Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (140)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Litt, M.
Right arrow Articles by Maumenee, I. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Litt, M.
Right arrow Articles by Maumenee, I. H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 665-668

Autosomal dominant cerulean cataract is associated with a chain termination mutation in the human [beta]-crystallin gene CRYBB2
Introduction
Results
Discussion
Materials And Methods
   Family members
   Vectorette PCR
   DNA sequencing
   Restriction endonuclease digestions
Acknowledgements
References

Autosomal dominant cerulean cataract is associated with a chain termination mutation in the human [beta]-crystallin gene CRYBB2

Autosomal dominant cerulean cataract is associated with a chain termination mutation in the human [beta]-crystallin gene CRYBB2 Michael Litt1,*, Roque Carrero-Valenzuela1, Dante M. LaMorticella1, Dennis W. Schultz1, Thomas N. Mitchell3, Patricia Kramer1,2 and Irene H. Maumenee3

1Department of Molecular and Medical Genetics and 2Department of Neurology, Oregon Health Sciences University, Portland, OR 97201, USA and 3Center for Hereditary Eye Diseases, Johns Hopkins University, Baltimore, MD 21287, USA

Received October 25, 1996; Revised and Accepted January 31, 1997

DDBJ/EMBL/GenBank accession nos U72400-U72404

Congenital cataracts are a common major abnormality of the eye that frequently cause blindness in infants. At least a third of all cases are familial; autosomal dominant congenital cataract (ADCC) appears to be the most common familial form in the Western world. Cerulean cataracts have peripheral bluish and white opacifications in concentric layers with occasional central lesions arranged radially. Although the opacities may be observed during fetal development and childhood, usually visual acuity is only mildly reduced until adulthood, when lens extraction is generally necessary. We have been studying a family (ADCC-1) with cerulean blue ADCC, in which the affected daughter of a first cousin mating was presumed to be homozygous for the cataract gene. Recently, we mapped an ADCC gene in this family to a region of chromosome 22 containing three [beta]-crystallin genes. Here we report that a chain-termination mutation in CRYBB2 is associated with ADCC in this family.

INTRODUCTION

Congenital cataracts are a common major abnormality of the eye that frequently cause blindness in infants (1 ). At least a third of all cases are familial (2 ); autosomal dominant congenital cataract (ADCC) appears to be the most common familial form in the Western world (3 ). Ten distinct loci in humans have been identified for 10 phenotypically distinct forms of ADCC (4 -14 ). Cerulean cataracts have peripheral bluish and white opacifications in concentric layers with occasional central lesions arranged radially. Although the opacities may be observed during fetal development and childhood, usually visual acuity is only mildly reduced until adulthood, when lens extraction is generally necessary. Bodker et al. (15 ) described a family (ADCC-1) with cerulean blue ADCC, in which the affected daughter of a first cousin mating was presumed to be homozygous for the cataract gene.

Crystallin genes, which encode major structural proteins in the lens, are obvious candidate genes for cataracts. Four reports of mutations in crystallin genes associated with hereditary cataracts have been published. Chambers and Russell (16 ) found an in-frame deletion of 12 nucleotides in the [beta]B2 crystallin gene that was associated with inherited autosomal dominant cataract in the Philly mouse. In the human autosomal dominant Coppock-like cataract, activation of a [gamma]-crystallin pseudogene by a cluster of sequence changes in the promoter region produces a 10-fold increase in the expression of mRNA encoding a truncated polypeptide (17 ). A splice site mutation in the [beta]-crystallin gene causes an AD cataract in the guinea pig (18 ) and a single nucleotide deletion in the [gamma]E-crystallin gene of the Elo mouse mutant causes AD cataract and microphthalmia (19 ).

Recently, we mapped an ADCC gene in family ADCC-1 to a region of chromosome 22 containing the three [beta]-crystallin genes CRYBB2, CRYBB3 and CRYBB2P1 (14 ). In humans, one of the linked crystallin genes-CRYBB2-encodes a major protein component of the adult lens, whereas the second-CRYBB3-although expressed embryonically, is not detectable postnatally (20 ). [beta]-Crystallins are `composed of two similar domains linked by a connecting peptide, with each domain in turn comprised of two similar Greek key motifs' (21 ). Each Greek key motif is constructed from four antiparallel [beta]-sheets. The basic members of this family-CRYBB1, CRYBB2 and CRYBB3-also have both N- and C-terminal extensions (21 ). The cDNA sequence of the human CRYBB2 gene has been determined (22 ) but little is known about intron sequences or sizes for this gene.

