Identification of the Syrian hamstercardiomyopathy gene
Identification of the Syrian hamster cardiomyopathy geneVincenzoNigro1,*, YasushiOkazaki2, AngelaBelsito1, GiulioPiluso1, YoichiMatsuda3, LuisaPolitano4, GiovanniNigro4, CarloVentura5, CiroAbbondanza1, Anna MariaMolinari1, DarioAcampora6, MasahikoNishimura7, Yoshihide Hayashizaki2 and Giovanni AlfredoPuca1
1Istituto di Patologia Generale e Oncologia, Facoltà di Medicina, Seconda Università degli Studi di Napoli, Larghetto S. Aniello a Caponapoli, 2, 80138Napoli,Italy,2Genome Science Laboratory, Tsukuba Life Science Center, The Institute of Physical and Chemical Research (RIKEN), 3-1-1 Koyadai, Tsukuba,Ibaraki 305,Japan,3Laboratory of Animal Genetics, School of Agricultural Sciences, Nagoya University, Chikusa,Nagoya 464-01,Japan,4Dipartimento di Internistica Clinica e Sperimentale, Facoltà di Medicina, Seconda Università degli Studi di Napoli, Piazza Miraglia, 80138Napoli,Italy,5Istituto di Chimica Biologica, Facoltà di Medicina, Università degli Studi di Sassari, viale S. Pietro 43/b, 07100 Sassari, Italy,6International Institute of Genetics and Biophysics, via Marconi 12, 80121Napoli,Italy and7Institute for Experimental Animals, Hamamatsu University School of Medicine, 3600 Handa-cho,Hamamatsu 431-31,Japan
Received December 3, 1996;Revised and Accepted January 16, 1997
The BIO14.6 hamster is a widely used model for autosomal recessive cardiomyopathy. These animals die prematurely from progressive myocardial necrosis and heart failure. The primary genetic defect leading to the cardiomyopathy is still unknown. Recently, a genetic linkage map localized the cardiomyopathy locus on hamster chromosome 9qa2.1-b1, excluding several candidate genes. We now demonstrate that the cardiomyopathy results from a mutation in the[delta]-sarcoglycan gene that maps to the disease locus. This mutation was completely coincident with the disease in backcross and F2 pedigrees. This constitutes the first animal model identified for human sarcoglycan disorders.
For at least three decades, the cardiomyopathic Syrian hamster (BIO14.6) has constituted a widely studied animal model of hypertrophic cardiomyopathy and muscular dystrophy (1 ,2 ). These animals develop widespread muscle cell necrosis in the myocardium as well as in the skeletal muscle (3 ,4 ). Hypertrophy of the remaining cardiomyocytes is followed by heart dilatation leading to ultimate failure. Several genes which cause human hypertrophic cardiomyopathy including those coding for [beta]-myosin heavy chain, [alpha]-tropomyosin, cardiac troponin T, and [beta]-myosin-binding protein C were excluded (5 ,6 ). Thus, despite a very large number of studies, thecardiomyopathy gene has not yet been identified.
In the last few years, research has concentrated upon dystrophin (7 ) and the dystrophin-associated glycoprotein complex, since a similar muscle cell necrosis occurs in Duchenne/Becker muscular dystrophy (DMD/BMD) and severe childhood autosomal recessive muscular dystrophies (SCARMD) (8 ,9 and references therein). The characterization of the dystrophin-associated complex has greatly improved our understanding of muscular dystrophies (10 -14 ). Dystrophin is a subsarcolemmal rod-shaped protein which associates with several other proteins and glycoproteins to form the dystrophin-glycoprotein complex. This is composed of two main subcomplexes: dystrophin-dystroglycan and sarcoglycan. Dystrophin-dystroglycan functions as a bridge across the muscle membrane from actin to merosin (15 ).
