[alpha]-Mannosidosis: functional cloning of the lysosomal [alpha]-mannosidase cDNA and identification of a mutation in two affected siblings
[alpha] -Mannosidosis: functional cloning of the lysosomal [alpha]-mannosidase cDNA and identification of a mutation in two affected siblingsØivind Nilssen1,*, Thomas Berg1, Hilde M. F. Riise1,2, Umayal Ramachandran1, Gry Evjen2, Gaute M. Hansen2, Dag Malm3, Lisbeth Tranebjærg1 and Ole K. Tollersrud2
1Department of Medical Genetics, 2Department of Medical Biochemistry and 3Department of Medicine, University Hospital and University of Tromsø, N-9038 Tromsø, Norway
Received December 9, 1996;Revised and Accepted February 11, 1997
DDBJ/EMBL/GenBank accession no. U60266
[alpha]-Mannosidosis (MIM 248500) is an autosomal recessive lysosomal storage disorder resulting from deficient activity of lysosomal [alpha]-mannosidase (LAMAN) (EC 3.2.1.24). The disease is characterized by massive intracellular accumulation of mannose-rich oligosaccharides with resulting mental retardation, hearing loss, immune deficiency and skeletal changes. We report here the purification and characterization of human placenta LAMAN. The enzyme is synthesized as a single-chain precursor which is processed into three glycopeptides of 70, 42 and 15 kDa. The 70 kDa peptide is further partially proteolysed into three more peptides that are joined by disulfide bridges. The laman cDNA sequence was assembled from overlapping fragments obtained by PCR on human fibroblast and human lung cDNA. The deduced amino acid sequence contains a putative signal peptide of 48 amino acids followed by a polypeptide sequence of 962 amino acids. Northern blot analyses revealed a single transcript of ~3.5 kb present in all tissues examined but at varying levels. Two affected siblings of Palestinian origin were homozygous for a mutation that causes a His -> Leu replacement at a position which is conserved among class 2 [alpha]-mannosidases from several species.
Lysosomal [alpha]-mannosidase (LAMAN, EC 3.2.1.24) is an exoglycosidase which cleaves [alpha]-linked mannose-residues from the non-reducing end during the ordered degradation of N-linked glycoproteins (1 ). The enzyme belongs to the class 2 [alpha]-mannosidases, and it cleaves all known types of [alpha]-mannosidic linkage (2 ).
Lack of LAMAN activity results in the autosomal, recessive, lysosomal storage disorder [alpha]-mannosidosis (MIM #248500) (3 ,4 ). The patients accumulate mainly unbranched oligosaccharide chains of which the major storage product is the trisaccharide Man[alpha]1-3Man[beta]1-4GlcNAc.
The disease has been described in man (3 ,4 ), cattle (5 ) and cat (6 ). In humans, the disease is rare but globally widespread. The main clinical symptoms are progressive mental retardation, immune deficiency, impaired hearing and Hurler-like skeletal changes. Other findings are lens opacities, muscular hypotonia, macroglossia, prognathism, vacuolated lymphocytes and pancytopenia. The clinical severity of [alpha]-mannosidosis ranges in a continuum from mildly affected to severely affected patients and heterogeneity has been observed among affected siblings (4 ). At present, the diagnosis is based on the combination of clinical findings, the pattern of oligosaccharides excreted in urine (7 ) and the measurement of [alpha]-mannosidase activity in fibroblasts, white blood cells or prenatally in cultured amniocytes (4 ). [alpha]-Mannosidosis may be underdiagnosed, especially in mildly affected patients.
The gene encoding lysosomal [alpha]-mannosidase has been localized close to the centromere of chromosome 19 (19p13.2-q12) by analysis of human/rodent somatic cell hybrids for [alpha]-mannosidase activity (8 ,9 ) and by PCR screening of a human/rodent cell hybrid mapping panel DNA (10 ,11 ).
Previously, human LAMAN was reported to be composed of two peptides of ~60 and 30 kDa (12 ,13 ). Recently, we demonstrated that bovine LAMAN is composed of five glycopeptides synthesized from a single-chain precursor. Starting with the peptide derived from the N-terminal part of the precursor their molecular masses were 35/38 (peptide a), 11/13 (peptide b), 22 (peptide c), 38 (peptide d) and 13/15 kDa (peptide e), respectively (14 ).
Two different amino acid sequences of putative human lysosomal [alpha]-mannosidases have been deduced from cDNA obtained from retina/muscle (10 ) and spleen (11 ). The cloning of these cDNAs relied on PCR-based approaches using conserved sequences between the murine Golgi [alpha]-mannosidase (15 ) and the Dictyostelium discoideum lysosomal [alpha]-mannosidase (16 ). Although both share identity with a stretch of 19 amino acid residues from a LAMAN peptide (13 ), the two deduced amino acid sequences were only 90% identical.
