Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (76)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Rowe, P. S.
Right arrow Articles by O'Riordan, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rowe, P. S.
Right arrow Articles by O'Riordan, J. L.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 539-549

Distribution of mutations in thePEX gene in families with X-linked hypophosphataemic rickets (HYP)
Introduction
Results
   Deletions and insertions
   Nonsense mutations
   Splice (donor and acceptor) mutations
   Missense mutations
   Sequence motifs (prosite database search)
Discussion
Materials And Methods
   HYP families
   Genomic sequence and exon-intron structure
   PCR/SSCP analysis and microsatellite screening
   Southern blotting
   Protein analysis
Acknowledgements
References

Distribution of mutations in thePEX gene in families with X-linked hypophosphataemic rickets (HYP)

Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP) Peter S. N. Rowe1,*, Claudine L. Oudet2, Fiona Francis3, Christiane Sinding4, Solange Pannetier2, Mike J. Econs5, Tim M. Strom6, Thomas Meitinger6, Michele Garabedian4, Albert David7, Marie-Alice Macher8, Elisabeth Questiaux9, Ewa Popowska10, Ewa Pronicka10, Andrew P. Read11, Agnes Mokrzycki11, Francis H. Glorieux12, Marc K. Drezner5, Andre Hanauer2, Hans Lehrach3, Johnathan N. Goulding1 and Jeffrey L. H. O'Riordan1

1Department of Medicine, University College London, Middlesex Hospital,London,UK,2Institut de Genetique et de Biologic Moleculaire et Cellulaire, CNRS/INSERM/ULP,Illkirch,France,3Max Planck Institut fur Genetik,Berlin,Germany,4CNRS, URA583, Laboratoire d'Endocrinologie, Hopital St Vincent de Paul,Paris,France,5Department of Medicine, Duke University,Durham, NC,USA,6Ludwig-Maximillian Universitat,Munich,Germany,7Clinique Medicale Pediatrique, Hopital de la Mere et de I'Enfant, CHU de Nantes,Nantes,France,8Service Nephrologie, Hopital Robert Debre, Hopitaux de Paris,Paris,France,9Service de Pediatrie et Neonatalogie, Centre Hospitalier, Intercommunal Robert Ballanger,Aulnay sous Bois,France,10 Centrum Zdrowia Dziecka,Warsaw,Poland,11Department of Medical Genetics, University of Manchester,Manchester,UK and12Genetics Unit, Shriners Hospital,Montreal,Canada

Received October 28, 1996;Revised and Accepted January 29, 1997

Mutations in thePEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families forPEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate-enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure,N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

INTRODUCTION

X-linked hypophosphataemic rickets (HYP) is prototypic of a group of inherited conditions with defects in renal phosphate transport, and bone mineralisation (1 ,2 ). Affected patients have short stature, rickets and bone deformities. A unique feature of the disease is the inappropriate vitamin D metabolism in the presence of low serum phosphate. Deletions found in thePEX gene in patients with HYP have shown that mutations in this gene causes the disease (3 ,4 ). The role of the PEX protein (a zinc metallopeptidase), in regulating phosphate, vitamin D and bone mineral metabolism is not known.

Studies done on a mouse homologue of human X-linked rickets (Hyp), have shown that a circulating extrarenal factor plays a key role in the pathophysiology of the disease (5 -8 ). This factor may well act either directly or indirectly on signal mechanisms that affect renal Na+-dependent phosphate co-transport (NaPi), and clearance of 1,25 (OH)2 vitamin D3 via 24 hydroxylase. A decrease in NaPi expression and an increase in 24 hydroxylase activity occur in the Hyp mouse (9 -14 ). Moreover, levels of protein kinase C are also elevated, and endogenous phosphorylation of renal mitochondrial membrane proteins via phorbol esters has been shown to decrease NaPi transport and increase 24 hydroxylase activity (15 -18 ). The involvement of a circulating factor is underlined by renal cross-transplantation studies of kidneys from affected mice to normal mice, and also parabiosis observations of Hyp mice joined to normal mice (5 -8 ). In addition, studies on phosphate transport in immortalised renal cell cultures show that the Hyp defect is not primarily intrinsic to the renal tubule (19 ).

Tumour-acquired osteomalacia shares many features in common with familial rickets, and may well be an oncogenic equivalent to HYP (1 ,2 ,20 ,21 ). A key characteristic of the disease is the striking remission of clinical abnormalities in bone mineral status, and phosphate/vitamin D metabolism following resection of tumour. Furthermore, heterotransplantation of tumours into nude mice (22 ), infusion of tumour extracts into dogs and rats (23 ,24 ) and studies using tumour conditioned media on renal cell lines (25 ,26 ) all suggest that a circulating factor is involved (see review2 ,21 ).

The complexity of the underlying physiology and biochemistry of HYP has been emphasised by the discovery of intrinsic osteoblast defects (27 -30 ). Moreover, recent reports using the mousePex gene DNA to screen Northern RNA blots have shown expression exclusively in bone and teeth (31 ). More sensitive screening techniques (for example RT-PCR), extend the tissues of expression to include kidney and lung. The precise abnormality in bone is not known; however, recent evidence confirms that two osteoblast bone matrix proteins, osteopontin and osteocalcin, have reduced levels of phosphorylation and increased levels of expression respectively in the Hyp mouse (32 ,33 ).

The identification of the primary defect in HYP has provided an important reagent to help further our understanding of the pathophysiology of X-linked rickets. In patients, the defects in bone mineralisation are only partially corrected by treatment with high doses of 1,25 (OH)2 vitamin D3, and the abnormalities in bone growth remain. An extensive analysis ofPEX gene mutations in affected individuals will help to characterise gene function and unravel the molecular links between renal phosphate transport, vitamin D metabolism, osteoblast function and bone mineralisation. This information in turn will be of use in correlating clinical phenotype to changes in protein primary sequence, predicted structure and post-translational processing. Ultimately these studies will help in the design of more effective treatments for patients with X-linked rickets and related diseases of bone.

RESULTS

PCR primers designed from intronic sequence flanking 22 exons characterised in thePEX gene were used to amplify genomic DNA from 99 HYP families and from seven sporadic cases of rickets. Single-stranded conformation polymorphism analysis (SSCP) was then carried out to detect possible changes in DNA sequence (mobility shifts in polyacrylamide gels), which were then confirmed by sequence analysis.

Two sets of families originating from Europe and North Africa were investigated. Twenty six mutations (32%), were found in the first set which contained 81 pedigrees, and was screened for mutations in 17 of the 22 exons. A further 15 families from this set were found to have mobility shifts consistent with changes in DNA structure, but were not sequenced to confirm this. Combining the 15 unconfirmed mutations with the 26 characterised changes results in a total of 41 mutations (51%) for the first set of families. The second set containing 18 families were screened for mutations in all the 22 exons, and 15 mutations (83%) were detected. In addition, two sporadic cases of hypophosphataemic rickets on seven probands (28%) were associated with mutations in thePEX gene (Table1 ).

The number and type of mutations were: deletions (16), insertions (two), stop codons (nine), splice mutations (10) and missense mutations (six). Mutations were evenly distributed along the gene, and no hot spot(s) were evident.

Three polymorphisms were detected by SSCP. The first polymorphism occurred in 15% of individuals, and involved a change (C -> T), in intronic sequence 19 bp after the forward PCR primer used to amplify exon 10. A second polymorphism was associated with a change in SSCP/PCR mobility of the exon 18 region; this polymorphism was not sequenced, and was also found in 15% of individuals. The third polymorphism involved the poly(T) tract flanking exon 19, in which four alleles were identified. The primers presented in Table3 for exon 19 do not amplify the polymorphism.