Sarcoglycan (SG) has been described as a complex of four transmembrane glycoproteins: a 50 kDa (A2, 50DAG, adhalin, [alpha]-SG), a 43 kDa (A3b, 43DAG, [beta]-SG), a 35 kDa (A4, 35DAG, [gamma]-SG) (8 ,15 ,16 ) and a 35 kDa ([delta]-SG) (17 ). Mutations of eachSG gene have been proved to cause autosomal recessive human limb-girdle muscular dystrophies (LGMD2) (18 ); the LGMD2C (19 ), LGMD2D (20 ,21 ), LGMD2E (22 ,23 ) and LGMD2F (24 ,25 ) are caused by [gamma]-, [alpha]-, [beta]- and [delta]-SG gene defects, respectively. In all forms, the primary loss of one SG component involves the full complex. A triplet of 59 kDa proteins, known as syntrophins (A1), a 25DAP (A5) and the human homologues of theTorpedo 87 kDa (dystrobrevins, A0), also seem to be involved in complexes with dystrophin (15 ).
Genes encoding the dystrophin-associated proteins are now considered good candidates for the hamster cardiomyopathy. In particular, adhalin ([alpha]-SG) deficiency has been revealed in the cardiomyopathic hamster muscle before the onset of myocytolysis (26 ,27 ). However, two independent studies have indicated that the [alpha]-SG deficiency is secondary, the first showing that the [alpha]-SG mRNA and cDNA sequences are normal (28 ), and the second physically mapping the [alpha]-SG gene to a chromosomal region outside the disease locus (5 ). In the latter report, we constructed a genetic linkage map of the Syrian hamster using backcross progeny and assigned the cardiomyopathy locus to the centromeric region of hamster chromosome 9qa2.1-b1 (5 ). Afterwards, the [beta]- and [gamma]-SG genes were also checked for mutations, with no result (29 ).
We analysed the skeletal and cardiac muscle from cardiomyopathic BIO14.6 hamster compared with the control F1B strain by Western blot. A rabbit polyclonal serum directed against the human [delta]-SG (17 ) specifically recognized only one 35 kDa band from the hamster muscle. This band appears to be identical to that observed using fresh homogenates from human or mouse muscle. The immunoreactivity was totally competed out with the fusion protein used to raise the serum, but not with the control proteins. In the BIO14.6 strain, we saw no 35 kDa band corresponding to the [delta]-SG in either cardiac or skeletal muscle (Fig.1 ).
Non-degenerate primer pairs were designed from the human cDNA sequence (X95191) and used in PCR to amplify overlapping fragments of the hamster [delta]-SG coding sequence (17 ). These sequences were assembled into an open reading frame (ORF), similar to the human sequence (Fig.2 ).
We next amplified the [delta]-SG cDNA from the BIO14.6 templates using hamster-specific primer pairs. Interestingly, we obtained faint [delta]-SG RT-PCR products from the BIO14.6 compared with the control hamster. RNase protection assay was then performed using a 340 nucleotide probe encompassing part of the eighth exon of hamster [delta]-SG (Fig.3 A). In the experiment shown, no [delta]-SG protection was obtained by either skeletal or cardiac muscle BIO14.6 RNA (Fig.3 B, lanes 3-4). However, after longer exposure, a faint protection was visible in BIO14.6 heart RNA, but not in skeletal muscle (not shown). These findings were constant using different RNA probes and template preparations and were confirmed by Northern blot (not shown).
We then estimated the amount of [delta]-SG mRNA in BIO14.6. A low number of PCR cycles was performed and products were blotted and hybridized to an internal primer. Results were quantified using a Phosphor Image analyser and normalized. The [delta]-SG mRNA level was always seen as <3-5% in heart (Fig.3 C), while it was negligible in skeletal muscle.
We next performed 5' rapid amplification of cDNA ends (RACE) (30 ) using reverse nested oligonucleotide primers located at the 5' end of the hamster cDNA. The [delta]-SG cDNA contains an ~200 bp sequence correctly spliced to the second exon (Fig.4 a). No difference was observed using either cardiac or skeletal muscle cDNA templates. We obtained the same data performing the RACE with different nested primers and confirmed the sequence co-linearity with genomic DNA clones. The putative first exon only comprises the 5'-untranslated region (5' UTR) with two in-frame stop codons, whereas the second exon begins with the first AUG. In contrast, in the human transcript, the start codon is located at the end of the upstream exon. The full ORF encodes a predicted 289 amino acid protein, having 95% amino acid identity with the human cDNA (Fig.2 ). In comparison, the hamster [alpha]-, [beta]- and [gamma]-SG have 88, 95 and 83% amino acid identity with the respective human sequences (29 ). Sequence comparison between the BIO14.6 and normal cardiac muscle cDNA revealed a different 5' UTR, but no mutation in the coding region.