Here we report the structure and composition of the human LAMAN enzyme and the corresponding laman cDNA, containing the complete coding region. The deduced amino acid sequence was colinear with the N-terminal amino acid sequences of five different LAMAN glycopeptides. This work also presents the first molecular description of a mutation likely to be responsible for [alpha]-mannosidosis in man.
Identification of human LAMAN peptides by N-terminal sequencing
A
MW
From Edman
Deduced from
Deduced from
Source
(kDa)
degradation of
bovine cDNA
human cDNA
bovine peptides
38
XLYKTVPKVKPDM
AGYKTCPKVKPDM
GGYETCPTVQPNM
(14)
11
XXXVNXXYST
GIRVNVLYST
GSSVHVLYST
(14)
B
MW
From Edman
Deduced from
Source
(kDa)
degradation of
human cDNA
human peptides
22
XGX(E)APLNEA
SGDSAPLNEA
This work
20
XGX(W)APLN(D)A
SGDSAPLNEA
This work
34
XPALTIENEXIXAT
SPALTIENEHIRAT
This work
13
XPXXTQFSGLXXDLPPSV
APPRTQFSGLRRDLPPSV
This work
Sequences are written in one-letter code. X indicates positions where no definite assignments could be made. Enclosed within parentheses are amino acids, within c1 and c2, that do not match the sequence deduced from human cDNA. The LAMAN a and b peptides were identified by comparing N-terminal sequences from bovine LAMAN (14) with that deduced from human cDNA (A). The LAMAN 20/22, 42 and 13/15 kDa peptides (Fig. 1A and B) were subjected to N-terminal sequencing and identified as the c-, d- and e-peptides, respectively, by comparison with amino acid sequences deduced from human cDNA.
Human LAMAN was purified from 12 kg of placenta as explained in Materials and Methods. Unless heat denatured, the enzyme activity could be recovered as a single band after SDS/PAGE (Fig. 1 B). From the crude homogenate the degree of purification was 15 000-fold with 0.2% recovery. The specific activity was 30 U/mg which is similar to previous reports on D.discoideum (17 ) and porcine kidney LAMAN (18 ).
The human laman cDNA was obtained by PCR on cDNA derived from human skin fibroblasts and lung cells as explained in Materials and Methods. The assembled sequence contains 3149 bp including an open reading frame of 3030 bp (Fig. 2 ). The sequence contains two potential translation initiation signals preceded by an in-frame, stop codon 5' to the first ATG. The 3' untranslated region is 102 bp long and contains the poly(A) signal variant, ATTAAA, 14 nucleotides (nt) upstream of the poly(A) tail. This alternative poly(A) signal is seen upstream of the poly (A) tail in the bovine laman gene (14 ) and the murine Golgi [alpha]-mannosidase II gene (15 ).
The amino acid sequence of the LAMAN polypeptide was deduced from the cDNA sequence. The second ATG at codon 23 is absent in the corresponding bovine (14 ) and feline (T.Berg, O.K.Tollersrud and Ø.Nilssen, in preparation) sequences and, furthermore, since the sequence surrounding the first ATG is in better agreement with the Kozak consensus (PuCCATGG), we favour the idea that LAMAN synthesis initiates from the first ATG starting at position +1 as shown in Figure 2 . The protein is composed of 1010 amino acids. The N-terminal end of the bovine LAMAN a-peptide displays the sequence AGYKTCPKVKPDM (Table 1 ). The deduced human amino acid sequence contains an equivalent stretch of amino acids; GGYETCPTVQPNM (62% identity) starting at residue 49, indicating that this sequence constitutes the start of the human a-peptide. This sequence is preceded by a typical signal peptidase cleavage site (46ARA <=> G49) in accordance with the (-3,-1)-rule of von Heijne et al. (20 ,21 ). The putative signal peptide contains 48 amino acids which include a hydrophobic core of 11 consecutive amino acids extending from residue 36 to 47.
Without the signal peptide, human LAMAN has a predicted molecular mass of 108.6 kDa. This is consistent with the sum of MWs of the deglycosylated peptides as judged by SDS/PAGE. The human and bovine a and b peptides have similar molecular weights and, moreover, the N-terminal sequences from peptides a and b from the bovine LAMAN display a high degree of identity to the corresponding positions in human LAMAN (Table 1 A). The N-terminal sequences obtained from the 22/20 kDa (c-peptide), 42 kDa (d-peptide) and 15/13 kDa (e-peptide) peptides match with internal amino acid sequences deduced from the cDNA (Table 1 B and Fig. 2 ). This demonstrates that, as for the bovine LAMAN, the human enzyme is synthesized as a single-chain precursor that is cleaved into five peptides of which the abc peptide complex is only partially processed (Fig. 1 ). The peptides were designated a-e as explained in Figures 2 and 3 . Based on the deduced amino acid sequence they have estimated molecular weights of 34.2, 9.5, 18.9, 31.5 and 14.5 kDa, respectively. The deduced amino acid sequence contains 11 potential Asn-X-Ser/Thr glycosylation sites. Reduction in MWs after deglycosylation suggests that most sites are occupied (Figs 1 , 2 and 3 ). At the amino acid sequence level the human LAMAN is 83% identical to the bovine LAMAN (14 ) and 38% identical to the D.discoideum LAMAN (16 ).