Deletions and insertions

Thirteen of the 43 identified mutations were large deletions (>104 bp). Two of these deletions were in excess of 50 kb, involving the complete loss of the N-terminal end of the gene, exons 1-5 and exons 2-5 respectively (Table1 ). The remaining deletions were confirmed by using PCR with primers flanking specific exons. DNA flanking exons 2 (two families), 5 (two families), 7 (two families), 8, 9, 10 and 13 (two families) were found to be missing. All the deletions would be expected to result in frameshifts and/or premature termination of the PEX protein with loss of function. Exons 3, 5 and 12 displayed three small deletions of 5, 104 (partial deletion of exon 5 and a splice donor mutation for exon 5, see below), and 5 bp respectively. Also, two small insertions (1 and 5 bp respectively) were identified in exon 9.

Nonsense mutations

Nine mutations were characterised as stop mutations. One of the stop mutations was found in exon 1 of two unrelated families. The remaining nonsense mutations were observed in exons 1, 8, 9, 11, 13, 15 and 21 respectively (Table1 ).

The stop mutation in exon 21 (mutation CQ4), resulting in the substitution of a TGA stop for a CGA (arginine) at residue 702, is potentially very informative concerningPEX gene function (Table1 ). Although the zinc-binding motif is not affected, and is retained in the mutant protein, a small section of the C-terminal end of the protein is expected to be lost.

The family of patient CQ4 is affected by the disease as severely as other families in which mutations in the N-terminal region occur. The mother and her two affected sons exhibit the typical X-linked hypophosphataemic phenotype, with low serum phosphate, elevated alkaline phosphatase and increased ionised calcium. Severe growth impairment (-1.8 SD to -2.5 SD) was also a major feature of the clinical phenotype in all three affected members. The mother and one of her sons (12 years), both displayed genu varum, and surgery was necessary to improve the mother's status. Both affected sons exhibited bone deformities and frequent tooth abscesses.

Table 1. Mutations
Exon no.

 Variant

 Mutation

 Amino acid

 nt site
Missense mutations

3

 CM41

 TGT -> TCT

 C77S

 230
4

 DC8

 CTT -> CCT

 L138P

 413
15

 CM98

 CCG -> CTG

 P534L

 1601
15

 AJ24

 CCG -> CTG

 P534L

 1601
17

 AG75

 GGA -> AGA

 G579R

 1734
17

 POZN

 GGA -> AGA

 G579R

 1734
Stop mutations

1

 TH241

 CGA -> TGA

 R20Stop

 58
1

 S

 CGA -> TGA

 R20Stop

 58
2

 DA52

 CAG -> TAG

 Q51Stop

 151
8

 CP21

 CAG -> TAG

 Q311Stop

 931
9

 BD46

 AAA -> TAA

 K348Stop

 1042
11

 M

 TGG -> TGA

 W403Stop

 403
13

 CT65

 TAT -> TAA

 Y478Stop

 1434
15

 CP64

 ATC C/gt -> ATC T/gt

 R549Stop

 1645
15

 XHYP018

 AGATCC/gtga -> AGATCT/gtga

 Exon 15 skip, early stop exon 17

 1645
21

 CQ5

 CGA -> TGA

 R702Stop

 2104
Frameshifts: insertions and deletions

3

 RG175

 5 bp deletion

 frameshift codons 67-69

 201-205
5

 MW180

 610-663 bp of exon 5,

 104 bp deletion

 610 plus
 

  

 plus 50 bp of 3' intron

 codons 204-221 inclusive

 intron
9

 HG

 insertion: 8 bp frameshift

 insertion; codons 320/21

 961/962
 

  

 (GAGTTACT)

 valine

  
9

 SG

 insertion: 1 bp frameshift

 insertion; codons 327/28

 980/981
 

  

 976/977 (C)

 tyrosine
10

 BB35

 deletion B3a

 after codon 359

 after 1075
12

 PY

 frameshift (AAAAG) deleted

 5 bp deletion codons 466-467

 1396/1399
Splice mutations

7

 XH011

 AAGTCT/gtaa -> AAGTCT/ttaa

 splice donor (codon 244)

 732
7

 B10

 ttacag/TATCGGG -> ttacaa/TATCGGG

 splice acceptor (codon 245)

 733
7

 XH015

 ttacag/TATCGGG -> ttacac/TATCGGG

 splice acceptor (codon 245)

 733
7

 CL69

 GCTGAG/gt -> GCTGAG/tt

 splice donor (codon 283)

 849
10

 DS99

 cag/GACC -> cgg/GACC

 splice acceptor (codon 360)

 1079
11

 BA99

 ATG/gt -> ATG/tt

 splice donor (codon 434)

 1303
17

 BH41

 at..../ATCT -> aa..../ATCT

 splice acceptor ( codon 567)

 1700
19

 CL66

 AGG/gt -> AGG/at

 splice donor (codon 655)

 1965
Exons are shown in upper case and introns in lower case for splice mutations.

Splice (donor and acceptor) mutations

Six splice donor mutations were detected that would result in the loss of exons 5, 7 (two families), 11, 15 and 19. Four splice acceptor mutations occurred, resulting in the loss of exon 7 (two families), exon 10 and exon 17. In the case of patient B10, skipping of exon 7 has been confirmed by reverse transcription of mRNA followed by PCR, and sequencing of the relevant region (3 ). Both in-phase and out-of-phase exon skipping mutations were observed in HYP patients. A small deletion (104 bp), in family, MW18O (Table1 ), would result in the skipping of exon 5, with consequent major changes in predicted secondary structure and thus function.

In mutation DS99, hypophosphataemic male twins were found to have an alteration in the splice acceptor site of exon 10. This mutation potentially would result in skipping of exon 10 followed by a frameshift of the mis-spliced exon sequences. Both of the children were severely affected, and required corrective surgery at 2 years of age for craniostenosis (abnormal skull growth due to premature fusion of skull bones). Prior to surgery, the twins were affected by intracranial hypertension, and this resulted in the development of mild mental retardation.

A mutation involving a transversion of T -> A in intronic sequence 5' to the start of exon 17, and -16 bp upstream, was detected in a large Italian HYP pedigree (mutation BH41). All eight of the affected family members carried the mutation, as confirmed by a larger allele on SSCP polyacrylamide gel mobility shifts. Moreover, the mutation was not found on 72 X chromosomes screened from other HYP patients, or from the mothers of the CEPH pedigrees. The larger SSCP mobility shift allele contained the following sequence:aagtattaatgccatagA TCT, which differed from the expected normal sequence of:atgtattaatgccatagA TCT. It is of interest to note that only 2% of splice acceptor sites contain an additional ag sequence between base positions -4 and -15, which is 5' relative to the consensus acceptor ag (34 ). The extra ag in the mutant at -15 to -16 is expected, therefore, to cause loss of exon 17 (containing the zinc consensus motif and active catalytic site) due to suppression of the normal splice acceptor site. Moreover the mis-spliced exon would result in a frameshift in the remaining C-terminal sequence of the PEX protein.