RESULTS

Of the three crystallin genes in the critical region, only CRYBB2 is strongly expressed in the adult lens. Hence, we chose this geneas an initial target for mutation screening. Although the exon/intron structure of CRYBB2 has not been described, it seemed likely that it was similar to that of the rat [beta]B1-crystallin gene, with a 5' terminal non-coding exon and five coding exons (23 ). Since studies of other crystallin genes have shown that the four conserved `Greek key' motifs are each encoded by a separate exon (24 ), we assumed that this would also hold for CRYBB2 and we predicted the positions of introns accordingly. To design primers for amplification of the coding exons and their flanking regions, we sequenced the intronic regions near predicted exon-intron junctions. Since CEPH YAC M686F7 contains an STS for CRYBB2, but not for CRYBB2P1 (25 ), we obtained templates for sequencing by vectorette PCR (26 ) of this YAC, using the published CRYBB2 cDNA sequence (22 ) for design of gene-specific primers. Sequences flanking the five coding exons of CRYBB2have been deposited in GenBank with accession numbers U72400-U72404. In all cases, the positions of exon-intron boundaries agreed with those predicted assuming homology with the rat [beta]B1-crystallin gene. Primers used for amplification of exons and their flanking regions are described in Table 1 . The sizes of PCR products obtained with these primer sets were the same when genomic DNA and YAC M686F7 DNA were used as templates, indicating that the YAC insert was colinear with the genome. The sequences of the products obtained from genomic DNA were consistent with the published cDNA sequence (22 ) and not with those of the CRYBB2 pseudogene (20 ), indicating that the primers specifically amplified the expressed gene.


Figure 1. DNA sequences of unaffected (WT) and homozygous affected (102) individuals illustrating the mutation in CRYBB2. The DNA sequences shown are those of the antisense strands. The G -> A transition produces a premature stop codon and a truncated protein.

PCR products containing the coding region of exon 6 from the affected homozygote (individual #102) in family ADCC-1 and from an unaffected unrelated individual were sequenced directly. Individual 102 had a G -> A transition in the antisense strand at the position of the first base of the codon normally encoding glutamine residue 155 (Fig. 1 ). This mutation creates a stop codon which truncates the [beta]B2-crystallin polypeptide by 51 residues (Fig. 2 ). The mutation also creates a BfaI site, allowing convenient testing for its presence in family members. Figure 3 shows BfaI digests of seven members of family ADCC-1. The sizes of the BfaI fragments from the normal and mutant alleles agree with those predicted from the sequence shown in Figure 2 , i.e., 237 bp and 116 + 121 bp, respectively. The five affected family members shown had the mutation whereas the two unaffected members did not. Individual #102, previously shown to be homozygous for the markers flanking the disease locus, was also homozygous for the mutant allele. All of the 13 additional family members tested who were heterozygous for the disease-bearing chromosome as determined by linkage analysis (14 ), were also heterozygous for the mutation. None of the 12 additional family members tested who lacked this chromosome had the mutation. In addition, all 31 unrelated unaffected individuals (CEPH grandparents) tested lacked the mutation (data not shown).

DISCUSSION

We have described a family with ADCC associated with a chain termination mutation in the human CRYBB2 gene which is predicted to give rise to a [beta]B2-crystallin polypeptide lacking 51 of the 55 amino acid residues normally encoded by exon 6. This is the first report of a mutation in a highly expressed human crystallin gene.

Table 1 . Primers used for amplification of CRYBB2 exons and flanking regions
Exon

 Primers

 Product size (bp)
2

 N3B: TGCTCTCTTTCTTTGAGTAGACCTC

 385
 

 I25': CCCATTTTACAGAAGGGCAAC

  
3

 I23': ACCCTTCAGCATCCTTTGG

 314
 

 I35': GCAGACAGGAGCAAGGGTAG

  
4

 I33': GCTTGGAGTGGAACTGACCTG

 244
 

 I45': GGCAGAGAGAGAAAGTAGGATGATG

  
5

 I43': GCCCCCTCACCCATACTC

 242
 

 I55': CCCCAGAGTCTCAGTTTCCTG

  
6

 I5E6: CCTAGTGGCTTATGGATGCTC

 347
 

 704R: TCTTCACTTGGAGGTCTGGAG

  