We screened a Syrian hamster genomic DNA [lambda] phage library using the [delta]-SG cDNA as a probe. Like the human gene, the hamster [delta]-SG gene spans a very large genomic region, since most introns are exceedingly larger than single [lambda] phage clones (size 9-23 kb). We isolated several overlapping clones in the promoter region and constructed anEcoRI restriction map covering >40 kb (Fig.4 B). The 5' UTR and the putative promoter were mapped to a 2.0 kbEcoRI fragment, 24 kb from the second exon, while the minor promoter was located upstream. We used these sequences as probes in Southern blotting. In the experiment, DNA was cut withHindIII,EcoRV orEcoRI. The first exon-containing probe did not recognize the specific bands from BIO14.6 DNA (Fig.5 ).
To see if the defect in [delta]-SG protein and reduction in [delta]-SG mRNA expression level could be the primary cause of the cardiomyopathy, we performed fluorescencein situ hybridization (FISH) analysis. Cloning of the [delta]-SG gene and the probes used are described in Materials and Methods and Figure4 B. FISH analysis revealed that the [delta]-SG gene is located on chromosome 9qa2.1-b1 where the Syrian hamster cardiomyopathy locus has been mapped (5 ) (Fig.6 ).
We had previously constructed a whole genetic map of the Syrian hamster using 72 backcross progeny (5 ). (ACN*BIO14.6) F1 was mated to BIO14.6 and the backcross progeny were produced. The phenotypes of progeny (cardiomyopathic or normal) were at an ~1:1 ratio, following the Mendelian rule. The linkage analysis using the (ACN*BIO14.6) F1*BIO14.6 backcross pedigree (n = 72) and F2 pedigree (n = 131) showed that the absence of 2.0 kbEcoRI fragment containing the first exon was completely coincident with the mutant phenotype (Fig.7 ). This evidence strongly suggests that the [delta]-SG gene is the primary cause of the hamster cardiomyopathy.
Here we show that [delta]-SG protein is undetectable in the cardiomyopathic hamster muscle. This is associated with a strong reduction in [delta]-SG mRNA levels. Our findings indicate that a deletion occurs in the [delta]-SG regulatory sequences and first exon. To verify whether this is the primary cause of the BIO14.6 disease, we used genetic analyses. FISH localized the[delta]-SG gene to chromosome 9qa2.1-b1, where the cardiomyopathic locus has been mapped (5 ). Analysis with the backcross (n= 72) and F2 (n = 131) pedigrees demonstrated that the deletion of the first exon is completely coincident with the mutant phenotype. These data demonstrate that the [delta]-SG gene is the primary causative gene for the Syrian hamster cardiomyopathy.
The residual [delta]-SG transcription in BIO14.6 cardiac muscle is produced by a weak alternative promoter and first exon (Y08839) located upstream from the deleted region. This promoter is also used in the normal hamster heart (unpublished data).
The BIO14.6 hamster has been a historical model for cardiomyopathy. Now it is the first animal model reported for a sarcoglycanopathy, which represents a documented example of anSG gene mutation associated with an autosomal recessive cardiomyopathy. In most human sarcoglycanopathies, cardiac function is spared (31 ,32 ). In the case of dystrophin gene mutations, in contrast, cardiac damage is very common and a major factor in reducing life expectancy, particularly in BMD patients and in female carriers of DMD/BMD (33 -35 ). Interestingly, an [alpha]-SG negative staining has been observed in the heart transplanted from a 13-year-old boy with severe cardiomyopathy (36 ). Since no [alpha]-SG gene mutation has been reported for that patient, it may be interesting to investigate whether [delta]-SG gene mutations also lead to human cardiomyopathies.