Missense mutations

Six missense mutations were found in exons 3, 4, 15 and 17. The mutations found in exons 15 and 17 were found in two separate (unrelated) families respectively. The first N-terminal missense mutation encountered in exon 3 (CM41), involved codon 77 (Table1 ). A single base change of G to C at position 230 bp in thePEX gene (TGT -> TCT) results in a substitution of serine for a cysteine. The altered cysteine is potentially very important for protein secondary structure, and an alignment of the M13 family of zinc metallopeptidases indicates that the region is highly conserved (Fig.1 ). Of clinical interest is the appearance of deafness in an affected 10 year old boy from this family. The other two affected members of the pedigree (the affected boy's mother and brother) had normal hearing.


Figure 1. Clustal V alignment analysis, and boxshade scheme of the M13 Zn2+ metallopeptidases, including PEX. All four proteins of the M13 family including PEX showed alignment of 10 cysteine residues spanning the entire proteins atPEX gene positions 54, 60, 77, 85, 142, 406, 617, 693, 733 and 746 respectively. The N-terminal region consisting of ~24 hydrophobic residues and 25 intracellular residues, is followed by a large extracellular C-terminal domain containing the Zn2+-binding site. This pattern is present in all M13 family members of the Zn2+ metallopeptidase clan MA (35,40). The hydrophobic N-terminal sequence may serve as a transmembrane anchor sequence or as a signal peptide. Specific regions clustered throughout each of the four proteins have a high degree of conservation. PEX, NEP, ECE-1 and KELL have six, six, five and 10 potentialN-glycosylation sites respectively. It must be noted, however, that the folding of the protein plays an important role in the regulation ofN-glycosylation.

Conversion of a T to a C at 412 bp (exon 4), that would result in the exchange of a proline for a leucine at residue 138 of the PEX protein, was found in HYP patient DC8. Secondary structure prediction analysis indicated that this missense mutation would lead to major changes in [alpha]-helical structure, protein turn and [beta]-sheets, with additional subtle localised changes in surface probability and antigenicity (data not shown). Moreover, the region is highly conserved, with the substituted leucine present in both PEX and neprilysin (NEP) (see Fig.1 ).

A missense mutation in exon 15 was found in two French families (CM98 and AJ24), that involved a substitution of leucine for proline (CCG -> CUG), at codon 534 (Table1 ). Confirmation that both families were not related was obtained by deducing the haplotypes for three `PEX-region' microsatellites (i.e.DXS7475,DXS7473 and an unpublished microsatellite localised to a 5.1 kbEcoRI fragment of cosmid 1005 encompassing the 10th intron of thePEX gene reported in Table3 ), for each family (4 ). No common alleles were found for the two families tested (markers not shown).

Another recurrent mutation was found in a Polish (POZN) and Spanish family (AG75), in exon 17. The change involved substitution of an arginine for a glycine at residue 579 of PEX (Fig.1 ). This mutation is of great interest since it is directly adjacent to the zinc-binding motif HEFTH, and the replaced glycine is conserved in PEX, NEP and endothelin-converting enzyme (ECE-1), but not in KELL. The whole region is also highly conserved, and is a major fingerprint for the M13 family of zinc metallopeptidases (35 ). A key feature of this site is a clustering of hydrophobic residues in PEX and all the M13 family members, with associated [beta]-sheet. In this context, replacing glycine that has an uncharged polar group (conserved in PEX, NEP and ECE-1) with the basic positively charged arginine reduces the hydrophobicity, and also extends predicted [beta]-sheet in the mutant form. Unexpectedly, in our family samples, no missense mutations were detected in the core active catalytic site residues of the Zn2+-binding motif.

Sequence motifs (prosite database search)

The main changes in predicted post-translational modification sites were: (i) three amidation sites, (ii) eightN-glycosylation sites, (iii) nineN-myristoylation sites and (iv) one C-terminal prenylation site. Screening of the PEX protein (prosite database) also revealed three potential cAMP and cGMP protein kinase sites, nine casein kinase sites, 12 protein kinase C sites and five tyrosine kinase sites. Also, potential disruption of the zinc-binding motif occurs in a mutation found in both POZN and AG75.

DISCUSSION

ThePEX gene product has a high degree of homology with members of the neutral endopeptidase family (M13 family of zinc metallopeptidases), which are type II integral membrane glycoproteins. Proteins belonging to this group include NEP, ECE-1 and KELL antigen (3 ,21 ). Extensive mutation analysis of 99 HYP families has revealed a range of defects in thePEX gene. These include stop mutations, missense mutations, splice mutations, insertions and deletions. A number of mutations were found that would potentially alter the pattern of post-translational modification of the PEX protein and change secondary structure. Screening of the PEX protein (prosite database) also revealed potential disruption of putative kinase phosphorylation sites (see Results). Molecular regulation and cellular signalling are mediated by protein phosphorylation, and changes in patterns of endogenous protein phosphorylation of renal membranes occur in the mouse model (Hyp) of the rickets disease (15 -18 ). The nature of the mutations found in thePEX gene allows important deductions to be made concerning PEX and its putative function as a zinc metallopeptidase. This paper presents a selection of the main conclusions drawn from an exhaustive study of the probable structure of the PEX protein (wild-type or HYP). This analysis has been helped and supported by a number of predictive computer programs (36 -38 ).

Amongst the most informative mutations concerning PEX function are those involving specific changes or substitutions of single amino acids (missense mutations). The first N-terminal missense mutation in exon 3 (CM41) results in substitution of a serine for a cysteine, and this is predicted to alter secondary structure and protein flexibility. Also, there are implications for protein folding as cysteine residues are able to form coordinate disulphide bonds with other cysteine residues, and it is of interest that adjacent to the changed cysteine there is a potentialN-glycosylation motif (NLSV). The implication is that the mutant protein would be expected to fold into a different secondary and, by definition, tertiary structure to that of the wild-type protein, and thus have impaired function.

Table 2. . Important residues for zinc sequestration and substrate specificity
Amino acid

 NEP

 PEX

 ECE-1

 KELL
Arginine (R)

 102

 Ser100

 128

 Ser117
Asparagine (N)

 542

 538

 549

 540
Alanine (A)

 543

 539

 550

 541
Histidine (H)

 583

 580

 590

 581
Glutamic acid (E)

 584

 581

 591

 582
Histidine (H)

 587

 584

 594

 585
Glutamic acid (E)

 646

 642

 650

 633
Aspartic acid (D)

 650

 646

 654

 638
Histidine (H)

 711

 710

 715

 694
Arginine (R)

 747

 747

 Glu752

 Gln736

Table 3. . PCR exon primers and conditions
Exon no.
Annealing temp.
(oC)(
MgCl2 conc.
(mM)

 Sequence 5' to 3'
1

 59

 0.8

 GCTCTTGAGACCAGCCACCA
 

  

  

 ATAAAGCACAAGGAAACTTCTCG
2

 55

 1

 TCTTGCGTATGTTTCCGAGGG
 

  

  

 CTGTCTTCTCTTCCACTTCC
3

 55

 1

 ATTCAGTGCTTGTCATTAATCC
 

  

  

 TAAAGTGTATCACCAAACCCC
4

 59

 1.6

 GGAGGTTGGAATTGTGATTATCA
 

  

  

 CTCTTCTTCCTCAAACAATATATTA
5

 59

 1.2

 CTAGTGTGCTGATCCAGTTTGC
 

  

  

 GCAGCATGAGTCTCTTTCCC
6

 51

 1.2

 CATCACTCTTGTTAACATGG
 

  

  

 GGCCTTAGAACTAATGGGC
7

 50

 1.6

 GGAAAGAAAGAGATTTTCAGTG
 

  