Recently, we showed that the human laman cDNA is encoded by 24 exons spanning 21.5 kb. The assembled exon sequence is in agreement with the cDNA sequence reported here. The organization of the human laman gene, with the precise size of each exon and with the sequences of the 3' and 5' intron boundaries, is explained in detail by Riise et al. (22 ).
The human laman showed a single transcript of 3.5 kb (Fig. 4 A). This is consistent with the size previously determined for D.discoideum lysosomal [alpha]-mannosidase mRNA (16 ). The human laman mRNA was expressed at highest levels in lung followed by kidney, pancreas, liver, placenta, skeletal muscle and heart (Fig. 4 A). At these conditions no laman transcript could be detected from mRNA from whole, homogenized, normal brain (Fig. 4 A). However, further Northern analysis with 6 days exposure time revealed that laman is expressed, at varying levels, in 16 different brain sections (Fig. 4 B). This result is consistent with the finding that LAMAN activity can be detected in the cerebral cortex of human brain (3 ).
laman cDNA from an affected Palestinian boy (23 ) was sequenced and compared with the normal laman cDNA sequence. Two nucleotide substitutions were found within the open reading frame (Figs 2 and 5 A and C). A C932T transition results in the change of Thr311 -> Ile and disrupts a putative N-glycosylation site (Fig. 5 C). However, because the healthy father was homozygous for the T932 allele (Fig. 5 D) and since this allele also was detected in 19 out of 46 Palestinian normal chromosomes (P = 0.41) by PCR based RFLP analysis (see Materials and Methods), it must be considered as polymorphic and, thus, excluded as a disease causing mutation.
Lysosomal [alpha]-mannosidase (LAMAN) is critical for the catabolism of oligosaccharides during glycoprotein turnover and lack of LAMAN activity results in severe disease. In order to explore the underlying mechanisms of [alpha]-mannosidosis and to develop a reliable diagnostic tool we have purified and characterized the LAMAN enzyme and its cDNA. LAMAN is synthesized as a single-chain precursor which is processed into three peptides with molecular weights of 70, 42 and 13/15 kDa. Further specific, but less efficient, processing of the 70 kDa subunit results in a total of five different peptides. Size determination by SDS/PAGE and amino acid sequence information from N-terminal sequencing of bovine (14 ) and human peptides allowed us to designate the peptides as; a (39 kDa), b (8-10 kDa), c (20/22 kDa), d (42 kDa) and e (13/15 kDa) according to their order in the complete amino acid sequence as deduced from the laman cDNA sequence. The a, b and c peptides are linked by disulfide bridges. The cleavage pattern is similar to that suggested for bovine LAMAN (14 ).
Previously, human fibroblast LAMAN was reported to be composed of two peptides of 63-67 and 43-47 kDa, originating from a 110 kDa precursor (26 ). Similarly, a 55-63 kDa peptide and a 30 kDa peptide was reported for the LAMANs of human liver (12 ) and a human leukaemic cell line (HL-60) (13 ). They probably correspond to the abc-peptide and the d-peptide, reported here, as the 30 kDa peptide from HL-60 (13 ) had an N-terminal sequence similar to that of peptide d (Table 1 and Fig. 2 ). The 13/15 kDa e-peptide, reported here, has not previously been described, presumably because of its heterogeneity and small size which makes it difficult to detect by SDS/PAGE.
The deduced LAMAN amino acid sequence contains 11 potential N-glycosylation sites (Figs 2 and 3 ). The reduction in MWs for the various peptides after deglycosylation with endo H and PNGase F indicates that most N-glycosylation sites are occupied and that both high mannose and complex type N-linked oligosaccharides are present. The transport into lysosomes is probably mannose 6-phosphate dependent as LAMAN is secreted from fibroblasts of patients affected with I-cell disease (26 ). The oligosaccharide chains linked to peptides b and c, at Asn366 and Asn496, are endo H sensitive and thus, the most likely candidates for mannose 6-phosphate tagging.
