Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (59)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Habuchi, T.
Right arrow Articles by Knowles, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Habuchi, T.
Right arrow Articles by Knowles, M. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 913-920

A novel candidate tumour suppressor locus at 9q32-33 in bladder cancer: localization of the candidate region within a single 840 kb YAC
Introduction
Results
Discussion
Materials And Methods
   Detection of loss of heterozygosity by microsatellite analysis
   Isolation and characterization of YAC clones
   Generation of sequence-tagged sites (STSs) from YAC-ends
   Construction of the YAC contig map
   Uniform resource locators (URLs) for public genome data
Acknowledgements
References

A novel candidate tumour suppressor locus at 9q32-33 in bladder cancer: localization of the candidate region within a single 840 kb YAC

A novel candidate tumour suppressor locus at 9q32-33 in bladder cancer: localization of the candidate region within a single 840 kb YAC Tomonori Habuchi1, Osamu Yoshida2 and Margaret A. Knowles1,*

1Molecular Genetics Laboratory, Marie Curie Research Institute, The Chart, Oxted, Surrey RH8 0TL, UK and 2Department of Urology, Faculty of Medicine, Kyoto University, Kawahara-cho 54, Sakyo-ku, Shogoin, Kyoto 606, Japan

Received December 23, 1996; Revised and Accepted March 12, 1997

Loss of heterozygosity (LOH) on chromosome 9q is the most frequent genetic alteration in transitional cell carcinoma (TCC) of the bladder, implicating the presence of a tumour suppressor gene or genes on 9q. To define the location of a tumour suppressor locus on 9q in TCC, we screened 156 TCCs of the bladder and upper urinary tract by detailed deletion mapping using 31 microsatellite markers on 9q. Partial deletions of 9q were found in 10 TCCs (6%), and LOH at all informative loci on 9q was found in 77 TCCs (49%). In five low grade superficial bladder tumours, the partial deletion was localized to D9S195 located at 9q32-33, with retention of heterozygosity at all other informative loci including D9S103, D9S258, D9S275 and GSN. We constructed a yeast artificial chromosome (YAC) contig covering the deleted region in these five tumours and placed another four unmapped microsatellite markers on this contig map. Using these markers, we further defined the common deleted region to the interval between D9S1848 and AFMA239XA9. The region is covered by a single YAC (852e11), whose size is estimated to be 840 kb. Our data should expedite further fine mapping and identification of the candidate tumour suppressor gene at 9q32-33.

INTRODUCTION

Transitional cell carcinoma (TCC) is the most common form (~90%) of malignant epithelial tumour of the bladder and upper urinary tract. Molecular genetic and cytogenetic analyses have shown that multiple genetic alterations are involved in the genesis and progression of transitional cell carcinomas. Among these alterations, loss of heterozygosity (LOH) or deletion of chromosome 9q and/or 9p is the most frequent genetic alteration (>50%) in both superficial papillary and invasive TCC (1 -4 ). LOH studies have demonstrated the frequent occurrence of LOH at all loci on both arms of chromosome 9, and cytogenetic studies have identified frequent monosomy 9 in TCC (5 -8 ). Detailed deletion mapping studies using microsatellite markers have defined localized deletions on the short arm and long arm of chromosome 9 (9 ,10 ). These data suggest that alterations of multiple tumour suppressor genes on chromosome 9 may occur in the genesis and progression of TCC.

Localized homozygous or hemizygous deletion at 9p21 is found in some TCCs as well as many other malignant tumours, suggesting the existence of a tumour suppressor gene at this locus (11 -13 ). Candidate tumour suppressor genes, p16/CDKN2/ MTS1 and p15/MTS2 identified at 9p21 have been found to be homozygously deleted in many types of human malignant tumour including TCC (14 -17 ). On 9q, we have shown that there are at least two common deleted regions, one at 9q34 and another at 9q13-31 (18 ). These findings are consistent with the results of Simoneau et al. (19 ). The commonly deleted regions on 9q which have been reported to date are relatively large, and further refined localization of the candidate tumour suppressor loci has been hampered by the low frequency of partial deletions (5 ,6 ,9 ,10 ,18 ). However, partial deletions telomeric to 9q31 have been found in several TCCs, and the occurrence of partial deletions here is more frequent than on proximal 9q (18 ,19 ), indicating that there may be a tumour suppressor locus in this region. Furthermore, partial deletions telomeric to 9q31-32 have been reported in other types of human malignant tumour (20 -26 ). In this study, we have attempted to detect more localized deletions in the telomeric 9q region by using a larger number of microsatellite markers. Here we report the localization of a deleted region at 9q32-33 in TCC and the construction of a yeast artificial chromosome (YAC) contig map encompassing the region. Further deletion mapping analyses suggest that the region for a candidate tumour suppressor is localized within a single YAC whose size is estimated to be 840 kb.