  

 TCTTCCATGTCTCTCAAACATA
8

 54

 1.2

 GTAATCATACAGTAAGAAATGG
 

  

  

 GAGATGAAATCCAATCCCTTC
9

 59

 1.2

 TTTTCAAAGGATGTGAGAAGGGAAG
 

  

  

 CATTCTGTTTTGTTCTCTCTCCCCT
10

 60

 1.5

 GGCATCATCTTTTATGTGATTCGTA
(CA)24 repeat intron

  

  

 TGGGGTAAGATACACAACAAGTAGG
10

 59

 1.2

 CTGCAGAGCATCAGATATTGAC
 

  

  

 AAAGTTATCCAGCGATGTAACAC
11

 59

 1.2

 GCCATGGGTTTTATCCAAATGAA
 

  

  

 GATCTGGCTAAATTGCCATTATTT
12

 59

 1.6

 AGCATGGAGTCAAGCTGAAAGA
 

  

  

 TGTCAAGCATGAACATCCATTAAA
13

 59

 1.6

 AGATGAAGGGCGCAMCTACA
 

  

  

 TCACCAGTTTTAATTGCTAGGAC
14

 59

 1.2

 GAACAATGATGTTGTGGTTTGTTT
 

  

  

 AGACTCCGCTTCTCACCAATG
15

 59

 1.2

 AGCCATGCTGTGTTTGTCTTTG
 

  

  

 CTTACCCTCCATCATAGTCATG
16

 59

 1.6

 AGGTACTCATCATTGAATCAATCT
 

  

  

 ATGTTCTTCCTAATTGGTCAGTAA
17

 59

 0.8

 AGGATTATGCTCTGAGATTCATG
 

  

  

 CATTATTATAAAAGCAGCAGCTTAT
18

 60

 1.5

 GGTGAGGGAAAGGAAAGATG
 

  

  

 AATGAACCACAAGGTGCCCC
19

 53

 1.5

 TTCCTTTTTTCTTTCTGTTAG
 

  

  

 AACATGGCTATGGTATGAATTGAGG
20

 56

 1.5

 TGAGCAAAGAGAAAAACCCACCGTT
 

  

  

 GGAGCAAACTCAAGTCCTGCATCTC
21

 55

 1.5

 GCTCATTTGTTGGGATGTTTTCTCT
 

  

  

 GTTAAAAACTGCCGTCACCCATTTG
22

 54

 1.5

 ACAGAACCTGTTGATGTGCAAGAAT
 

  

  

 GCCTCCGCTGGCCACTGTGCAACTG


Figure 2. Scheme showing the proposed Zn2+ catalytic site of PEX. The substrate structure is positioned centrally, and the important PEX residues are shown surrounding the cleaved peptide. The scheme for PEX is adapted from known X-ray crystallographic data for thermolysin plus site-directed mutagenesis studies and inhibitor data for neprilysin (35,39,40).A missense mutation in the adjacent C-terminal exon 4, involving a change of leucine to proline at residue 138 (DC8), also has implications for PEX activity. This substitution is predicted to cause changes in [alpha]-helical structure, protein turn and [beta]-sheets and localised changes in surface probability and antigenicity. Also, two overlapping motifs (eight residues N-terminal to the mutation; SRR and RRDT), in a region of increased surface probability, indicate that this region could be phosphorylated by either protein kinase C and/or by cAMP/cGMP protein kinases. The region N-terminal to the substitution is also highly conserved in all the metallopeptidases, and in particular the substituted leucine is conserved in NEP and PEX. Thus it is probable that this region is critical forPEX gene function, and protein phosphorylation may play a role.


Figure 3. Deduced cDNA sequence for the humanPEX gene (GenBank accession No. U60475). Exon splice sites are represented by arrows. The genomic sequence has been submitted for publication (Franciset al.).

A recurrent missense mutation in exon 15, at residue 534 (CM98), resulted in substitution of a leucine for a proline. This mutation occurs four residues N-terminal to a conserved group of amino acids NAFYS. Asn538 and Ala539 are the most important residues in this cluster due to their predicted interaction with the substrate P2', and the substrate P1' site respectively (Fig.2 ). Also, the change in amino acid results in an extended [beta]-sheet and the appearance of a newN-glycosylation motif (NLTT) immediately adjacent (one residue N-terminal) to both Asn538 and Ala539 (`P' site amino acids). This is also associated with a reduction in protein flexibility. Thus, this mutation would be expected to disrupt PEX catalytic site interactions by altering the immediate molecular environment (proline has a negatively charged R-group, and leucine is hydrophobic). This mutation was also found twice in a panel of 29 other HYP families (Franciset al., in preparation).

Conservation of amino acids involved in the catalytic site of the M4 family of thermolysin and the M13 family of NEP and PEX is striking (Table1 , Fig.1 ), and there is a clustering of hydrophobic residues. Hydrolysis of the substrate occurs through formation of a penta-coordinated complex of the metal that includes the three amino acids of the peptidase, the oxygen of the sissile bond and a water molecule bound to the Zn2+ atom (35 ,39 ,40 ). The three zinc-coordinating ligands characteristic of the Zn2+ metallopeptidase groups occur in PEX at positions His580, His584 and Glu642(Fig.2 ). An additional Glu residue at position 581 has a role in catalysis by polarising a water molecule. An important residue shown to be essential for stabilisation of the transition state in thermolysin, and confirmed by site-directed mutatgenesis is His711 (NEP clustal alignment position), (41 ). This residue is present in all the zinc metallopeptidases including PEX (Table2 ). A missense mutation found in POZN and AG75, which occurs in exon 17 and replaces residue Gly579with an arginine, would be expected to cause a charge polarity reversal (glycine negatively charged, arginine positively charged). The substituted residue (Gly579), occurs in position `X' (any amino acid), of the zinc motif (abXHEbbHbc), where b is an uncharged residue, c is a hydrophobic residue and `a' is most commonly a valine or threonine across the zinc metallopeptidase families. In PEX and KELL, the `a' residue is isoleucine (Table2 , Fig.1 ). Gly579 is conserved in PEX, NEP and ECE-1, and substitution by Arg579 is predicted to cause changes in localised hydrophobicity and extend the [beta]-sheet encompassing the zinc region, as well as reversing charge polarity. This suggests that Gly579 may play an important role in either substrate specificity or enzyme function. Also, the [alpha]-helical nature of the zinc motif is an important structural requirement of the catalytic site, and the glycine is predicted to disrupt this (35 ). This mutation was found four times in a panel of 29 HYP families investigated by Franciset al. (in preparation).

The S2, S1, S1' and S2' subsites of the protease and the lateral chains of the substrate corresponding to the P2, P1, P1' and P2' amino acid moieties interact by Van der Waals and ionic forces to ensure specificity (35 ). A major determinant of substrate specificity is a hydrophobic residue in the substrate P1' site. The arginine at 747 of PEX corresponding to Arg747of NEP interacts with this P1' residue and is important for correct `lock and key' alignment (Fig.2 ). In this context, the stop mutation found in exon 21 of thePEX gene (mutation CQ5), in which substitution of an arginine codon CGA for a stop codon UGA at residue 702 occurs, is potentially important when consideringPEX gene function. This stop mutation is predicted to result in the loss of the tip of the C-terminus in the mutant form (beyond the Zn2+ motif in exon 17), and thus of the key residues Arg747 and His710 (Fig.2 , Table2 ). Therefore, mutation CQ5 and the manifestation of the disease phenotype suggest the importance of the Zn2+ catalytic site in PEX. However, it is also possible that the CQ5 stop mutation increases susceptibility to proteolytic degradation. In addition, loss of the two cysteine residues in CQ5 could also alter protein structure sufficiently to cause loss of function.

