidosis in rats. J. Clin. Invest., 91, 1099-1104.MEDLINE Abstract
25 Menon,K.P., Tieu,P.T. and Neufeld,E.F. (1992) Architecture of the canine IDUA gene and mutation underlying canine mucopolysaccharidosis type I. Genomics, 14, 763-768.MEDLINE Abstract
26 Sando,G. and Neufeld,E.F. (1977) Recognition and receptor mediated uptake of a lysosomal enzyme, [alpha]-L-iduronidase, by cultures human fibroblasts. Cell, 12, 619-627.MEDLINE Abstract
27 Pfeffer,S.R. (1991) Targeting of proteins to the lysosome. Curr. Top. Microbiol. Immunol.,170, 43-63.MEDLINE Abstract
28 Whitley,C.B., Belani,K.G., Chang,P.N., Summers,C.G., Blazar,B.R., Tsai,M.Y., Latchaw,R.E., Ramsay,N.K.C. and Kersey,J.H. (1993) Long-term outcome of Hurler syndrome following bone marrow transplantation. Am. J. Med. Genet., 46, 209-218.MEDLINE Abstract
29 Hopwood,J.J., Vellodi,A., Scott,H.S., Morris,C.P., Litjens,T., Clements,P.R., Brooks,D.A., Cooper,A. and Wraith,J.E. (1993) Long-term clinical progress in bone marrow transplanted mucopolysaccharidosis type I patients with a defined genotype. J. Inher. Metab. Dis., 16,1024-1033.MEDLINE Abstract
30 Krivit,W., Lockman,L.A., Watkins,P.A., Hirsch,J. and Shapiro,E.G. (1995) The future for treatment by bone marrow transplantation for adrenoleukodystrophy, metachromatic leukodystrophy, globoid cell leukodystrophy and Hurler syndrome. J. Inher. Metab. Dis., 18, 398-412.MEDLINE Abstract
31 Shull,R.M., Hastings,N.E., Selcer,R.R., Jones,J.B., Smith,J.R., Cullen,W.C. and Constantopolous,G. (1987) Bone marrow transplantation in canine mucopolysaccharidosis I: effects within the central nervous system. J. Clin. Invest., 79, 435-443.MEDLINE Abstract
32 Breider,M.A., Shull,R.M. and Constantopoulos,G. (1989) Long-term effects of bone marrow transplantation in dogs with mucopolysaccharidosis I. Am. J. Path., 134, 677-692.
33 Sands,M.S., Barker,J.E., Vogler,C. Levy,B., Gwynn,B., Galvin,N., Sly,W.S. and Birkenmeier,E. (1993) Treatment of murine mucopolysaccharidosis type VII by syngeneic bone marrow transplantation in neonates. Lab. Invest.68, 676-686.MEDLINE Abstract
34 Bastedo,L., Sands,M.S., Lambert,D.T., Pisa,M.A. and Birkenmeier,E. (1994) Behavioral consequences of bone marrow transplantation in the treatment of murine mucopolysaccharidosis type VII. J. Clin. Invest. 94, 1180-1186.MEDLINE Abstract
35 Birkenmeier,E.H., Barker,J.E., Vogler,C.A., Kyle,J.W., Sly,W.S., Gwynn,B., Levy,B. and Pegors,C. (1991) Increased life span and correction of metabolic defects in murine mucopolysaccharidosis type VII after syngeneic bone marrow transplantation. Blood. 78, 3081-3092. MEDLINE Abstract
36 Sands,M.S., Vogler,C., Kyle,J.W., Grubb,J.H., Levy,B., Galvin,N., Sly,W.S. and Birkenmeier,E.H. (1994) Enzyme replacement therapy for murine mucopolysaccharidosis type VII. J. Clin. Invest., 93, 2324-2331.
37 Vogler,C., Sands,M., Higgins,A., Levy,B., Grubb,J., Birkenmeier,E.H. and Sly,W.S. (1993) Enzyme replacement with recombinant [beta]-glucuronidase in the newborn mucopolysaccharidosis type VII mouse. Pediatr. Res., 34, 837-840.MEDLINE Abstract
38 Vogler,C., Sands,M., Levy,B., Galvin,N., Birkenmeier,E.H., and Sly,W.S. (1996) Enzyme replacement with recombinant [beta]-glucuronidase in murine mucopolysaccharidosis type VII: Impact of therapy during the first six weeks of life on subsequent lysosomal storage, growth, and survival. Pediatr. Res., 39,1050-1054.MEDLINE Abstract
39 Sly,W.S. (1993) Gene therapy on the sly. Nature Genet., 4, 105-106.MEDLINE Abstract
40 Moullier,P., Bohl,D., Heard,J.M. and Danos,O. (1993) Correction of lysosomal storage in the liver and spleen of MPS VII mice by implantation of genetically modified skin fibroblasts. Nature Genet., 4, 154-159.MEDLINE Abstract
41 Salvetti,A., Moullier,P., Cornet,V., Brooks,D., Hopwood,J.J. Danos,O. and Heard,J.M. (1995) In vivo delivery of human [alpha]-l-iduronidase in mice implanted with neo-organs. Hum. Gene Ther., 6, 1153-1159.MEDLINE Abstract
42 Clarke,L.A., Nasir,J. Zhang,H., McDonald,H., Applegarth,D.A., Hayden,M.R. and Toone,J. (1994) Murine [alpha]-L-iduronidase: cDNA isolation and expression. Genomics.24, 311-316.MEDLINE Abstract
43 Nagy,A., Rossant,J., Nagy,R., Abramow-Newerly,W. and Roder,J.C. (1993) Derivation of completely cell culture-derived mice from early passage embryonic stem cells. Proc. Natl. Acad. Sci. USA., 90, 8424-8428.MEDLINE Abstract
44 Southern,E.M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol., 98, 503. MEDLINE Abstract
45 Hopwood,J.J., Muller,V., Smithson,A. and Baggett,N. (1979) A fluorometric assay using 4-methylumbelliferyl alpha-L-iduronide for the estimation of alpha-l-iduronidase activity and the detection of Hurler and Scheie syndromes. Clinica. Chimica. Acta., 92, 257-265.MEDLINE Abstract
46 Lowry,O.H., Rosebrough,N.S., Farr,A.L. and Randall,R. (1951) Protein measurement with the folin phenol reagent. J. Biol. Chem., 193, 265-272.
47 Whitley,C.B., Ridnour,M.D., Draper,K.A., Dutton,C.M. and Neglia,J.P. (1989) Diagnostic test for mucopolysaccharidosis I. Direct method for quantifying excessive urinary glycosaminoglycan excretion. Clin. Chem.,35, 374-379.MEDLINE Abstract
48 Blin,N. and Stafford,D.W. (1976) A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res., 3, 2303. MEDLINE Abstract
49 Feinberg,A.P. and Vogelstein,B. (1983) A technique for radiolabeling DNA restriction fragments to high specific activity. Anal. Biochem., 132, 6.MEDLINE Abstract
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Thu Mar 13 17:29:21 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