RESULTS

We analysed 156 TCCs of the bladder and upper urinary tract using 31 microsatellite markers on 9q. These tumours included 26 TCCs which showed retention of heterozygosity at all informative loci examined in a previous study (10 ). LOH at at least one locus on 9q was detected in 87 of 156 TCCs (56%), whereas 69 (44%) showed retention of heterozygosity at all loci. Seventy seven (49%) tumours showed LOH at all informative loci on 9q. This frequency of LOH on 9q is an underestimate of the overall frequency in TCC since the present study included a selected group of 26 tumours which showed retention of heterozygosity at all informative 9q loci examined previously (10 ). If these cases are not included, 86 of 130 TCCs (66%) showed LOH at at least one locus on 9q. Ten tumours (6%) showed partial deletions on 9q, and five of the 10 tumours (3%) had LOH at D9S195, which is mapped at 9q32-33, and retention of heterozygosity at all other informative loci on 9q (Figs 1 and 2 ). These five tumours also showed retention of heterozygosity at all informative 9p21 markers and no homozygous deletion at 9p21 by multiplex PCR analyses (17 ). The results for the other five partial deletions on 9q have been described previously (18 ), and further deletion mapping in these five tumours did not significantly narrow the localization of the deleted region (data not shown). In accordance with previous studies (1 -6 ), the existence of LOH on 9q was not significantly associated with tumour grade and stage. LOH at at least one locus on 9q was observed in 14 of 21 grade 1 TCCs (67%), 38 of 56 grade 2 TCCs (68%) and 23 of 38 grade 3 TCCs (61%) (P >0.1, [chi]2). As for stage, LOH on 9q was found in 26 of 36 Ta TCCs (72%), 16 of 31 T1 TCCs (52%), and 27 of 39 T2 or higher stage TCCs (69%) (P >0.1, [chi]2). Interestingly, the five tumours with localized LOH at D9S195 were all classified as low grade (grade 1 or 2) superficial (Ta or T1) TCCs (Fig. 1 ).


Figure 1. Localized deletion at 9q32-33 found in five TCCs. The five tumours depicted showed retention of heterozygosity at all other informative loci on 9q and 9p. Other examined loci are described in Materials and Methods. The order of markers from D9S103 to D9S195 and D9S258 has not been defined clearly. D9S275 has been mapped 1 cM proximal to D9S195 and D9S258 by Généthon.


Figure 2. Representative autoradiographs showing the pattern of localized deletion at 9q32-33. N, normal DNA; T, tumour DNA. Deleted alleles are indicated with arrowheads in (A), (B) and (C). (A) In tumour no. 35, LOH is found at D9S195 with retention of heterozygosity at the other markers. (B) In tumour no. 68, LOH is observed at D9S195 and AFMA239ZE1 with retention of heterozygosity at the other markers. (C) In tumour no. 121, localized LOH is found at D9S195 with retention of heterozygosity at D9S1848, AFMA239ZE1 and AFMA239XA9. (D) Representative patterns for microsatellite markers D9S195, AFMA239ZE1 and D9S1848. In D9S195, stutter (ghost) bands were observed consistently both above and below the major band representing each allele. With this marker, a significant difference in intensity between each allele is observed normally (case nos 51, 84, 93 and 35 in A) where there is large difference in allele size. Cases no. 131 and no. 135 are constitutionally homozygous (not informative) at this locus and all other tumours shown have LOH. The markers AFMA239ZE1 and D9S1848 show no stutter bands above the major band. Tumour no. 23 shows loss of an upper allele and tumours no. 29 and no. 30 show a clear loss of a lower allele at AFMA239ZE1. Note that heterozygotes for AFMA239ZE1 show a significant difference in intensity between each allele differing only by one CA repeat unit, as seen in case no. 68 (B). At D9S1848, tumours nos 43, 44, 53, 65, and 128 show retention of heterozygosity and all other cases are constitutionally homozygous.