The expected loss of exon 19 in patient CL66 due to a splice donor mutation would also result in loss of an important C-terminal residue, Glu642. This amino acid is conserved in all four metallopeptidases and plays a pivotal role in the sequestration of the catalytic site Zn2+ atom (Fig.2 ).

Loss of exons due to aberrant splicing or exon skipping would inevitably lead to loss of a number of post-translational sites, and result in major changes of secondary structure. Unfortunately, confirmation of the splicing could not be obtained as blood/DNA samples were collected over a long period, and only a few B-lymphablastoid cell lines were available for mRNA extraction.NEP, which consists of 24 exons (comparable with the 22 so far identified forPEX), is subject to alternative splicing, and two shortened forms have been described. An alternatively spliced form ofNEP with exons 5-18 removed (retaining the membrane-spanning domain) and an alternatively spliced form lacking exon 16 both result in inactive enzymes (42 ,43 ). It is therefore perhaps not surprising that the large number of splice mutations described here for thePEX gene are associated with the clinical phenotype in X-linked rickets. Closer analysis of the predicted changes in secondary structure and loss of specific motifs will provide clues to the reason for loss of function.

Correlation between a given genotype and a specific phenotype is of prime interest to the clinical management and understanding of familial diseases. This study raises a possible link between mutations involving the N-terminal region of thePEX gene and the occurrence of deafness. Relevant to this is the recent finding of a deletion of exons 1-3 in a mouse model (Gy) with classic hypophosphataemic rickets and inner ear defects (Stromet al., submitted). In our group of families, at least one patient mutated inPEX exon 3 (CM41) exhibited middle ear defects and consequent deafness. Twins mutated for exon 10 (DS99) have a hearing loss of 20-30 dB, but it was not possible to know whether this was generated by the craniostenosis or whether it was the direct consequence of the mutation.

The role of the HYP zinc metallopeptidase (PEX) in regulating renal phosphate handling, vitamin D metabolism and bone mineral metabolism is not known. Several mechanisms are possible, although it is difficult to define a single theory as correct. The evidence from this study suggests that PEX is a protease with a requirement for zinc (M13 family). A consideration of biochemical and physiological data on the mouse model of rickets strongly suggests that the molecular defect in HYP also involves an extra-renal circulating factor (2 ,20 ,21 ). It has been proposed that this factor (possibly humoral), if found, should be called phosphatonin (44 ). The complexity of the pathophysiology of X-linked rickets is underlined further by the finding that intrinsic osteoblast defects are also associated with the disease (27 -30 ,32 ,33 ). Also, although the defects in bone mineralisation are partially corrected by treating patients with high doses of phosphate and 1,25 (OH)2 vitamin D3, the abnormalities in bone growth remain (45 ).

Genetic evidence from the Hyp mouse also suggests a role for a circulating factor (46 ), and of particular interest is the absence of a gene dose effect (generally found in X-linked dominant diseases). In contrast to the Hyp mouse, several studies of human X-linked rickets show that gene dosage effects do occur (45 ,47 ,48 ). Moreover, the large deletions, splice mutations, frameshifts and missense mutations we have described forPEX would eliminate gene function and are associated with the clinical phenotype in humans. Thus, in humans, affected HYP males (hemizygous) express the full clinical phenotype (null mutations) and heterozygous females have a reduced gene dosage and intermediate clinical phenotype because of random X-inactivation (49 ). One possible explanation for the lack of apparent gene dosage effect in the mouse is haploinsufficiency. In haploinsufficiency disorders, the gene products participate in intermolecular complexes, and reduced amounts of product can lead to profound alterations in competitive and stoichiometric interactions (50 ). It is conceivable that haploinsufficiency may play a large role in the mouse disease model, and a reduced but significant role in the human equivalent of the disease. This implies that thePEX gene product may either interact with itself or other components to form multimeric complexes before activation. It is also possible thePEX gene product processes or modifies component part(s) of a multimeric complex prior to the initiation of the interaction or assembly of the multimer.

The analysis of the mutations in thePEX gene of patients with HYP and a consideration of the implied modifications of the altered PEX protein confirm the requirement of a fully intact PEX to ensure function. It is of interest, therefore, to speculate whether a circulating factor (proteolytically processed by thePEX gene product) is responsible either indirectly or directly for the changes in renal phosphate transport, vitamin D metabolism and osteoid mineralisation. An answer to the `humoral factor' theory awaits isolation of a putative PEX protein substrate. Characterisation of this substrate (possible novel hormone) will facilitate studies directed towards increasing our understanding of bone mineral metabolism. Also, an increased knowledge ofPEX gene function may provide a means of devising better treatments for patients with X-linked rickets, tumour osteomalacia and possibly other related diseases of bone.

MATERIALS AND METHODS

HYP families

Ninety nine families were studied in which HYP had been inherited through two or more generations. In addition, seven sporadic cases were studied. Diagnosis was confirmed radiologically, and by measuring renal phosphate wasting, serum phosphate and vitamin D metabolism (see ref.2 ). The families were of global provenance (Europe and North Africa).

Genomic sequence and exon-intron structure

Cloning of thePEX cDNA has been described previously (ref.3 and GenBank accession No. U60475). The genomic sequence of thePEX gene region and intron-exon boundary sequences are presented elsewhere (Franciset al., in preparation). Intronic primers flanking each of the 22 characterised exons and conditions for PCR are shown in Table3 . The relative position of exons in the cDNA sequence is shown in Figure3 .

PCR/SSCP analysis and microsatellite screening

Core buffer for PCR was: 10 mM Tris-HCl pH 8, 50 mM KCl, 1 µM primers, 200 µM dNTPs, 0.25 U ofTaq polymerase, 100 ng of DNA and MgCl2, as presented in Table3 , in a total volume of 25 µl. Thermocycling was carried out at 95oC for 2 min, followed by 35 cycles of 95oC for 1 min, 50oC for 1 min, 72oC for 1 min. SSCP of mutations was then carried out as described earlier (3 ). Analysis of microsatellites after PCR of DNA was undertaken as described (4 ).

Southern blotting

The larger deletions within thePEX gene were confirmed by PCR and by Southern analysis of genomic DNA isolated from affected patients (3 ).

Protein analysis

A number of computer programs were used to analyse the primaryPEX gene sequence, and to predict alignment, structural motifs and secondary structure (hydrophobicity, surface probability, antigenicity, flexibility). These consisted of the Wisconsin GCG and EGCG packages (36 ,37 ), and also the antheroplot programme (38 ). The databases used were Prosite, Swissprot, GenBank and EMBL. The alignments depicted are derived using clustal V analysis (GCG or antheroplot), and transformed using the prettybox programme (GCG).

ACKNOWLEDGEMENTS

We thank Dr Simone Gilgenkrantz, Dr Michele Mathieu, Dr Martine Le Merrer and Dr Marc Petrus for their collaboration. We thank Serge Vicaire for technical assistance with sequencing and Adrien Staub, Franck Ruffenach, Iingrid Colas and Edouard Troesch for oligonucleotide synthesis. Also, we would like to extend our thanks to all the clinicians who have contributed patients for this research. This study was supported by the Medical Research Council of the United Kingdom (MRC Senior Fellowship to P.R.), lnstitut National de la Sante et de la Recherche Medicale, the Centre National de la Recherche Scientifique, the Centre Universitaire Hospitalier Regional, the Commission of the European Communities (Gene CT930027), the Ministere de la Recherche Francaise (92N60/0694) and the Peter und Traudl Engelhorn Stiftung grant to F.F.