The observation that SG defects affect cardiac muscle less than dystrophin mutations has also been correlated with the different expression pattern of dystrophin mRNA. It may be noteworthy that [beta]-SG and [delta]-SG, resembling dystrophin, are expressed in skeletal, cardiac and smooth muscle, while [beta]-SG is also expressed in non-muscle cells. SG proteins in skeletal muscle are found together in equimolar ratio (16 ,37 ). In other tissues, whether the four SG components are associated in a standard functional array is still unknown. One can hypothesize that the differences in the tissue-specific expression may affect different arrangements of these SGs. This might explain why the hamster[delta]-SG mutation mainly affects the heart function even if the [delta]-SG protein is absent in both skeletal and cardiac muscle. In LGMD2F, skeletal muscle is more involved, but cardiac symptoms might be mitigated by limitation of heart work load in patients confined to wheelchairs. Finally, the existence of LGMD2F patients with prevailing cardiac damage cannot be excluded.
Interestingly, the mutation described is a deletion of putative regulatory sequences in a gene mainly involved in muscular dystrophy. This situation is comparable with the one described by Muntoniet al. (38 ,39 ) in X-linked dilated cardiomyopathy. This condition is, in fact, associated with a deletion in the dystrophin muscle promoter and first exon. Recently, a transcriptional enhancer in this same region of the human dystrophin gene has been identified (40 ). It will be interesting to determine in both conditions whether the deleted regions contain cardiac- and/or stage-specific regulatory sequences.
Our results lend significant support to a specific role for [delta]-SG in the cardiac dystrophin-associated complex. However, the function of [delta]-SG within the complex remains obscure. Further studies on SG expression in human cardiomyopathies are necessary and a still larger use of this hamster model may have an impact on therapy.
BIO14.6 cardiomyopathic Syrian hamsters were purchased from Bio Breeders, Fitchburg, MA. Male F1B control golden Syrian hamsters were obtained from Charles River (Italy). Animals were sacrificed in accordance with institutional guidelines. Backcross progeny were produced from BIO14.6 (B) and an inbred strain ACN (A) using (ACN-BIO14.6) F1 females*BIO14.6 males (ABB,n = 72). (ACN*BIO14.6) F2 progeny (n = 131) were also produced and genotyped. Phenotype was confirmed by the measurement of serum creatine phosphokinase (CPK) level at 60 and 90 days of age, and by the microscopic examination of heart, tongue and skeletal muscle at 90 days of age.
Induction and purification of fusion proteins and antibody production against [delta]-SG were performed as described (17 ).
Hamster frozen muscular tissue was crushed in a pre-cooled mortar. Approximately 50 mg of sample were added to 200 µl of loading buffer [8 M urea, 125 mM Tris-HCl pH 6.8, 4% SDS, 100 mM dithiothreitol (DTT) and 0.001% bromophenol blue], boiled for 3 min and centrifuged to remove SDS-insoluble proteins. Samples were run on 11% SDS-PAGE and transferred to nitrocellulose sheets. Membranes were incubated for 2 h at room temperature with rabbit antiserum diluted 1:4.000 in phosphate-buffered saline (PBS) with 3% non-fat milk, 0.05% Tween-20 and 0.05% NP-40. After washing, membranes were incubated for 1 h with peroxidase-conjugated anti-rabbit IgG diluted 1:10 000 in PBS with 0.5% non-fat milk, 0.05% Tween-20 and 0.05% NP-40. Immunoreactive bands were visualized by ECL (Amersham).
Total cardiac and skeletal muscle RNA from Syrian hamster and BIO14.6 was isolated and reverse transcribed according to standard procedures (41 ). Low stringency PCR amplifications were performed in a Robocycler Gradient 96 (Stratagene), which allows the simultaneous use of 12 different annealing temperatures using a 10 µl reaction, 3 µM of each primer, 3.5 mM dNTPs, 5 mM MgCl2, 100 mM KCl and 0.5 U AmpliTaq polymerase (Perkin Elmer). All the other PCR amplifications were performed in a thermal cycler PTC-100 (MJ Research) as described (42 ). Most of the PCR products generated by these primer pairs were specific. Screening of the genomic library was performed according to standard procedures (41 ). We screened ~500 000 plaques of Golden Hamster [lambda] FIX II library (Stratagene). Duplicate sets of filters were hybridized in 6* SSC and 40% formamide at 42oC with the32P-labelled 0.8 kb probe(108 c.p.m.). Washes were carried out at 67oC in 0.15* SSC 0.1% SDS. More than 100 positive clones were classified according to the hybridization with different [delta]-SG oligonucleotides. Hyperfilm MP (Amersham) was used for most applications. We confirmed the cDNA sequence and the exon-intron boundaries at the same positions of the human [delta]-SG gene.