The authenticity of the laman cDNA sequence presented here was shown by its colinearity with the N-terminal amino acid sequences of the bovine LAMAN a and b peptides and the human LAMAN c, d and e peptides. It deviates only at four codons when compared with a partial lysosomal acidic [alpha]-mannosidase cDNA sequence recently published by Liao et al. (11 ). However, additional sequence information from the 5' and 3' ends allowed us to identify the first in-frame ATG codon, the site likely to be responsible for translation initiation, as well as the poly(A) tail and the corresponding signal sequence for polyadenylation. The present laman cDNA sequence contains several deviations from the sequence presented by Nebes and Schmidt (10 ). These include nucleotide substitutions and small deletions and insertions, of which some are frame-shifting. At the amino acid sequence level the two LAMANs show 91% identity and in particular we failed to identify a proper N-terminal sequence for the a-peptide [as deduced from the bovine counterpart (14 )] and the e-peptide (this work) in their sequence. Furthermore, compared to that obtained from retina/muscle cDNA (10 ) the skin fibroblast/lung laman sequence presented here contains a stretch of an additional 69 bp encoding 23 amino acids extending from residue 507 to 530. This was the only laman splice variant detectable by RT-PCR on cDNA derived from lung, skin fibroblasts, kidney, peripheral blood cells, retina, skeletal muscle, fetal and adult brain, heart, placenta, liver and pancreas (results not shown).
Northern blot analysis revealed a single laman transcript of ~3.5 kb which is somewhat larger than the cDNA presented here. Recently we demonstrated a 5' untranslated extension of 309 bp corresponding to a total transcript size of 3444 nt (22 ), consistent with the size determined by Northern blot analysis (Fig. 4 A). The level of laman gene expression is highest in lung followed by kidney, pancreas and liver. A much lower expression is observed in other tissues. Since the disease pathology of [alpha]-mannosidosis is prominent in the CNS, it is curious that there was no detectable laman mRNA in homogenized brain material. However, additional analysis with 6 days exposure of Multiple Brain Tissue Northern blots revealed that the laman gene is expressed but at low and varying levels in all 16 brain sections examined. The highest level of expression appears to be in corpus callosum and the spinal cord whereas considerably lower levels are observed in the larger structures which include cerebellum, cerebral cortex, frontal and temporal lobe, and occipital pole. The significance (if any) of this variation remains to be elucidated. Compared to what is observed in other tissues it appears that only a low, but crucial level of laman expression is required to maintain normal CNS development and function.
These studies identify the first mutation likely to be responsible for [alpha]-mannosidosis in man. A missense mutation, A212T, absent in normal controls and resulting in the replacement of His71 with Leu, was present in a homozygous state in two affected siblings of Palestinian origin and in a heterozygous state in their carrier father. Homozygosity was expected since these patients were children of consanguineous parents (23 ). They were considered as mildly affected and a residual acidic [alpha]-mannosidase activity of 20% of normal was detected in the patients' fibroblast cells (23 ). Nevertheless, the patients showed vacuolated leukocytes and fibroblasts consistent with the disease phenotype (23 ). It has been suggested that the severity of clinical expression is related to the degree of enzyme impairment both in human [alpha]-mannosidosis (27 ) and in other lysosomal disorders (28 ). However, mutant LAMAN enzymes, even though containing residual activity upon testing at the appropriate pH, may be mislocalized to non-lysosomal compartments and therefore functionally inactive at in vivo conditions. Moreover, other acidic [alpha]-mannosidases have been reported (26 ) and the activity of such enzymes may be misinterpreted as residual LAMAN activity. Therefore, to establish the relationship between genotype and phenotype, enzyme activity should be measured on fractionated lysosomes.
The affected residue, His71, is conserved among the LAMANs of man, cattle and D.discoideum as well as in the non-acidic class 2 [alpha]-mannosidases of Golgi and ER. The fact that less than 3% of all amino acid residues are identical among these [alpha]-mannosidases indicates that His71 is physiologically important. However, expression studies are required to demonstrate the functional consequences of the A212T mutation.
A second nucleotide substitution, C932 -> T, results in replacement of Thr311 with Ile. As the T932 allele also exists in a homozygous state in the carrier father as well as in 41% of Palestinian normal chromosomes, this specific alteration must be considered as polymorphic and is probably not contributing to the disease phenotype. The Thr311Ile substitution disrupts a potential glycosylation site, 309Asn-His-Thr311, demonstrating that glycosylation at Asn309 is not required for LAMAN function. This is consistent with the findings of Liao et al. (11 ).
Mutation analysis of the laman gene will provide information about the structure and function of lysosomal [alpha]-mannosidase and the disease causing mechanisms in [alpha]-mannosidosis. It will facilitate carrier detection and lead to more rapid prenatal and postnatal diagnosis confirmation. Such studies will provide insight to the relationship between genotype and phenotype. This may lead to more accurate clinical phenotype prediction which is essential for the evaluation of future therapy protocols. Interestingly, bone marrow transplantation has proven to be remarkably effective in ameliorating the disease process in feline [alpha]-mannosidosis (29 ). The results presented here provide a tool for future experiments on gene or enzyme replacement therapy for this disorder.
[alpha]-Mannosidase activity was determined according to Opheim and Touster (30 ).