REFERENCES

1 McKusick, V., Francomano, C.A. and Antonorakis, S. (1992) Mendelian Inheritance in Man. The Johns Hopkins University Press. Baltimore, MD.

2 Rowe, P.S. (1994) Molecular biology of hypophosphataemic rickets and oncogenic osteomalacia. Hum. Genet., 94, 457-467. MEDLINE Abstract

3 HYP consortium, (1995) A gene (PEX) with homologies to endopeptidases is mutated in patients with X-linked hypophosphatemic rickets. The HYP Consortium. Nature Genet., 11, 130-136.

4 Rowe, P.S., Goulding, J.N., Francis, F., Oudet, C., Econs, M.J., Hanauer, A., Lehrach, H., Read, A.P., Mountford, R.C., Summerfield, T., Weissenbach, J., Fraser, W., Drezner, M.K., Davies, K.E. and O'Riordan, J.L. (1996) The gene for X-linked hypophosphataemic rickets maps to a 200-300kb region in Xp22.1, and is located on a single YAC containing a putative vitamin D response element (VDRE). Hum. Genet., 97, 345-352. MEDLINE Abstract

5 Morgan, J.M., Hawley, W.L., Chenoweth, A.I., Retan, W.J. and Diethelm, M.D. (1974) Renal transplantation in hypophosphataemia with vitamin-D resistant rickets. Arch. Intern. Med., 134, 549-552. MEDLINE Abstract

6 Meyer, R.A., Meyer, M.A. and Gray, R.W. (1989) Parabiosis suggests a humoral factor is involved in X-linked hypophosphataemia in mice. J. Bone Mineral Res., 4, 493-500.

7 Meyer, R.A., Tenenhouse, H.S., Meyer, M.A. and Klugerman, A.H. (1989) The renal phosphate transport defect in normal mice parabiosed to X-linked hypophosphataemic mice persists after parathyroidectomy. J. Bone Mineral Res., 4, 523-532.

8 Nesbitt, T., Coffman, T.M., Griffith, R. and Drezner, M.K. (1992) Crosstransplantation of kidneys in normal and Hyp mice. J. Clin. Invest., 89, 1453-1459. MEDLINE Abstract

9 Tenenhouse, H.S., Yip, A. and Jones, G. (1988) Increased renal catabolism of 1,25-dihydroxyvitamin D3 in murine X-linked hypophosphataemic rickets. J. Clin. Invest., 81, 461-465. MEDLINE Abstract

10 Tenenhouse, H.S. and Jones, G. (1990) Abnormal regulation of vitamin D catabolism by dietary phosphate in murine X-linked hypophosphataemic rickets. J. Clin. Invest., 85, 1450-1455. MEDLINE Abstract

11 Nagawaka, N., Arab, N. and Ghishan, F.K. (1991) Characterisation of the defect in the Na+-phosphate transporter in vitamin D resistant hypophosphataemic mice. J. Biol. Chem., 266, 13616-13620.

12 Werner, A., Moore, M.L., Mantei, N., Biber, J., Semenza, G. and Murer, H. (1991) Cloning and expression of cDNA for Na/Pi cotransport system of kidney cortex. Proc. Natl Acad. Sci. USA, 88, 9608-9612. MEDLINE Abstract

13 Roy, S., Martel, J., Ma, S. and Tenenhouse, H.S. (1994) Increased renal 25-hydroxyvitamin D3-24-hydroxylase messenger ribonucleic acid and immunoreactive protein in phosphate deprived Hyp mice: a mechanism for accelerated 1,25-dihydroxyvitamin D3 catabolism in X-linked hypophosphataemic rickets. Endocrinology, 134, 1761-1767. MEDLINE Abstract

14 Tenenhouse, H.S., Werner, A., Biber, J., Shuyi, M.A., Martel, J., Roy, S. and Murer, H. (1994) Renal Na+ -phosphate co-transport in murine X-linked hypophosphatemic rickets: molecular characterisation. J. Clin. Invest., 93, 671-676. MEDLINE Abstract

15 Tenenhouse, H.S. and Henry, H.L. (1985) Protein kinase activity and protein kinase inhibitor in mouse kidney: effect of the X-linked Hyp mutation and vitamin D status. Endocrinology, 117, 1719-1726. MEDLINE Abstract

16 Boneh, A., Mandla, S. and Tenenhouse, H.S. (1989) Phorbol myristate acetate activates protein kinase C, stimulates the phosphorylation of endogenous proteins and inhibits phosphate transport in mouse renal tubules. Biochim. Biophys. Acta, 1012, 308-316. MEDLINE Abstract

17 Mandla, S., Boneh, A. and Tenenhouse, H.S. (1990) Evidence for protein kinase C involvement in the regulation of renal 25-hydroxyvitamin D3-24-hydroxylase. Endocrinology, 127, 2639-2647. MEDLINE Abstract

18 Chen, M.L., Boltz, M.A. and Armbrecht, H.J. (1993) Effects of 1,25-dihydroxyvitamin D3 and phorbol ester on 25-hydroxyvitamin D3 24-hydroxylase cytochrome P450 messenger ribonucleic acid levels in primary cultures of rat renal cells. Endocrinology, 132, 1782-1788. MEDLINE Abstract

19 Nesbitt, T., Econs, M.J., Byun, J.K., Martel, J., Tenenhouse, H.S. and Drezner, M.K. (1995) Phosphate transport in immortalized cell cultures from the renal proximal tubule of normal and Hyp mice: evidence that the HYP gene locus product is an extrarenal factor. J. Bone Mineral Res., 10, 1327-1333.

20 Drezner, M.K. (1990) Tumour-associated rickets and osteomalacia. In Favus,M.J. (ed.), Primer on Metabolic Bone Diseases and Disorders of Mineral Metabolism. American Society for Bone and Mineral Research, Kelseyville, CA, pp. 184-188.

21 Rowe, P.S.N. (1997) The PEX gene: its role in X-linked rickets, osteomalacia, and bone mineral metabolism. Exp. Nephrol., in press.

22 Miyauchi, A., Fukase, M., Tsutsumi, M. and Fujita, T. (1988) Hemangiopericytoma induced osteomalacia: tumour transplantation in nude mice causes hypophosphataemia and tumour extracts inhibit renal 25-hydroxyvitamin D [alpha]1-hydroxylase activity. J. Clin. Endocrinol. Metab., 67, 46-53. MEDLINE Abstract

23 Aschinberg, L.C., Solomon, L.M., Zeis, P.M., Justice, P. and Rosenthal, I.M. (1977) Vitamin D resistant rickets associated with epidermal nevus syndrome: demonstartion of a phosphaturic substance in the dermal lesions. J. Paediatr., 91, 56-60.

24 Popovtzer, M.M. (1981) Tumour induced hypophosphataemic osteomalacia: evidence for a phosphaturic cyclic AMP-independent action of tumour extract. Clin. Res., 29, 418A (Abstract).