5' RACE was performed from 1 µg of total RNA from skeletal or cardiac muscle. Reverse transcriptase (BRL) was from the semi-random oligo 5'-NNNNNNSS-3'. After treatment with terminal transferase (BRL) in the presence of dATP, nested amplifications were performed starting from specific reverse primers located at positions: 290R (CGGGACTGGATTTCTTTGGCGTAC), 193R (CAATTGTGAAGTTCATGACTTTGAGAATC), 160R (TGGTCATGGCCAAGTTCACCAGGAT), 90R (CCAGCCATAAATCCCCACTTTGTA) or 24R (AGAGTACTGTTCCTGAGGCATCTC) of the cDNA sequence together with standard RACE primers. The following buffer (JD) was used for all PCR amplifications: 30 mM Tris, 8 mM HEPES, 8% glycerol, 1% dimethylsulphoxide (DMSO), 2 mM DTT, 5 mM MgCl2, 20 mM potassium L-glutamate (Fluka), 60 mM ammonium acetate (Fluka), 0.002% gelatin.
The direct R-banding FISH method was used for chromosomal assignment of the [delta]-SG gene. Preparation of R-banded chromosomes and FISH were performed as described by Matsudaet al. (43 ), and chromosomal identification was followed as in Liet al. (44 ).
Genomic DNA clones inserted in pBS (SK+) vector were used as biotinylated probes. The probes were labelled by nick-translation with biotin-16-dUTP (Boehringer Mannheim). The labelled DNA fragments were ethanol precipitated with a 100-fold excess of sonicated whole genomic DNA, salmon sperm DNA and tRNA and then denatured at 75oC in 100% formamide. The denatured probe was mixed with an equal volume of hybridization solution to make a final concentration of 50% formamide, 2* SSC, 10% dextran sulphate and 2 mg/ml bovine serum albumin (BSA, Sigma). Each 20 µl mixture containing 250 ng of labelled DNA was put onto a denatured slide, covered with Parafilm and incubated overnight at 37oC. The slides were washed for 20 min in 50% formamide in 2* SSC at 37oC and in 2* SSC and 1* SSC for 20 min each at room temperature. After rinsing in 4* SSC, they were incubated under coverslips with fluoresceinated avidin (Vector Laboratories) at a 1:500 dilution in 1% BSA/4* SSC for 1 h at 37oC. After washing, the slides were stained with 0.75 mg/ml propidium iodine. Excitation at a wavelength of 450-490 nm (Nikon filter set B-2A) and near 365 nm (UV-2A) was used for observation of R-banded and G-banded chromosomes, respectively. Kodak Ektachrome ASA100 films were used for microphotography.
We thank Andrea Ballabio for comments on the manuscript and the Bioinformatic and cDNA Library Core Facilities at TIGEM, Milan. We thank Francesco Muntoni, Mayana Zatz and Piero Carninci for encouragement. G.P. was supported by UILDM, Italy. This research was supported by grants to G.A.P. from the A.I.R.C, MURST 40% and 60%, and by a Grant-in-Aid for Scientific Research on Priority Areas from The Ministry of Education, Science and Culture, Japan to Y.O. We gratefully thank the financial support of Telethon, Italy (Grant no. 899).
1 Homburger, F., Baker, J.R., Nixon, C.W. and Whitney, R. (1962) Primary, generalized polymyopathy and cardiac necrosis in an inbred line of Syrian hamsters. Med. Exp., 6, 339-345.
2 Homburger, F. et al. (1963) Further morphologic and genetic studies on dystrophy-like primary myopathy of Syrian hamsters. Fed. Proc., 22, 195.