For the identification of a candidate tumour suppressor gene at this locus, we then constructed a YAC contig of the deleted region. The Généthon linkage map (http://www.genethon.fr/, March 1996) places both D9S195 and D9S258 1 cM distal to D9S275 at 135 cM from the top of chromosome 9, and other linkage data has placed D9S195 proximal to GSN (27 ,28 ). However, the precise order of the markers D9S103, D9S258, D9S275, D9S195, D9S302 and GSN was not defined clearly. We obtained and analysed 10 YAC clones from the Centre d'Etudes du Polymorphisme Humain (CEPH) (29 ) known to be positive for D9S195, D9S258, and D9S275. We also screened the ICI YAC library (30 ) with D9S195, D9S258, D9S275 and D9S302 by PCR and we identified 11, seven and three positive clones for D9S195, D9S258 and D9S275 respectively (Fig. 3 ). Three CEPH YACs were found to contain D9S103 and three other CEPH YACs contained GSN (Fig. 3 ). We could not find a YAC containing D9S302 in the ICI library. We first constructed a YAC contig by PCR analyses using the five markers (D9S103, D9S195, D9S258, D9S275 and GSN). To refine the YAC contig map further, we then isolated 10 YAC-end fragments from five clones by the vectorette method, and established 10 sequence-tagged sites (STSs) (Table 1 ). These new STSs were mapped to chromosome 9 by PCR using the human-Chinese hamster ovary hybrid cell line GM10611, which contains an intact human chromosome 9 in a Chinese hamster background (31 ) and the other YACs. We also identified the marker D9S123 in CEPH YAC 765b11. Considering the linkage data and CEPH YAC data (http://www.ceph.fr/) indicating that YACs 755g12, 798e3, 767h1 and 765b11 overlap each other, the resulting YAC contig map is shown in Figure 3 . Our data indicate the likely order of these markers as (centromere)-D9S275-D9S195-D9S258- D9S103- GSN-(telomere). YAC 908c11 may contain a large internal deletion. However, if we assume that no YACs have an internal deletion, the orientation of the markers from D9S275 to D9S103 (Fig. 3 ) may be reversed and the likely order is (centromere)-D9S103-D9S258-D9S195-D9S275-GSN-(telomere). In either case, the flanking markers for the deleted region in the five tumours with selective deletions are D9S258 and D9S275 (Fig. 3 ). Although D9S302 previously was closely linked to D9S195 by linkage analyses (27 ), this marker was absent from all the YAC clones analysed.


Figure 3.A YAC contig map encompassing the deleted region at 9q32-33. 3EG8, 21GH3, 36GD9, 15HD3, 12IB1, 28BB3, 9EE5, 9DC8 and 21GH3 are from the ICI YAC library (30) and other YACs are from the CEPH YAC library (29). Black and white squares indicate the presence or absence of a particular STS in each YAC, respectively. Hatched squares indicate the YAC-end STSs. -R and -L indicate right and left YAC-ends, respectively. The size of each YAC was determined by CHEF-gel electrophoresis, followed by Southern hybridization with total human DNA. The size of all CEPH YACs shown was consistent with CEPH data.


Figure 4.Further deletion mapping in the critical deleted region in five tumours with localized deletion at 9q32-33. The order of microsatellite markers was determined from the YAC contig map constructed. White, black and hatched squares indicate retention of heterozygosity, LOH and constitutional homozygote (not informative), respectively.

In order to define the deleted region further, we tried to locate other published microsatellite markers on this YAC contig map. According to Généthon linkage data and data from the Whitehead Institute-MIT Genome Center (http://www-genome.wi.mit.edu/, Release 11, October 1996), four microsatellite markers, D9S1848, GGAA-P17524, AFMA239XA9 and AFMA239ZE1 have been mapped close to D9S195. Using the YAC contig map, we placed D9S1848 between 852e11-R and 9DC8-R, AFMA239ZE1 between 814c5-L and 12IB1-R, AFMA239XA9 between 12IB1-L and 852e11-L and GGAA-P17524 between 15HD3-R and 814c5-R (Fig. 3 ). The likely order of these markers is therefore (centromere)-D9S275-D9S1848-AFMA239ZE1- D9S195-AFMA239XA9-GGAA-P17524-D9S258-D9S103-GSN-(telomere) (Fig. 3 ). Using these markers, we analysed the extent of the deletion in the five tumours with localized deletion at 9q32-33 (Figs 2 and 4 ). Three tumours (nos 35, 68 and 121) retained heterozygosity at AFMA239XA9, and all five tumours retained heterozygosity at D9S1848. In addition to D9S195, LOH was detected at AFMA239ZE1 in tumours no. 68 and no. 102. Since only tumour no. 121 showed retention of heterozygosity at AFMA239ZE1, the consensus candidate region for a tumour suppressor gene is between D9S1848 and AFMA239XA9 (Fig. 4 ). This region is covered by a single YAC (852e11) and is considered to be <840 kb, if this YAC has neither deletion nor rearrangement (Fig. 3 ).