Figure 2. Sequence of CRYBB2 exon 6 and upstream intronic region. Exon sequences are capitalized. Amino acid sequences are shown in single letter code; * indicates a stop codon. Exon sequences and amino acid residues are numbered according to ref. 21. Sequences used to design primers I5E6 and 704r for amplification of exon 6 are singly underlined. The sequence used to design the nested sequencing primer 596r is doubly underlined. The gene-specific primer 529r used for vectorette PCR is indicated by a dotted underline. The C -> T transition at base 14 of exon 6 (position 475 of the sequence shown) is indicated in boldface. This mutation converts a CAG glutamine codon to an in-frame stop codon. It also creates a BfaI restriction site (CTAG). An additional BfaI site at positions 2-5 is overlined.


Figure 3. Agarose gel of BfaI digests of PCR products obtained with primers I5E6 and 596r (Fig. 2) from seven members of family ADCC-1. Family members tested are indicated by dots in the pedigree above the gel. Lane 1 contains a 100 bp ladder size marker. The importance of [beta]-crystallins in the maintenance of lens transparency was clearly demonstrated by the analysis of the Philly mouse hereditary cataract model. These mice have a mutation resulting in the deletion of four amino acids near the C-terminus of [beta]B2-crystallin (16 ). Loss of these amino acids was predicted to prevent the normal oligomerization of the [beta]B2-crystallin subunits, since these residues had been shown, by the X-ray crystallographic structure of the [beta]B2 homodimer of bovine lens, to be involved in the stabilization of the native tertiary structure of [beta]B2-crystallin (27 ). The mutant CRYBB2 gene which we have found in family ADCC-1 encodes a [beta]B2-crystallin polypeptide which is more severely altered than that found in the Philly mouse. Failure of this truncated protein to oligomerize with itself or with other crystallins could cause its precipitation, which would be consistent with its dominant phenotype, resulting in cataracts.

Although all 31 unaffected unrelated individuals screened lacked the C475T alteration, this sample size is too small to rule out the possibility that this alteration could occur in 1-2% of the normal population. However, because the alteration is predicted to cause a severe functional deficit in a major lens crystallin polypeptide, it is likely that it is the causative mutation in family ADCC-1 rather than just a polymorphism in strong linkage disequilibrium with the causative mutation.

The homozygous affected individual #102 required extraction of cataracts at age 5 and lost all visual perception by adolescence. Her heterozygous affected relatives had a milder disease, generally requiring cataract extraction between 20 and 40 years of age (14 ). Hence, as previously discussed (14 ) individual #102 represents a rare example of homozygosity for a dominant mutation.

MATERIALS AND METHODS

Family members

The clinical diagnoses of members of family ADCC-1 and the pedigree of this family are given in refs 14 and 15 .

Vectorette PCR

CEPH YAC M686F7 containing CRYBB2 was purchased from Research Genetics. A region of this YAC containing the exon/intron junction upstream of exon 6 was amplified using vectorette PCR (26 ). Vectorette oligos VCT.TOP: pAAGGAGAGGACGCTGTCTGTCGAGGAAGGAACGGACGAGAGAAGGGAGAG and VCT.Bot: CTCTCCCTTCTCGAATCGTAACCGTCGACGAGAATCGCTGTCCTCTCCTT were annealed and ligated to the AluI digested YAC. Following removal of excess oligos by ultrafiltration, PCR was performed using the vectorette primer VCT.IN: AACCGTCGACGAGAATCGCTG and the gene specific primer 529R: CCTTGTAGTCTCCCTTCTCCAG (Fig. 2 ) to obtain a product containing intronic sequences flanking the 5' end of exon 6.

DNA sequencing

The gel-purified PCR products containing the 5' end of exon 6 were sequenced on an ABI 373 sequencer using vectorette or gene-specific primers and the Amplitaq FS cycle sequencing kit with dye-labeled terminators. Similar methodology was used to obtain sequences flanking the other exons. The flanking sequences obtained together with published sequences of the 5' and 3' untranslated regions (22 ) were used to design PCR primers for amplification of the coding regions of specific exons (Table 1 ). Three temperature `touchdown' PCR was performed using an initial annealing temperature of 70oC which was decreased by 0.5oC in each of the first 30 cycles, then maintained at 55oC for 16 more cycles. Each cycle consisted of a 10 s, 94oC denaturing step, a 30 s annealing step, and a 1 min, 72oC extension. PCR products obtained from unaffected and affected members of family ADCC-1 with these primers were gel purified and sequenced as described above.