3 Bajusz, E. and Homburger, F. (1966) Myopathies: a meeting report. Science, 152, 1112-1113.
4 Gertz, E.W. (1973) Animal model of human disease: myocardial failure, muscular dystrophy (cardiomyopathic Syrian hamster). Am. J. Pathol., 70, 151-154.MEDLINE Abstract
5 Okazaki, Y., Okuizumi, H., Ohsumi, T., Nomura, O., Takada, S., Kamiya, M., Sasaki, N., Matsuda, Y., Nishimura, M., Tagaya, O., Muramatsu, M. and Hayashizaki, Y. (1996) A genetic linkage map of the Syrian hamster and localization of cardiomyopathy locus on chromosome 9qa2.1-b1 using RLGS spot-mapping. Nature Genet., 13, 87-90.MEDLINE Abstract
6 Takada, S., Okazaki, Y., Kamiya, M., Ohsumi, T., Nomura, O., Okuizumi, H., Sasaki, N., Shibata, H., Mori, M., Nishimura, M., Muramatsu, M., Hayashizaki, Y. and Matsuda, Y. (1996) Five candidate genes for hamster cardiomyopathy were not mapped on the cardiomyopathy locus by FISH analysis. DNA Res., 3, 273-276.MEDLINE Abstract
7 Hoffman, E.P., Brown, R.H., Jr and Kunkel, L.M. (1987) Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell, 51, 919-928.MEDLINE Abstract
8 Ozawa, E., Yoshida, M., Suzuki, A., Mizuno, Y., Hagiwara, Y. and Noguchi, S. (1995) Dystrophin-associated proteins in muscular dystrophy. Hum. Mol. Genet., 4, 1711-1716.MEDLINE Abstract
10 Campbell, K.P. and Kahl, S.D. (1989) Association of dystrophin and an integral membrane glycoprotein. Nature, 338, 259-262.MEDLINE Abstract
11 Yoshida, M. and Ozawa, E. (1990) Glycoprotein complex anchoring dystrophin to sarcolemma. J. Biochem., 108, 748-752.MEDLINE Abstract
12 Ervasti, J.M., Ohlendieck, K., Kahl, S.D., Gaver, M.G. and Campbell, K.P. (1990) Deficiency of a glycoprotein component of the dystrophin complex in dystrophic muscle. Nature, 345, 315-319.MEDLINE Abstract
13 Ervasti, J.M. and Campbell, K.P. (1991) Membrane organization of the dystrophin-glycoprotein complex. Cell, 66, 1121-1131.MEDLINE Abstract
14 Matsumura, K., Tomé, F.M.S., Collin, H., Azibi, K., Chaouch, M., Kaplan, J.-C., Fardeau, M. and Campbell, K.P. (1992) Deficiency of the 50K dystrophin-associated glycoprotein in severe childhood autosomal recessive muscular dystrophy. Nature, 359, 320-322.MEDLINE Abstract
15 Tinsley, J.M., Blake, D.J., Zuellig, R.A. and Davies, K.E. (1994) Increasing complexity of the dystrophin-associated protein complex. Proc. Natl Acad. Sci. USA, 91, 8307-8313.MEDLINE Abstract
16 Yoshida, M., Suzuki, A., Yamamoto, H., Noguchi, S., Mizuno, Y. and Ozawa, E. (1994) Dissociation of the complex of dystrophin and its associated proteins into several unique groups by n-octyl [beta]-D-glucoside. Eur. J. Biochem., 222,1055-1061.MEDLINE Abstract
17 Nigro, V., Piluso, G., Belsito, A., Politano, L., Puca, A.A., Papparella, S., Rossi, E., Viglietto, G., Esposito, M.G., Abbondanza, C., Medici, N., Molinari, A.M., Nigro, G. and Puca, G.A. (1996) Identification of a novel sarcoglycan gene at 5q33 encoding a sarcolemmal 35 kDa glycoprotein. Hum. Mol. Genet., 5, 1179-1186.MEDLINE Abstract
18 Bushby, K.M.D. and Beckmann, J.S. (1995) The limb-girdle muscular dystrophies-proposal for a new nomenclature. Neuromusc. Disord., 5, 337-343.