25 Cai, Q., Hodgson, S.F., Kao, P.C., Lennon, V.A., Klee, G.G., Zinsmiester, A.R. and Kumar, R. (1994) Brief report: inhibition of renal phosphate transport by a tumor product in a patient with oncogenic osteomalacia [see comments]. N. Engl. J. Med., 330, 1645-1649. MEDLINE Abstract

26 Rowe, P.S.N., Ong, A., Cockerill, F., Goulding, J. and Hewison, M. (1996) Candidate 56 and 58 kDa protein(s) responsible for mediating the renal defects in oncogenic hypophosphataemic osteomalacia. Bone, 18, 159-169.

27 Ecarot-Charrier, B., Glorieux, F.H., Travers, R., Desbarats, M., Bouchard, F. and Hinek, A. (1988) Defective bone formation by transplanted Hyp mouse bone cells into normal mice. Endocrinology, 123, 768-773. MEDLINE Abstract

28 Ecarot, B., Glorieux, F.H., Desbarats, M., Travers, R. and Labelle, L. (1992) Defective bone formation by Hyp mouse bone cells transplanted into normal mice: evidence in favour of an intrinsic osteoblast defect. J. Bone Mineral Res., 7, 215-220.

29 Ecarot, F.H., Glorieux, F.H., Desbarats, M., Travers, R. and Labelle, L. (1992) Effect of dietary phosphate deprivation and supplementation of recipient mice on bone formation by transplanted cells from normal and X-linked hypophosphataemic mice. J. Bone Mineral Res., 7, 523-530.

30 Ecarot, B., Glorieux, F.H., Desbarats, M., Travers, R. and Labelle, L. (1995) Effect of 1,25-dihydroxyvitamin D3 treatment on bone formation by transplanted cells from normal and X-linked hypophosphatemic mice. J. Bone Mineral Res., 10, 424-431.

31 Du, L., Desbarats, M., Viel, J., Glorieux, F.H., Cawthorn, C. and Ecarot, B. (1996) cDNA cloning of the murine PEX gene implicated in X-linked hypophosphataemia and evidence for expression in bone. Genomics, 36, 22-28. MEDLINE Abstract

32 Gundberg, C.M., Clough, M.E. and Carpenter, T.O. (1992) Development and validation of a radioimmunoassay for mouse osteocalcin: paradoxical response in the Hyp mouse. Endocrinology, 130, 1909-1915. MEDLINE Abstract

33 Rifas, L., Dawson, L.L., Halstead, L.R., Roberts, M. and Avioli, L.V. (1994) Phosphate transport in osteoblasts from normal and X-linked hypophosphataemic mice. Calcif. Tissue Int., 54, 505-510. MEDLINE Abstract

34 Ohshima, Y. and Gotoh, Y. (1987) Signals for the selection of a splice site in pre-mRNA. Computer analysis of splice junction sequences and like sequences. J. Mol Biol., 195, 247-259. MEDLINE Abstract

35 Rawlings, N.D. and Barrett, A.J. (1995) Evolutionary families of metallopeptidases. Methods Enzymol., 248, 183-228. MEDLINE Abstract

36 Genetics computer group (1994) Programme Manual for the Wisconsin Package Version 8. 575 Science Drive, Madison, WI.

37 Rice, P. (1995) Programme Manual for the EGCG Package. Hinxton Hall, Cambridge,UK.

38 Deleague, G. (1997) Software for Protein Analysis: Antheroplot V2.5e. Microsoft Group. Vercors, Lyon, France.

39 Roques, B.P., Fournie Zaluski, M.C., Soroca, E., Lecomte, J.M., Malfroy, B., Llorens, C. and Schwartz, J.C. (1980) The enkephalinase inhibitor thiorphan shows antinociceptive activity in mice. Nature, 288, 286-288. MEDLINE Abstract

40 Roques, B.P., Noble, F., Crine, P. and Fournie Zaluski, M.C. (1995) Inhibitors of neprilysin: design, pharmacological and clinical applications. Methods Enzymol., 248, 263-283. MEDLINE Abstract

41 Bateman, R.C.J. and Hersh, L.B. (1987) Evidence for an essential histidine in neutral endopeptidase 24.11. Biochemistry, 26, 4237-4242.

42 Llorens-Cortes, C., Giros, B. and Schwartz, J.C. (1990) A novel potential metallopeptidase derived from the enkephalinase gene by alternative splicing. J. Neurochem., 55, 2146-2148. MEDLINE Abstract

43 Iijima, H., Gerard, N.P., Squassoni, C., Ewig, J., Face, D., Drazen, J.M., Kim, Y.A., Shriver, B., Hersh, L.B. and Gerard, C. (1992) Exon 16 del: a novel form of human neutral endopeptidase (CALLA). Am. J. Physiol., 262, L725-L729. MEDLINE Abstract

44 Econs, M.J. and Drezner, M.K. (1994) Tumour induced osteomalacia-unveiling a new hormone. N. Engl. J. Med., 330, 1679-1681. MEDLINE Abstract

45 Seikaly, M.G., Browne, R.H. and Baum, M. (1994) The effect of phosphate supplementation on linear growth in children with X. Hydrolysis of theily of, andPediatrics, 94, 478-481. MEDLINE Abstract

46 Qiu, Z.Q., Tenenhouse, H.S. and Scriver, C.R. (1993) Parental origin of mutant allele does not explain absence of gene dose effect in X-linked Hyp mice. Genet Res., 62, 39-43. MEDLINE Abstract

47 Petersen, D.J., Boniface, A.M., Schranck, F.W., Rupich, R.C. and Whyte, M.P. (1992) X-linked hypophosphataemic rickets: a study with literature review of linear growth response to calcitriol and phosphate therapy. J. Bone Mineral Res., 7, 583-597.

48 Thabet, M.A., Truchina, O. and Chan, J.C. (1994) X-linked hypophosphatemia: molecular biology and treatment controversies. Acta Paediatr. Sin., 35, 180-187. MEDLINE Abstract

49 Lyon, M.F. (1988) X-chromosome inactivation and the location and expression of X-linked genes. Am. J. Hum. Genet., 42, 8-16. MEDLINE Abstract

50 Fisher, E. and Scambler, P. (1995) Human haploinsufficiency: one for sorrow two for joy. Nature Genet., 10, 135-142.

*To whom correspondence should be addressed

This page is maintained by OUP admin. Last updated Thu Mar 13 17:29:21 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Eur J EndocrinolHome page
T. Saito, Y. Nishii, T. Yasuda, N. Ito, H. Suzuki, T. Igarashi, S. Fukumoto, and T. Fujita
Familial hypophosphatemic rickets caused by a large deletion in PHEX gene
Eur. J. Endocrinol., October 1, 2009; 161(4): 647 - 651.
[Abstract] [Full Text] [PDF]

Home page
 Annals of Clinical & Laboratory ScienceHome page
J. Kim, K. H. Yang, J. S. Nam, J. R. Choi, J. Song, M. Chang, and K.-A Lee
A Novel PHEX Mutation in a Korean Patient with Sporadic Hypophosphatemic Rickets
Ann. Clin. Lab. Sci., January 1, 2009; 39(2): 182 - 187.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A. Martin, V. David, J. S. Laurence, P. M. Schwarz, E. M. Lafer, A.-M. Hedge, and P. S. N. Rowe
Degradation of MEPE, DMP1, and Release of SIBLING ASARM-Peptides (Minhibins): ASARM-Peptide(s) Are Directly Responsible for Defective Mineralization in HYP
Endocrinology, April 1, 2008; 149(4): 1757 - 1772.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
S. Liu, P. S N Rowe, L. Vierthaler, J. Zhou, and L D. Quarles
Phosphorylated acidic serine-aspartate-rich MEPE-associated motif peptide from matrix extracellular phosphoglycoprotein inhibits phosphate regulating gene with homologies to endopeptidases on the X-chromosome enzyme activity
J. Endocrinol., January 1, 2007; 192(1): 261 - 267.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
A. Syal, S. Schiavi, S. Chakravarty, V. Dwarakanath, R. Quigley, and M. Baum
Fibroblast growth factor-23 increases mouse PGE2 production in vivo and in vitro
Am J Physiol Renal Physiol, February 1, 2006; 290(2): F450 - F455.
[Abstract] [Full Text] [PDF]