Restriction endonuclease digestions

PCR products obtained with primers I5E6 and 596r (Fig. 2 ) were gel purified, digested with BfaI (New England Biolabs) according to the manufacturer's instructions and run on a 2% agarose gel.

ACKNOWLEDGEMENTS

This work was funded by NIH grant RO1-HG00022 to M.L. and a grant from the Medical Research Foundation of Oregon to P.K.

REFERENCES

1 Lund, A., Eiberg, H., Rosenburg, T. and Warburg, M. (1992) Autosomal dominant congenital cataract: Linkage relations, clinical and genetic heterogeneity. Clin. Genet., 41, 65-69. MEDLINE Abstract

2 Reese, P., Truck-Muller C.and Maumenee, I. (1987) Autosomal dominant congenital cataract associated with chromosomal translocation [t(3;4)(p26.2;p15)]. Arch. Opthal., 105,1382-1384.

3 Marner, E, Rosenburg, T, and Eiberg, H. (1989) Autosomal dominant congenital cataract: Morphology and Genetic Mapping. Acta Opthalmologica, 67, 151-158.

4 Renwick, J. and Lawler, S. (1963) Probable linkage between a congenital cataract locus and the Duffy blood group locus. Ann. Hum. Genet., 27, 67-84.

5 Lubsen, N., Renwick, J. and Schoenmakers, J. (1986) Hereditary cataract: perspective for prenatal screening. Opthal. Paediatr. Genet., 7, 195-200.

6 Richards, J., Maumenee, I., Rowe, S. and Lovrien, E. (1984) Congenital cataract possibly linked to haptoglobin. Cytogenet. Cell. Genet., 37, 570.

7 Eiberg, H., Marner, E., Rosenberg, T. and Mohr, J. (1988) Marner's cataract (CAM) assigned to chromosome 16: linkage to haptoglobin. Clin. Genet., 34, 272-275. MEDLINE Abstract

8 Eiberg, H., Lund, A. M., Warburg, M. and Rosenberg, T. (1995) Assignment of congenital cataract Volkmann type (CCV) to chromosome lp36. Hum. Genet., 96, 33-38. MEDLINE Abstract

9 Glaser, T., Jepeal, L., Edwards, J.G., Young, S.R., Favor, J. and Maas, R.L. (1994) PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nature Genet., 7, 463-471. MEDLINE Abstract

10 Armitage, M. M., Kivlin, J. D. and Ferrell, R. E. (1995) A progressive early onset cataract gene maps to human chromosome 17q24. Nature Genet., 9, 37-40.

11 Berry, V., Ionides, A.C.W., Moore, A.T., Plant, C., Bhattacharya, S.S. and Shiels, A. (1996) A locus for autosomal dominant anterior polar cataract on chromosome 17p. Hum. Mol. Genet., 5, 415-419. MEDLINE Abstract

12 Padma, T., Ayyagari, R., Murty, J. S., Basti, S., Fletcher, T., Rao, G. N., Kaiserkupfer, M. and Hejtmancik, J.F. (1995) Autosomal dominant zonular cataract with sutural opacities localized to chromosome 17q11-12. Am. J. Hum. Genet., 57, 840-845. MEDLINE Abstract

13 Rogaev, E.I., Rogaeva, E.A., Korovaitseva, G.I., Farrer, L.A., Petrin, A.N., Keryanov, S.A., Turaeva, S., Chumakov, I., St. George-Hyslop, P. and Ginter, E.K. (1996) Linkage of polymorphic congenital cataract to the [gamma]-crystallin gene locus on human chromosome 2q33-q35. Hum. Mol. Genet., 5, 699-703. MEDLINE Abstract

14 Kramer, P, Yount, J.,Mitchell, T., LaMorticella, D., Carrero-Valenzuela, R., Lovrien, E., Maumenee, I. and Litt, M. (1996) A second gene for cerulean cataracts maps to the [beta] crystallin region on chromosome 22. Genomics, 35, 539-542. MEDLINE Abstract

15 Bodker, F.S., Lavery, M.A., Mitchell, T.N., Lovrien, E.W. and Maumenee, I.H. (1990) Microphthalmos in the presumed homozygous offspring of a first cousin marriage and linkage analysis of a locus in a family with autosomal dominant cerulean congenital cataracts. Am. J. Med. Genet., 37, 54-59. MEDLINE Abstract