19 Noguchi, S., McNally, E.M., Ben Othmane, K., Hagiwara, Y., Mizuno, Y., Yoshida, M., Yamamoto, H., Bönnemann, C.G., Gussoni, E., Denton, P.H., Kyriakides, T., Middleton, L., Hentati, F., Ben Hamida, M., Nonaka, I., Vance, J.M., Kunkel, L.M. and Ozawa, E. (1995) Mutations in the dystrophin-associated protein [gamma]-sarcoglycan in chromosome 13 muscular dystrophy. Science, 270, 819-822.MEDLINE Abstract
20 Roberds, S.L., Leturcq, F., Allamand, V., Piccolo, F., Jeanpierre, M., Anderson, R.D., Lim, L.E., Lee, J.C., Tomé, F.M.S., Romero, N.B., Fardeau, M., Beckmann, J.S., Kaplan, J.-C. and Campbell, K.P. (1994) Missense mutations in the adhalin gene linked to autosomal recessive muscular dystrophy. Cell, 78, 625-633.MEDLINE Abstract
21 Piccolo, F., Roberds, S.L., Jeanpierre, M., Leturcq, F., Azibi, K., Beldjord, C., Carrié, A., Récan, D., Caouch, M., Reghis, A., El Kerch, F. et al. (1995) Primary adhalinopathy: a common cause of autosomal recessive muscular dystrophy of variable severity. Nature Genet., 10, 243-245.MEDLINE Abstract
22 Lim, L.E., Duclos, F., Broux, O., Bourg, N., Sunada, Y., Allamand, V., Meyer, J., Richard, I., Moomaw, C., Slaughter, C., Tomé, F.M.S., Fardeau, M., Jackson, C.E., Beckmann, J.S. and Campbell, K.P.(1995) [beta]-Sarcoglycan: characterization and role in limb-girdle muscular dystrophy linked to 4q12. Nature Genet., 11, 257-265.MEDLINE Abstract
23 Bönnemann, C.G., Modi, R., Noguchi, S., Mizuno, Y., Yoshida, M., Gussoni, E., McNally, E.M., Duggan, D., Angelini, C., Hoffman, E.P., Ozawa, E. and Kunkel, L.M. (1995) [beta]-Sarcoglycan (A3b) mutations cause autosomal recessive muscular dystrophy with loss of the sarcoglycan complex. Nature Genet., 11, 266-273.MEDLINE Abstract
24 Passos-Bueno, M.R., Moreira, E.S., Vainzof, M., Marie, S.K. and Zatz, M. (1996) Linkage analysis in autosomal recessive limb-girdle muscular dystrophy (AR LGMD) maps a sixth form to 5q33-34 (LGMD2F) and indicates that there is at least one more subtype of AR LGMD. Hum. Mol. Genet., 5, 815-820.MEDLINE Abstract
25 Nigro, V., Moreira, E.S., Piluso, G., Vainzof, M., Belsito, A., Politano, L., Puca, A.A., Passos-Bueno, M.R. and Zatz, M. (1996) Autosomal recessive limb-girdle muscular dystrophy, LGMD2F, is caused by a mutation in the [delta]-sarcoglycan gene. Nature Genet., 14, 195-198. MEDLINE Abstract
26 Roberds, S.L., Ervasti, J.M., Anderson, R.D. et al. (1993) Disruption of the dystrophin-glycoprotein complex in the cardiomyopathic hamster. J. Biol. Chem., 268, 11496-11499.MEDLINE Abstract
27 Mizuno, Y., Noguchi, S., Yamamoto, H., Yoshida, M., Nonaka, I., Hirai, S. and Ozawa, E. (1995) Sarcoglycan complex is selectively lost in dystrophic hamster muscle. Am. J. Pathol., 146, 530-536. MEDLINE Abstract
28 Roberds, S.L. and Campbell, K.P. (1995) Adhalin mRNA and cDNA sequence are normal in the cardiomyopathic hamster. FEBS Lett., 364, 245-249.MEDLINE Abstract
29 McNally, E.M., Bönnemann, C.G., Kunkel, L.M. and Bhattacharya, S.K. (1996) Deficiency of adhalin in a patient with muscular dystrophy and cardiomyopathy. N. Engl. J. Med., 334, 1610-1611.MEDLINE Abstract
30 Frohman, M.A., Dush, M.K. and Martin G.R. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl Acad. Sci. USA, 85, 8998-9002.MEDLINE Abstract