The following steps were carried out at 4oC unless otherwise stated. Human placenta (12 kg) was homogenized in 0.05 M sodium phosphate buffer, pH 7.0, 1:2 (w:v). After centrifugation at 10 000 g for 10 min the supernatant was heated at 60oC for 60 min. Any precipitate was removed by centrifugation at 10 000 g for 10 min. The supernatant was added (NH4)2SO4 to 35% saturation, stirred overnight and centrifuged at 10 000 g for 10 min. (NH4)2SO4 was added to 60% saturation and centrifuged at 11 000 g for 10 min after overnight stirring. The remaining part of the procedure was carried out at room temperature. The pellet was dissolved into 1300 ml 0.02 M Tris-HCl, pH 7.5 containing 0.15 M NaCl and chromatographed through a Concanavalin A-Sepharose column (Pharmacia) (1.5 * 7 cm) equilibrated with the same buffer. [alpha]-Mannosidase was eluted with 0.2 M [alpha]-methylmannopyranoside. The eluate (420 ml) was applied to a hydroxylapatite column (Bio-gel HTP, Bio-Rad) equilibrated with 0.02 M Tris-HCl, pH 7.5 containing 0.15 M NaCl. The run-through was dialysed against 0.02 M Tris-HCl, pH 7.6 and chromatographed through a DEAE-Sepharose ion exchange column (Pharmacia) equilibrated with the same buffer. [alpha]-Mannosidase was eluted at 0.07 M NaCl. The eluate was concentrated to 3 ml through an Amicon ultrafiltration cell fitted with an YM 30 membrane and chromatographed through Superdex 200 (Pharmacia) (1.5 * 60 cm) that was equilibrated with 0.05 M Tris-HCl, pH 7.4 containing 0.15 M NaCl (PBS). The fractions containing enzyme activity were collected and concentrated through Centricon 30 ultrafiltration tubes (Amicon). As a last step the enzyme was subjected to preparative SDS/PAGE. LAMAN activity was eluted into PBS by diffusion overnight at 4oC.
[alpha]-Mannosidase (0.2 mg/ml) was subjected to SDS/PAGE with an 8-25% gradient of polyacrylamide. After electrophoresis the peptides were transferred to a PVDF membrane (Immobilon, Millipore) by diffusion at 70oC for 2 h. The membrane was immunostained using peptide specific antisera against bovine lysosomal [alpha]-mannosidase as primary antibodies (14 ). The immune complex was detected with a secondary antibody/alkaline phosphatase conjugate kit from Bio-Rad. The molecular mass standards were: [alpha]-lactalbumin (14.4 kDa), soyabean trypsin inhibitor (20.1 kDa), carbonic anhydrase (30 kDa), ovalbumin (43 kDa), bovine serum albumin (67 kDa) and phosphorylase b (94 kDa).
Peptide sequencing was conducted by the Protein Core Facility of the Biotechnology Centre of Oslo, by automated Edman degradation in an Applied Biosystems 477A Protein sequencer.
Total RNA was isolated from fibroblast cells (1-3 * 106 cells) with TRIsolTM Reagent kit (GIBCO BRL), according to the suppliers specifications. Total RNA (2 [mu]g) was reverse transcribed using 100 pmol oligo dT/[mu]g RNA and 200 U SuperScriptTM II reverse transcriptase (GIBCO BRL) at 50oC for 60 min.
DNA extraction and cloning were carried out with standard techniques as explained by Sambrook et al. (31 ). PCR primers are listed in Table 2 . All PCR fragments, to be cloned or sequenced, were amplified with TaKaRa Ex Taq DNA-polymerase (Takara Shuzo Co., Ltd.). DNA sequencing was performed with 35S-labeled ATP, Sequenase and kit reagents from USB/Amersham by standard protocols. PCR primers MP1F and MP1R specific for the bovine laman gene [which we cloned simultaneously from a bovine kidney [lambda]ZAP cDNA library (14 )] were used to amplify a 2.8 kb fragment from cDNA prepared from human fibroblast total RNA. PCR conditions were denaturation at 95oC for 4 min followed by 38 cycles with denaturation at 95oC for 1 min and annealing/extension at 65oC for 3.5 min. After end repair with T4 polynucleotide kinase and Klenow polymerase (GIBCO BRL) the fragment was cloned into the SmaI site of pGEM1 (Promega). DNA from several positive clones was mixed and the 2.8 kb fragment was reisolated by EcoRI/HindIII digestion and subcloned into M13 mp18/mp19 (Pharmacia). Clones were pooled according to their orientation and sequenced in both directions with primers derived either from the bovine laman sequence or from the human laman sequence (Table 2 ). Overlapping fragments containing the 5' and 3' ends were obtained by PCR on Human Lung Marathon ready cDNA (Clontech) with primers AP1/MP261R and AP1/mph2F, respectively. PCR conditions for both primer combinations were: denaturation for 4 min at 95oC followed by 36 cycles with 95oC for 1 min, 63oC for 1 min and 72oC for 2 min. Fragments were cloned into the PCR II (Invitrogen) vector and sequenced with primers MP264R (5' end) and mph1,5F and mph310F (3' end).