DISCUSSION

Frequent occurrence of monosomy 9 or LOH at all informative loci in TCC indicates that inactivation of multiple tumour suppressors on chromosome 9 may occur during the genesis and progression of TCCs (5 -10 ). In support of this theory, recent studies by us and Simoneau et al. have shown that at least two tumour suppressor loci, one at 9q13-31 and another at 9q34, may exist on chromosome 9 in addition to that at 9p21 (18 ,19 ). In this study, we found five tumours with localized deletion at 9q32-33, indicating the presence of another candidate tumour suppressor locus for TCC in this region. Although the frequency of localized deletion at this locus is not high (3%), the presence of an important tumour suppressor gene in this region may be suggested for several reasons. First, accumulating data from several deletion mapping studies in TCC have shown that partial deletions on 9q mostly encompass this region, although localized deletion at 9q34 or at 9q13-31 is also found at low frequency (5 ,6 ,9 ,10 ,18 ,19 ). So far, we have found 13 TCCs with partial deletion on 9q (10 ,18 ), and the deletion in only a single tumour does not include the region defined in this study. Second, since LOH involving the entire long arm of chromosome 9 is found in >50% of TCCs (5 ,6 ,10 ,18 ), inactivation of a tumour suppressor at 9q32-33 and/or other tumour suppressor(s) on 9q may occur in a substantial proportion of TCCs with LOH on the whole of 9q. Furthermore, a recent study of microcell-mediated transfer of normal chromosome 9 into bladder cancer cells also indicates the presence of at least three tumour suppressor loci on 9q, and one candidate region encompasses the region defined in this study (32 ). Interestingly, all five TCCs with localized deletion at 9q32-33 were low grade superficial tumours (Fig. 1 ). Although we have not sequenced p16 and p15 genes in these tumours, all these tumours showed retention of heterozygosity at 9p21 and no homozygous deletion by multiplex PCR analyses (17 ). Therefore, it may be speculated that inactivation of a tumour suppressor located on 9q32-33 sometimes occurs in these low grade superficial tumours without inactivation of other tumour suppressors on chromosome 9. However, this is likely to be a rare event since LOH at all loci on chromosome 9 or monosomy 9 is frequently found even in low grade low stage TCCs (1 -8 ). The identification of all relevant tumour suppressor(s) on chromosome 9 will be required to define the roles of partial or total hemizygous loss of chromosome 9 in the genesis and progression of TCC.

Table 1 PCR primers and conditions for new YAC-end sequence-tagged sites (STSs)
YAC-end

 Primer sequence (5'-)

 Size
(bp)		 Annealing
temp. (5C)		 MgCl2
814c5-L

 1:GTACCTTAATAGCCTACAAGAC

 133

 55

 1.0
 

 2:CGGAATTCAATTCAGCTAAGTC

  

  

  
814c5-R

 1:TTCATGACCCTGTACTGTTTGC

 137

 55

 1.0
 

 2:CACTTTGGTGATAACCTCCATTC

  

  

  
852e11-L

 1:GAACTTTACATGCCGATAGACTTTG

113

 55

 1.0
 

 2:GAATTCTTGGCTCTTGTACTCTGT

  

  

  
852e11-R

 1:TGGGCTGCACAATTAGAACGTG

144

 55

 1.0
 

 2:AGGGAGAATTTGACAGCGAGAT

  

  

  
9DC8-L

 1:GCAATCAGCCTGAATGCAGGCT

 162

 50

 1.0
 

 2:ACTAGGGATCTGCATTGCTGAT

  

  

  
9DC8-R

 1:GAATTCAGGAGCCATGTGGAAT

 140

 55

 1.5
 

 2:AGGGAAACTAGTCTCAGAGAACT

  