31 McNally, E.M., Duggan, D., Gorospe, J.R., Bönnemann, C.G., Fanin, M., Pegoraro, E., Lidov, H.G.W., Noguchi, S., Ozawa, E., Finkel, R.S., Cruse, R.P., Angelini, C., Kunkel, L.M. and Hoffman, E.P. (1996) Mutations that disrupt the carboxyl-terminus of [gamma]-sarcoglycan cause muscular dystrophy. Hum. Mol. Genet., 5, 1841-1847.MEDLINE Abstract
32 Bönnemann, C.G., Passos-Bueno, M.R., McNally, E.M., Vainzof, M., Moreira, E.S., Marie, S.K., Pavanello, R.C.M., Noguchi, S., Ozawa, E., Zatz, M. and Kunkel, L.M. (1996) Genomic screening for [beta]-sarcoglycan gene mutations: missense mutations may cause severe limb-girdle muscular dystrophy type 2E. Hum. Mol. Genet., 5, 1953-1961.MEDLINE Abstract
33 Nigro, G., Comi, L.I., Politano, L. and Bain, R.J.I. (1990) The incidence and evolution of cardiomyopathy in Duchenne muscular dystrophy. Int. J. Cardiol., 26, 271-277.MEDLINE Abstract
34 Nigro, G., Comi, L.I., Politano, L., Limongelli, F.M., Nigro, V., De Rimini, M.L., Giugliano, M.A.M., Petretta, V.R., Passamano, L., Restucci, B., Fattore, L., Toebloev, K., Comi, L., De Luca, F., Raia, P. and Esposito, M.G. (1995) Evaluation of the cardiomyopathy in Becker muscular dystrophy. Muscle and Nerve, 18, 283-291.MEDLINE Abstract
35 Politano, L., Nigro, V., Nigro, G., Petretta, V.R., Passamano, L., Papparella, S., Di Somma, S. and Comi, L.I. (1996) Development of cardiomyopathy in female carriers of Duchenne and Becker muscular dystrophies. J. Am. Med. Assoc., 275, 1335-1338.
36 Fadic, R., Sunada, Y., Waclawik, A.J., Campbell, K.P. and Lotz, B.P. (1996) Deficiency of a dystrophin-associated glycoprotein (adhalin) in a patient with muscular dystrophy and cardiomyopathy. N. Engl. J. Med., 334, 362-366.MEDLINE Abstract
37 Beckmann, J.S. (1996) Genetic studies and molecular structures: the dystrophin associated complex. Hum. Mol. Genet., 5, 865-867.MEDLINE Abstract
38 Muntoni, F., Cau, M., Congiu, R., Ganau, A., Arvedi, G., Mateddu, A., Marrosu, M.G., Cianchetti, C., Realdi, A., Cao, A. and Melis, M.A. (1993) Deletion of the dystrophin muscle-promoter region associated with X-linked dilated cardiomyopathy. N. Engl. J. Med., 329, 921-925.MEDLINE Abstract
39 Muntoni, F., Wilson, L., Wang, Y., Marrosu, M.G., Cianchetti, C., Ganau, A., Mestroni, L., Dubowitz, V and Sewry, C.A.(1995) A mutation in the dystrophin gene specifically affecting dystrophin expression in the heart. J. Clin. Invest., 96, 693-699.MEDLINE Abstract
40 Klamut, H.J., Bosnoyan-Collins, L.O., Worton, R.G., Ray, P.N. and Davis, H.L. (1996) Identification of a transcriptional enhancer within muscle intron 1 of the human dystrophin gene. Hum. Mol. Genet., 5, 1599-1606.MEDLINE Abstract
41 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
42 Nigro, V., Politano, L., Nigro, G., Colonna Romano, S., Molinari, A.M. and Puca, G.A. (1992) Detection of a nonsense mutation in the dystrophin gene by multiple SSCP. Hum. Mol. Genet., 1, 517-520. MEDLINE Abstract
43 Matsuda, Y. and Chapman, V.M. (1995) Application of fluorescence in situ hybridization in genome analysis of the mouse. Electrophoresis, 16, 261-272.MEDLINE Abstract
44 Li, S., Pathak, S. and Hsu, T.C. (1982) High resolution G-banding patterns of Syrian hamster chromosomes. Cytogenet. Cell Genet., 33, 295-302.MEDLINE Abstract
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Thu Mar 13 17:29:21 GMT 1997. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