To test for splice variants in the region spanning nt positions 1521-1590, PCR was carried out with primers mph28F and mph305R on cDNA derived from kidney, lung, skin fibroblasts, peripheral blood lymphocytes, retina, skeletal muscle, fetal and adult brain, heart, placenta, liver and pancreas. PCR conditions were 95oC for 4 min followed by 30 cycles with 95oC for 40 s, 62oC for 30 s and 72oC for 90 s.
Oligodeoxynucleotides used for PCR and DNA sequencing
MP1F:
85-CCACCGCTCCCGCCTCTCT
MP264R:
218-TCATCATGTGTGTGAGGCA
mph30F:
403-CAGGAAGTCGTGCGAGACCTTGTGC
MP263R:
527-CGCAGTCTGAGTGTCATCTGGT
mph302F:
689-AGAAGCTGGAGATGGAGCAGGTGT
MP262R:
851-GGGCTGCGCGTGTCCTCCACAA
C932T:
910-CGGTATTACCGCACCAACAATA
MP261R:
984-GAACCACGTGTTGGCATTCT
MP303F:
996-CAAGCTCATCCAGTTGGTCAATG
MP26R:
1115-TTCACTGACCAGCTGAGGTTGGC
MP304F:
1293-CAGTGCACCCCTCAATGAGGCGA
mph28F:
1439-CTGGGCTCAGAGGCTTCAAAG
MP5R:
1546-GGTTATAAACGATCACCTGGAA
mph305R:
1701-GGCTGAGAACAGCAGCTCCG
MP305F:
1680-TCAGGAGCTGCTTTTCTCAGCCT
mph305bF:
1825-GAGCACATCCGGGCAACGTTTG
MP4R:
1922-TAGAAGGCTTGGCGAACAGGCAGC
MP306F:
1969-GGTGCCTACATCTTCAGAC
MP3R:
2246-CGGCCATTGCTGTCAGTGTAGAA
mph306bF:
2292-GAACCAGACGGAGCCCGTGGC
MP307F:
2316-AAATTACTATCCAGTCAACA
mph2R:
2532-CAGCACCAGGTGGCGCCCTCGCA
MP308F:
2583-GGAGGTCCTGGCCCCGCAGGTG
mph1.5F:
2733-GGTGCTGCTGCGCTTGGAGC
MP1R:
2881-GGAGCTGGTTGGCCGCCAGCGT
MP309F:
2889-AGCCTCCAGGCTCCAGTGGAC
mph310F:
2927-CACCCCACCAAACTCCGTACCA
mph3UTR-RI:
CATGCGAATTC-3054-GGAGGGCCCATCCCAGCAGACCTAA
mphI1F:
GCGAGATCAGGCCTCTCTGAGT
mphI3R:
TACAGCTTGCACGTGGCATGACA
mphI6F:
TCAAAACACAGCTATACACAGGGAT
mphI7R:
GACAGCACTGAGAGCTATGCACA
Oligos designated mph are derived from the human cDNA sequence whereas those designated MP are derived from the bovine cDNA sequence. Some of the MP oligos deviate somewhat from the human sequence. F means forward and homologous to the sense strand whereas R means reverse and complementary to the sense strand. The oligos are all given in the 5' -> 3' direction and numbers indicate the positions of the 5' nucleotides. Oligos designated mphI are complementary to intronic sequences (22). Primer mph3UTR-RI contains an EcoRI linker which is underlined.
Tissue specific expression was examined on Human Multiple Tissue Northern (MTN) Blot and Human Brain Multiple Tissue Northern (MTN) Blot I and II, delivered by Clontech Laboratories Inc., CA, USA. Each lane contains 2 [mu]g poly A+ RNA. The blots were hybridized to a human 2.8 kb [alpha]-mannosidase DNA fragment generated by primers MP1F and MP1R as described above, and according to the method described by Church and Gilbert (32 ). The Human Multiple Tissue Blot was exposed overnight whereas the Human Brain Multiple Tissue Blot was subjected to exposure for 6 days. A human [beta]-actin probe was hybridized to the same blots to serve as an internal control.