16 Chambers, C. and Russell, P. (1991) Deletion mutation in an eye lens [beta]-crystallin: an animal model for inherited cataracts. J. Biol. Chem., 266, 6742-6746. MEDLINE Abstract

17 Brakenhoff, R.H., Henskens, H.A.M., Vanrossum, M.W.P.C., Lubsen, N.H. and Schoenmakers, J.G.G. (1994) Activation of the [gamma]E-Crystallin pseudogene in the human hereditary Coppock-like cataract. Hum. Mol. Genet., 3, 279-283. MEDLINE Abstract

18 Rodriguez, I.R., Gonzalez, P., Zigler, J.S. and Borras T. (1992) A guinea-pig hereditary cataract contains a splice-site deletion in a crystallin gene. Biochim. Biophys. Acta, 1180, 44-52. MEDLINE Abstract

19 Cartier, M., Breitman, M.L. and Tsui, L.-C. (1992) A frameshift mutation in the [gamma]E-crystallin gene of the Elo mouse. Nature Genet., 2, 42-45. MEDLINE Abstract

20 Brakenhoff, R. H., Aarts, H.J.M., Schuren, F., Lubsen, N.H. and Schoenmakers, J.G.G. (1992) The second human beta B2-crystallin gene is a pseudogene. Exp. Eye. Res.,54, 803-806.

21 van Rens, G.L.M., Driessen, H.P.C., Nalini, V., Slingsby, C., de Jong, W.W. and Bloemendal, H. (1991). Isolation and characterization of cDNAs encoding beta A2- and beta A4-crystallins: heterologous interactions in the predicted beta A4-beta B2 heterodimer. Gene, 102, 179-188.

22 Chambers, C. and Russell, P. (1993) Sequence of the human lens [beta]B2-crystallin-encoding cDNA. Gene, 133, 295-299. MEDLINE Abstract

23 den Dunnen, J.T., Moorman, R.J.M., Lubsen, N.H. and Schoenmakers, J.G.G. (1986) Intron insertions and deletions in the beta/gamma crystallin gene family: the rate beta B1 gene. Proc. Natl. Acad. Sci. USA,83, 2855-2859. MEDLINE Abstract

24 Wistow, G.J. and Piatogorsky, J. (1988) Lens crystallins: the evolution and expression of proteins for a highly specialized tissue. Annu. Rev. Biochem., 37, 479-504.

25 Collins, J. E., Cole, C. G., Smink, L. J., Garrett, C. L., Leversha, M. A., Soderlund, C. A., Maslen, G. L., Everett, L. A., Rice, K. M., Coffey, A. J., Gregory, S. G., Gwilliam, R., Dunham, A., Davies, A. F., Hassock, S., Todd, C. M., Lehrach, H., Hulsebos, J. M., Weissenbach, J., Morrow, B., Kucherlapati, R. S., Wadey, R., Scambler, P. J., Kim, U. J., Simon, M. I., Peyrard, M., Xie, Y. G., Carter, N. P., Durbin, R., Dumanski, J. P., Bentley, D. R. and Dunham, I. (1995) A high-density YAC contig map of human chromosome 22. Nature, 377 supp, 367-379.

26 Arnold, C. and Hodgson, I.J. (1991) Vectorette PCR: a novel approach to genomic walking. PCR Methods Appl., 1, 39-42. MEDLINE Abstract

27 Bax, B., Lapatto, R.,Nalini, V., Driessen, H., Lindley, P.F., Mahdevan, D. et al. (1990) X-ray analysis of [beta]B2-crystallin and evolution of oligomeric lens proteins. Nature, 347, 7767-7780.

*To whom correspondence should be addressed. Tel: +1 503 494 7717; Fax: +1 503 494 8393; Email: litt@ohsu.edu