Home page
 J Intensive Care MedHome page
R. Khardori
Editorial: Refeeding Syndrome and Hypophosphatemia
J Intensive Care Med, May 1, 2005; 20(3): 174 - 175.
[PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
M. Baum, O. W. Moe, J. Zhang, V. Dwarakanath, and R. Quigley
Phosphatonin washout in Hyp mice proximal tubules: evidence for posttranscriptional regulation
Am J Physiol Renal Physiol, February 1, 2005; 288(2): F363 - F370.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
A. Boccia, M. Petrillo, D. di Bernardo, A. Guffanti, F. Mignone, S. Confalonieri, L. Luzi, G. Pesole, G. Paolella, A. Ballabio, et al.
DG-CST (Disease Gene Conserved Sequence Tags), a database of human-mouse conserved elements associated to disease genes
Nucleic Acids Res., January 1, 2005; 33(suppl_1): D505 - D510.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
D. Bresler, J. Bruder, K. Mohnike, W. D Fraser, and P. S N Rowe
Serum MEPE-ASARM-peptides are elevated in X-linked rickets (HYP): implications for phosphaturia and rickets
J. Endocrinol., December 1, 2004; 183(3): R1 - R9.
[Abstract] [Full Text] [PDF]

Home page
 CROBMHome page
P. S.N. Rowe
THE WRICKKENED PATHWAYS OF FGF23, MEPE AND PHEX
Critical Reviews in Oral Biology & Medicine, September 1, 2004; 15(5): 264 - 281.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. Baum, S. Loleh, N. Saini, M. Seikaly, V. Dwarakanath, and R. Quigley
Correction of proximal tubule phosphate transport defect in Hyp mice in vivo and in vitro with indomethacin
PNAS, September 16, 2003; 100(19): 11098 - 11103.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X.-Y. Bai, D. Miao, D. Goltzman, and A. C. Karaplis
The Autosomal Dominant Hypophosphatemic Rickets R176Q Mutation in Fibroblast Growth Factor 23 Resists Proteolytic Cleavage and Enhances in Vivo Biological Potency
J. Biol. Chem., March 7, 2003; 278(11): 9843 - 9849.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
X. Bai, D. Miao, D. Panda, S. Grady, M. D. McKee, D. Goltzman, and A. C. Karaplis
Partial Rescue of the Hyp Phenotype by Osteoblast-Targeted PHEX (Phosphate-Regulating Gene with Homologies to Endopeptidases on the X Chromosome) Expression
Mol. Endocrinol., December 1, 2002; 16(12): 2913 - 2925.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
M. R. Carpinelli, I. P. Wicks, N. A. Sims, K. O'Donnell, K. Hanzinikolas, R. Burt, S. J. Foote, M. Bahlo, W. S. Alexander, and D. J. Hilton
An Ethyl-Nitrosourea-Induced Point Mutation in Phex Causes Exon Skipping, X-Linked Hypophosphatemia, and Rickets
Am. J. Pathol., November 1, 2002; 161(5): 1925 - 1933.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
S. M. Jan De Beur and M. A. Levine
Molecular Pathogenesis of Hypophosphatemic Rickets
J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2467 - 2473.
[Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
P. T. Christie, B. Harding, M. A. Nesbit, M. P. Whyte, and R. V. Thakker
X-Linked Hypophosphatemia Attributable to Pseudoexons of the PHEX Gene
J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3840 - 3844.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
I. A. Holm, A. E. Nelson, B. G. Robinson, R. S. Mason, D. J. Marsh, C. T. Cowell, and T. O. Carpenter
Mutational Analysis and Genotype-Phenotype Correlation of the PHEX Gene in X-Linked Hypophosphatemic Rickets
J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3889 - 3899.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
Y. Sabbagh, G. Boileau, L. DesGroseillers, and H. S. Tenenhouse
Disease-causing missense mutations in the PHEX gene interfere with membrane targeting of the recombinant protein
Hum. Mol. Genet., July 1, 2001; 10(15): 1539 - 1546.
[Abstract] [Full Text] [PDF]

Home page
 Arch. Dis. Child.Home page
P S N ROWE
The molecular background to hypophosphataemic rickets
Arch. Dis. Child., September 1, 2000; 83(3): 192 - 194.
[Full Text] [PDF]

Home page
 BloodHome page
S. Lee, M. Lin, A. Mele, Y. Cao, J. Farmar, D. Russo, and C. Redman
Proteolytic Processing of Big Endothelin-3 by the Kell Blood Group Protein
Blood, August 15, 1999; 94(4): 1440 - 1450.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
B. Ecarot and M. Desbarats
1,25-(OH)2D3 Down-Regulates Expression of Phex, a Marker of the Mature Osteoblast
Endocrinology, March 1, 1999; 140(3): 1192 - 1199.
[Abstract] [Full Text]

Home page
 J. Clin. Endocrinol. Metab.Home page
M. J. Econs, N. E. Friedman, P. S. N. Rowe, M. C. Speer, F. Francis, T. M. Strom, C. Oudet, J. A. Smith, J. T. Ninomiya, B. E. Lee, et al.
A PHEX Gene Mutation Is Responsible for Adult-Onset Vitamin D-Resistant Hypophosphatemic Osteomalacia: Evidence That the Disorder Is Not a Distinct Entity from X-Linked Hypophosphatemic Rickets
J. Clin. Endocrinol. Metab., October 1, 1998; 83(10): 3459 - 3462.
[Abstract] [Full Text]

Home page
 J. Clin. Endocrinol. Metab.Home page
P. H. Dixon, P. T. Christie, C. Wooding, D. Trump, M. Grieff, I. Holm, J. M. Gertner, J. Schmidtke, B. Shah, N. Shaw, et al.
Mutational Analysis of PHEX Gene in X-Linked Hypophosphatemia
J. Clin. Endocrinol. Metab., October 1, 1998; 83(10): 3615 - 3623.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
M. L. Lipman, D. Panda, H. P. J. Bennett, J. E. Henderson, E. Shane, Y. Shen, D. Goltzman, and A. C. Karaplis
Cloning of Human PEX cDNA. EXPRESSION, SUBCELLULAR LOCALIZATION, AND ENDOPEPTIDASE ACTIVITY
J. Biol. Chem., May 29, 1998; 273(22): 13729 - 13737.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. Russo, C. Redman, and S. Lee
Association of XK and Kell Blood Group Proteins
J. Biol. Chem., May 29, 1998; 273(22): 13950 - 13956.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
M. J. Econs and F. Francis
Positional cloning of the PEX gene: new insights into the pathophysiology of X-linked hypophosphatemic rickets
Am J Physiol Renal Physiol, October 1, 1997; 273(4): F489 - F498.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (76)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Rowe, P. S.
Right arrow Articles by O'Riordan, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rowe, P. S.
Right arrow Articles by O'Riordan, J. L.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?