cDNA from a normal individual and an affected Palestinian boy (23 ) was amplified, as overlapping fragments, by PCR, with primer combinations; MP1F/MP263R, mph30F/MP26R, MP303F/MP5R, MP305F/mph2R and mph306bF/mph3UTR-RI. Initial denaturation was carried out at 94oC for 4 min, followed by 30 cycles with denaturation at 94oC for 30 s, annealing at 57oC (MP303F/MP5R) or at 62oC for 1 min and extension at 72oC for 3 min. The resulting fragments were sequenced directly with primers MP1F, MP263R, mph30F, mph302F, MP26R, MP303F, MP304F, MP5R, mph305bF, mph305R, mph2R, mph306bF, MP1R and mph310F. Upon comparison with the normal cDNA sequence the affected boy was found to be homozygous for two nucleotide alterations, an A -> T transversion at nt position 212 and a C -> T transition at nt position 932. Upon cDNA sequencing, the carrier father was shown to be heterozygous for A/T212 and homozygous for T932 (result not shown). Samples from the carrier mother were not available. The region spanning A/T212 was amplified from genomic DNA as a 657 bp fragment with primer combination mphI1F/mphI3R, with initial denaturation at 94oC for 5 min followed by 34 cycles with denaturation at 94oC annealing/extension at 66oC for 2 min. The resulting PCR product was digested with MslI and subjected to agarose gel electrophoresis. The A212 allele gave rise to five bands of 182, 160, 128, 119 and 68 bp, whereas the T212 allele gave rise to four bands of 279, 182, 128 and 68 bp (Fig. 5 B).
A 270 bp fragment containing the polymorphic C/T932 was amplified with primers mphI6F and mphI7R, with initial denaturation at 94oC for 5 min followed by 32 cycles with denaturation at 94oC for 1 min and annealing/extension at 66oC for 1 min. The PCR product was diluted to 1/50 and subjected to re-PCR with primers C932T and mphI7R (denaturation at 94oC for 5 min followed by 10 cycles with 94oC for 1 min, 45oC for 30 s and 72oC for 1 min, followed by 22 more cycles with annealing at 52oC). An SspI restriction site was created at T932 by replacement of nucleotides C19 with A and C21 with T in the C932T primer (Table 2 ). The two alleles, C932 and T932, were distinguished by SspI digestion and Metaphor agarose gel electrophoresis (2.5%). A 200 bp band was specific for the C932 allele whereas two bands, of 179 and 21 bp, were specific for the T932 allele.
The N-terminal sequencing was carried out by Drs Knut Sletten and Jessie Juul at the Biotechnology Centre of Oslo, Norway. The patient material was kindly provided by Dr Gideon Bach, Department of Human Genetics, Hadassah-Hebrew University Medical Center, Jerusalem, Israel. DNA samples from Palestinian normal controls were kindly provided by Dr Batsheva Bonnè-Tamir, Department of Human Genetics, Tel Aviv University, Israel.
1 Aronson, N.N.J. and Kuranda, M.J. (1989) Lysosomal degradation of Asn-linked glycoproteins. FASEB J., 3, 2615-2622.
2 Daniel, P.F., Winchester, B. and Warren, C.D. (1994) Mammalian [alpha]-mannosidases; multiple forms but a common purpose? Glycobiology, 4, 551-566. MEDLINE Abstract
4 Chester, M.A., Lundblad, A., Öckerman, P.A. and Autio, S. (1982) Mannosidosis. In: Genetic Errors of Glycoprotein Metabolism (Durand, P. and O'Brien, J., eds), pp. 89-121, Edi-Ermes, Milano, Springer-Verlag, Berlin.
5 Hocking, J.D., Jolly, R.D. and Batt, R.D. (1972) Deficiency of [alpha]-mannosidase in Angus cattle. An inherited lysosomal storage disease. Biochem. J., 128, 69-78. MEDLINE Abstract
6 Burditt, L.J., Chotai, K., Hirani, S., Nugent, P.G., Winchester, B.G. and Blackmore, W.F. (1980) Biochemical studies on a case of feline mannosidosis. Biochem. J, 189, 467-473. MEDLINE Abstract
7 Hommes, F.A. and Varghese, M. (1991) High-performance liquid chromatography of urinary oligosaccharides in the diagnosis of glycoprotein degradation disorders. Clin. Chem. Acta, 203, 211-224.
8 Champion, M.J. and Shows, T.B. (1977) Mannosidosis: assignment of the lysosomal [alpha]-mannosidase B gene to chromosome 19 in man. Proc. Natl. Acad. Sci. USA, 74, 2968-2972.MEDLINE Abstract
9 Kaneda, Y., Hayes, H., Uchida, T., Michihiro, M.C. and Okada, Y. (1987) Regional assignment of five genes on human chromosome 19. Chromosoma, 95, 8-12. MEDLINE Abstract
10 Nebes, V.L. and Schmidt, M.C. (1994) Human lysosomal [alpha]-mannosidase: Isolation and nucleotide sequence of the full-length cDNA. Biochem. Biophys. Res. Commun., 200, 239-245. MEDLINE Abstract
11 Liao, Y-F., Lal, A. and Moremen, K.W. (1996) Cloning, expression, purification, and characterization of the human broad specificity lysosomal acid [alpha]-mannosidase. J. Biol. Chem., 271, 28348-28358.