-->
This page is maintained by OUP admin. Last updated Fri Apr 11 08:44:24 BST 1997. Part of the OUP Journals World Wide Web service. Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 IOVSHome page
Y. Munemasa, J. M. K. Kwong, J. Caprioli, and N. Piri
The Role of {alpha}A- and {alpha}B-Crystallins in the Survival of Retinal Ganglion Cells after Optic Nerve Axotomy
Invest. Ophthalmol. Vis. Sci., August 1, 2009; 50(8): 3869 - 3875.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
L. Hansen, A. Mikkelsen, P. Nurnberg, G. Nurnberg, I. Anjum, H. Eiberg, and T. Rosenberg
Comprehensive Mutational Screening in a Cohort of Danish Families with Hereditary Congenital Cataract
Invest. Ophthalmol. Vis. Sci., July 1, 2009; 50(7): 3291 - 3303.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. Zhang, J. Li, C. Huang, L. Xue, Y. Peng, Q. Fu, L. Gao, J. Zhang, and W. Li
Targeted Knockout of the Mouse {beta}B2-crystallin Gene (Crybb2) Induces Age-Related Cataract
Invest. Ophthalmol. Vis. Sci., December 1, 2008; 49(12): 5476 - 5483.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
K. Ganguly, J. Favor, A. Neuhauser-Klaus, R. Sandulache, O. Puk, J. Beckers, M. Horsch, S. Schadler, D. Vogt Weisenhorn, W. Wurst, et al.
Novel Allele of Crybb2 in the Mouse and Its Expression in the Brain
Invest. Ophthalmol. Vis. Sci., April 1, 2008; 49(4): 1533 - 1541.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
D. Cohen, U. Bar-Yosef, J. Levy, L. Gradstein, N. Belfair, R. Ofir, S. Joshua, T. Lifshitz, R. Carmi, and O. S. Birk
Homozygous CRYBB1 Deletion Mutation Underlies Autosomal Recessive Congenital Cataract
Invest. Ophthalmol. Vis. Sci., May 1, 2007; 48(5): 2208 - 2213.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. B. Bateman, L. Richter, P. Flodman, D. Burch, S. Brown, P. Penrose, O. Paul, D. D. Geyer, D. G. Brooks, and M. A. Spence
A new locus for autosomal dominant cataract on chromosome 19: linkage analyses and screening of candidate genes.
Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3441 - 3449.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
M. Liu, T. Ke, Z. Wang, Q. Yang, W. Chang, F. Jiang, Z. Tang, H. Li, X. Ren, X. Wang, et al.
Identification of a CRYAB Mutation Associated with Autosomal Dominant Posterior Polar Cataract in a Chinese Family.
Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3461 - 3466.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Y. Liu, X. Zhang, L. Luo, M. Wu, R. Zeng, G. Cheng, B. Hu, B. Liu, J. J. Liang, and F. Shang
A Novel {alpha}B-Crystallin Mutation Associated with Autosomal Dominant Congenital Lamellar Cataract.
Invest. Ophthalmol. Vis. Sci., March 1, 2006; 47(3): 1069 - 1075.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Y. V. Sergeev, L. V. Soustov, E. V. Chelnokov, N. M. Bityurin, P. S. Backlund Jr, P. T. Wingfield, M. A. Ostrovsky, and J. F. Hejtmancik
Increased Sensitivity of Amino-Arm Truncated {beta}A3-Crystallin to UV-Light-Induced Photoaggregation
Invest. Ophthalmol. Vis. Sci., September 1, 2005; 46(9): 3263 - 3273.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Liu, X. Du, M. Wang, Q. Huang, L. Ding, H. W. McDonald, J. R. Yates III, B. Beutler, J. Horwitz, and X. Gong
Crystallin {gamma}B-I4F Mutant Protein Binds to {alpha}-Crystallin and Affects Lens Transparency
J. Biol. Chem., July 1, 2005; 280(26): 25071 - 25078.
[Abstract] [Full Text] [PDF]