12 Cheng, S.H., Malcolm, S., Pemble, S. and Winchester, B.G. (1986) Purification and comparison of the structures of human liver acidic [alpha]-D-mannosidases A and B. Biochem. J., 233, 65-72. MEDLINE Abstract
13 Emiliani, C., Martino, S., Stirling, J.L., Maras, B. and Orlacchio, A. (1995) Partial sequence of the purified protein confirms the identity of cDNA coding for human lysosomal [alpha]-mannosidase B. Biochem. J., 305, 363-366. MEDLINE Abstract
14 Tollersrud, O.K., Berg, T.B., Healy, P., Evjen, G., Ramachandran, U. and Nilssen, Ø. (1997) Purification of bovine lysosomal [alpha]-mannosidase, characterization of its gene and identification of mutations that cause bovine [alpha]-mannosidosis. Submitted.
15 Moremen, K.W. and Robbins, P.W. (1991) Isolation, characterization, and expression of cDNAs encoding murine [alpha]-mannosidase II, a Golgi enzyme that controls conversion of high mannose to complex N-glycans. J. Cell. Biol., 115, 1521-1534.
16 Schatzle, J., Bush, J. and Cardelli, J. (1992) Molecular cloning and characterization of the structural gene coding for the developmentally regulated lysosomal enzyme, [alpha]-mannosidase, in Dictyostelium discoideum. J. Biol. Chem., 267, 4000-4007. MEDLINE Abstract
17 Meirendorf, R.C., Cardelli, J.A., Livi, G.P. and Dimond, R.L. (1983) Synthesis of related forms of the lysosomal enzyme [alpha]-mannosidase in Dictyostelium discoideum.J. Biol. Chem., 258, 5878-5884.
18 Okumura, T. and Yamashina, I. (1973) Further purification and characterization of [alpha]-mannosidase from hog kidney. J. Biochem. Tokyo., 73, 131-138.
19 Kozak, M. (1991) An analysis of vertebrate mRNA sequences: Intimations of translational control. J. Cell. Biol., 115, 887-903. MEDLINE Abstract
20 von-Heijne, G. (1983) Patterns of amino acids near signal-sequence cleavage sites. Eur. J. Biochem., 133, 17-21.
21 von-Heijne, G. (1984) How signal sequences maintain cleavage specificity. J. Mol. Biol., 173, 243-251.
22 Riise, H.M.F., Berg, T., Nilssen, Ø., Romeo, G., Tollersrud, O.K. and Ceccherini, I. (1997) Genomic structure of the human lysosomal [alpha]-mannosidase gene. Genomics, In press.
23 Bach, G., Kohn, G., Lasch, E.E., El-Massri, M., Ornoy, A., Sekeles, E., Legum, C. and Cohen, M.M. (1978) A new variant of mannosidosis with increased residual enzymatic activity and mild clinical manifestation. Pediatr. Res., 12, 1010-1015. MEDLINE Abstract
24 Foster, J.M., Yudkin, B., Lockyer, A.E. and Roberts, D.B. (1995) Cloning and sequence analysis of GmII, a Drosophila melanogaster homologue of the cDNA encoding murine Golgi [alpha]-mannosidase II. Gene, 154, 183-186.MEDLINE Abstract
25 Bischoff, J., Moremen, K. and Lodish, H.F. (1990) Isolation, characterization, and expression of cDNA encoding a rat liver endoplasmic reticulum [alpha]-mannosidase. J. Biol. Chem., 265, 17110-17117. MEDLINE Abstract
26 Pohlmann, R., Hasilik, A., Cheng, S., Pemble, S., Winchester, B.G. and von-Figura, K. (1983) Synthesis of lysosomal [alpha]-mannosidase in normal and mannosidosis fibroblasts. Biochem. Biophys. Res. Commun., 115, 1083-1089. MEDLINE Abstract
27 Bennet, J.K., Dembure, P.P. and Elsas, L.J. (1995) Clinical and biochemical analysis of two families with type I and type II mannosidosis. Am. J. Med. Genet., 55, 21-26. MEDLINE Abstract
29 Walkley, S.U., Thrall, M.A., Dobrenis, K., Huang, M., March, P.A., Siegel, D.A. and Wurzelmann, S. (1994) Bone marrow transplantation corrects the central nervous system in a lysosomal storage disease. Proc. Natl. Acad. Sci. USA, 91, 2970-2974.MEDLINE Abstract
30 Opheim, D. and Touster, O. (1978) Lysosomal [alpha]-D-mannosidase of rat liver. J. Biol. Chem., 253, 1017-1023.MEDLINE Abstract
31 Sambrook, J., Fritch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual 2nd ed. Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, USA.
32 Church, G.M., and Gilbert, W. (1984) Genomic sequencing. Proc. Natl. Acad. Sci. USA, 81, 1991-1995.MEDLINE Abstract
*To whom correspondence should be addressed at: Tel: +47 7764 5421; Fax +47 7764 5430; Email: oivindn@fagmed.uit.no
-->
This page is maintained by OUP admin. Last updated Fri Apr 11 08:44:24 BST 1997. Part of the OUP Journals World Wide Web service.
Copyright
Oxford University Press, 1996