Home page
 Br J OphthalmolHome page
J D McKay, B Patterson, J E Craig, I M Russell-Eggitt, M G Wirth, K P Burdon, A W Hewitt, A C Cohn, Y Kerdraon, and D A Mackey
The telomere of human chromosome 1p contains at least two independent autosomal dominant congenital cataract genes
Br J Ophthalmol, July 1, 2005; 89(7): 831 - 834.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
S. A. Riazuddin, A. Yasmeen, W. Yao, Y. V. Sergeev, Q. Zhang, F. Zulfiqar, A. Riaz, S. Riazuddin, and J. F. Hejtmancik
Mutations in {beta}B3-Crystallin Associated with Autosomal Recessive Cataract in Two Pakistani Families
Invest. Ophthalmol. Vis. Sci., June 1, 2005; 46(6): 2100 - 2106.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
S. T. Santhiya, S. M. Manisastry, D. Rawlley, R. Malathi, S. Anishetty, P. M. Gopinath, P. Vijayalakshmi, P. Namperumalsamy, J. Adamski, and J. Graw
Mutation Analysis of Congenital Cataracts in Indian Families: Identification of SNPs and a New Causative Allele in CRYBB2 Gene
Invest. Ophthalmol. Vis. Sci., October 1, 2004; 45(10): 3599 - 3607.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
W. Ferrini, D. F. Schorderet, P. Othenin-Girard, S. Uffer, E. Heon, and F. L. Munier
CRYBA3/A1 Gene Mutation Associated with Suture-Sparing Autosomal Dominant Congenital Nuclear Cataract: A Novel Phenotype
Invest. Ophthalmol. Vis. Sci., May 1, 2004; 45(5): 1436 - 1441.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
M.A. Reddy, O.A. Bateman, C. Chakarova, J. Ferris, V. Berry, E. Lomas, R. Sarra, M.A. Smith, A.T. Moore, S.S. Bhattacharya, et al.
Characterization of the G91del CRYBA1/3-crystallin protein: a cause of human inherited cataract
Hum. Mol. Genet., May 1, 2004; 13(9): 945 - 953.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. Graw, A. Neuhauser-Klaus, N. Klopp, P. B. Selby, J. Loster, and J. Favor
Genetic and Allelic Heterogeneity of Cryg Mutations in Eight Distinct Forms of Dominant Cataract in the Mouse
Invest. Ophthalmol. Vis. Sci., April 1, 2004; 45(4): 1202 - 1213.
[Abstract] [Full Text] [PDF]

Home page
 Br J OphthalmolHome page
A T Moore
Understanding the molecular genetics of congenital cataract may have wider implications for age related cataract
Br J Ophthalmol, January 1, 2004; 88(1): 2 - 3.
[Full Text]

Home page
 Br J OphthalmolHome page
K P Burdon, M G Wirth, D A Mackey, I M Russell-Eggitt, J E Craig, J E Elder, J L Dickinson, and M M Sale
Investigation of crystallin genes in familial cataract, and report of two disease associated mutations
Br J Ophthalmol, January 1, 2004; 88(1): 79 - 83.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
E Nandrot, C Slingsby, A Basak, M Cherif-Chefchaouni, B Benazzouz, Y Hajaji, S Boutayeb, O Gribouval, L Arbogast, A Berraho, et al.
Gamma-D crystallin gene (CRYGD) mutation causes autosomal dominant congenital cerulean cataracts
J. Med. Genet., April 1, 2003; 40(4): 262 - 267.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
L. Fu and J. J.-N. Liang
Alteration of Protein-Protein Interactions of Congenital Cataract Crystallin Mutants
Invest. Ophthalmol. Vis. Sci., March 1, 2003; 44(3): 1155 - 1159.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
S. Khaliq, A. Hameed, M. Ismail, K. Anwar, and S. Q. Mehdi
A Novel Locus for Autosomal Dominant Nuclear Cataract Mapped to Chromosome 2p12 in a Pakistani Family
Invest. Ophthalmol. Vis. Sci., July 1, 2002; 43(7): 2083 - 2087.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Fu and J. J-N Liang
Detection of Protein-Protein Interactions among Lens Crystallins in a Mammalian Two-hybrid System Assay
J. Biol. Chem., February 1, 2002; 277(6): 4255 - 4260.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
K. J. Lampi, M. Shih, Y. Ueda, T. R. Shearer, and L. L. David
Lens Proteomics: Analysis of Rat Crystallin Sequences and Two-Dimensional Electrophoresis Map
Invest. Ophthalmol. Vis. Sci., January 1, 2002; 43(1): 216 - 224.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. Graw, J. Löster, D. Soewarto, H. Fuchs, A. Reis, E. Wolf, R. Balling, and M. H. de Angelis
Aey2, a New Mutation in the {beta}B2-Crystallin-Encoding Gene of the Mouse
Invest. Ophthalmol. Vis. Sci., June 1, 2001; 42(7): 1574 - 1580.
[Abstract] [Full Text]

Home page
 J. Med. Genet.Home page
Vanita, V. Sarhadi, A. Reis, M. Jung, D. Singh, K. Sperling, J. R. Singh, and J. Bürger
A unique form of autosomal dominant cataract explained by gene conversion between {beta}-crystallin B2 and its pseudogene
J. Med. Genet., June 1, 2001; 38(6): 392 - 396.
[Full Text]

Home page
 Br J OphthalmolHome page
N. G Congdon
Prevention strategies for age related cataract: present limitations and future possibilities
Br J Ophthalmol, May 1, 2001; 85(5): 516 - 520.
[Full Text]

Home page
 Br J OphthalmolHome page
P. Francis, V. Berry, S. Bhattacharya, and A. Moore
Congenital progressive polymorphic cataract caused by a mutation in the major intrinsic protein of the lens, MIP (AQP0)
Br J Ophthalmol, December 1, 2000; 84(12): 1376 - 1379.
[Abstract] [Full Text]

Home page
 Hum Mol GenetHome page
M. R. Baumgartner, C.-a. A. Hu, S. Almashanu, G. Steel, C. Obie, B. Aral, D. Rabier, P. Kamoun, J.-M. Saudubray, and D. Valle
Hyperammonemia with reduced ornithine, citrulline, arginine and proline: a new inborn error caused by a mutation in the gene encoding {Delta}1-pyrroline-5-carboxylate synthase
Hum. Mol. Genet., November 1, 2000; 9(19): 2853 - 2858.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. B. Bateman, D. D. Geyer, P. Flodman, M. Johannes, J. Sikela, N. Walter, A. T. Moreira, K. Clancy, and M. A. Spence
A New {beta}A1-Crystallin Splice Junction Mutation in Autosomal Dominant Cataract
Invest. Ophthalmol. Vis. Sci., October 1, 2000; 41(11): 3278 - 3285.
[Abstract] [Full Text]

Home page
 IOVSHome page
E. Pras, M. Frydman, E. Levy–Nissenbaum, T. Bakhan, J. Raz, E. I. Assia, B. Goldman, and E. Pras
A Nonsense Mutation (W9X) in CRYAA Causes Autosomal Recessive Cataract in an Inbred Jewish Persian Family
Invest. Ophthalmol. Vis. Sci., October 1, 2000; 41(11): 3511 - 3515.
[Abstract] [Full Text]

Home page
 IOVSHome page
J. B. Bateman, M. Johannes, P. Flodman, D. D. Geyer, K. P. Clancy, C. Heinzmann, T. Kojis, R. Berry, R. S. Sparkes, and M. A. Spence
A New Locus for Autosomal Dominant Cataract on Chromosome 12q13
Invest. Ophthalmol. Vis. Sci., August 1, 2000; 41(9): 2665 - 2670.
[Abstract] [Full Text]

Home page
 Hum Mol GenetHome page
S. Kmoch, J. Brynda, B. Asfaw, K. Bezouska, P. Novak, P. Rezacova, L. Ondrova, M. Filipec, J. Sedlacek, and M. Elleder
Link between a novel human {gamma}D-crystallin allele and a unique cataract phenotype explained by protein crystallography
Hum. Mol. Genet., July 22, 2000; 9(12): 1779 - 1786.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
P J Francis, V Berry, S S Bhattacharya, and A T Moore
The genetics of childhood cataract
J. Med. Genet., July 1, 2000; 37(7): 481 - 488.
[Abstract] [Full Text]

Home page
 IOVSHome page
D. Gill, R. Klose, F. L. Munier, M. McFadden, M. Priston, G. Billingsley, N. Ducrey, D. F. Schorderet, and E. Héon
Genetic Heterogeneity of the Coppock-like Cataract: A Mutation in CRYBB2 on Chromosome 22q11.2
Invest. Ophthalmol. Vis. Sci., January 1, 2000; 41(1): 159 - 165.
[Abstract] [Full Text]

Home page
 Br J OphthalmolHome page
A. Ionides, P. Francis, V. Berry, D. Mackay, S. Bhattacharya, A. Shiels, and A. Moore
Clinical and genetic heterogeneity in autosomal dominant cataract
Br J Ophthalmol, July 1, 1999; 83(7): 802 - 808.
[Abstract] [Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
D. A. Stephan, E. Gillanders, D. Vanderveen, D. Freas-Lutz, G. Wistow, A. D. Baxevanis, C. M. Robbins, A. Van Auken, M. I. Quesenberry, J. Bailey-Wilson, et al.
Progressive juvenile-onset punctate cataracts caused by mutation of the gamma D-crystallin gene
PNAS, February 2, 1999; 96(3): 1008 - 1012.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (140)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Litt, M.
Right arrow Articles by Maumenee, I. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Litt, M.
Right arrow Articles by Maumenee, I. H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?