  

  
12IB1-L

 1:CCATGGTTTGAACTGCAGTGTA

 190

 55

 1.0
 

 2:AGGGGTATGGTCATGAAGGATA

  

  

  
12IB1-R

 1:TTGACTGGAGAGCTAGTTTGCC

 168

 55

 1.0
 

 2:ACTGGATTCCTAGAGTGTATGTC

  

  

  
15HD3-L

 1:ATCTAGCCTTGCAAAGGTCCTAC

 113

 57

 1.0
 

 2:AGCTTGTAATCTGTAACGTGGCT

  

  

  
15HD3-R

 1:CCTTAATGCATACAGATCAATGCC

 81

 55

 1.0
 

 2:AAGGACAAGTGGATCCTACCAT

  

  

  

LOH involving 9q has been reported in other types of human cancer, including squamous cell carcinoma of the head and neck (20 ,21 ), squamous cell carcinoma of the skin (22 ), ovarian cancer (23 ,24 ), renal cell carcinoma (25 ) and oesophageal cancer (26 ). The localized deleted regions reported in these other cancers encompass the region at 9q32-33 described here. One of the candidate tumour suppressor loci in ovarian cancer has been mapped between HXB at 9q32 and ASS1 at 9q34.1 (23 ,24 ), which encompasses this region. Partial deletions telomeric to HXB and telomeric to D9S127 at 9q22.1-32 were reported in renal cell carcinoma and head and neck squamous cell carcinoma, respectively (20 ,25 ). Although a candidate tumour suppressor locus in oesophageal cancer has been mapped at 9q31-32, which is distinct from the region reported here (26 ), many partial deletions in oesophageal cancer also involve the region at 9q32-33 (26 ). Therefore, inactivation of a candidate tumour suppressor at 9q32-33 may be involved in other types of human cancer, and further detailed deletion mapping studies in these cancers may be interesting.

As an important step for positional cloning of the tumour suppressor gene, we have constructed a YAC contig map covering the entire candidate region. The order of the microsatellite markers determined by the YAC contig map mostly conforms to existing linkage data (27 ,28 and Généthon) if we assume that YAC 908c11 contains an internal deletion. If this were not the case, the orientation of markers from D9S275 to D9S103 would be reversed (Fig. 3 ) and there would be a discrepancy with the existing linkage data. Such a discrepancy could be the result of a mistyping in the genotype database, or a hybrid containing an unrecognized fragment or an internal deletion within a YAC (33 ). Since all 10 YAC-end STSs generated in this study have been mapped to the YAC contig and to chromosome 9, it is unlikely that these YACs are chimeric. It is suggested that the critical region for the tumour suppressor is localized between D9S1848 and AFMA239XA9 and is estimated to be <840 kb if the YAC 852e11 has no deletion. Since the region is also covered by six overlapping ICI YACs with relatively small size (Fig. 2 ), this YAC contig map will be useful for further fine mapping of this region and locating other STSs or expressed sequenced tags (ESTs).

MATERIALS AND METHODS

Detection of loss of heterozygosity by microsatellite analysis

Specimens of 145 TCCs of the bladder and nine TCCs of the ureter or renal pelvis were obtained with paired blood or normal kidney samples as a source of constitutional normal DNA. DNA from tumour specimens and corresponding normal tissues (peripheral blood or normal kidney) were obtained by proteinase K digestion followed by phenol/chloroform extraction. Adjacent portions of each tumour specimen were subjected to histopathological examination. Tumour stage and grade were classified according to the TNM system and the WHO criteria, respectively. We initially used 31 microsatellite markers mapped to 9q. Nine markers on 9q32-33 are shown in Figure 1 . The other 22 markers on 9q used were D9S15, D9S153, D9S167, D9S152, D9S201, D9S283, D9S119, D9S12, D9S176, D9S109, D9S127, D9S53, D9S58, D9S105, D9S59, D9S123, D9S282, D9S60, D9S61, ABL, D9S66 and D9S67. To evaluate 9p status in five tumours with localized deletion at 9q32-33, we tested D9S199, D9S200, IFNA, D9S1749, D9S126 and D9S171 by multiplex PCR (17 ). Primer sequences were obtained from the Genome Database. PCR reactions were carried out in 12.5 [mu]l reaction volumes with 5-10 ng of genomic DNA as template, 1.0-1.5 mM MgCl2, 200 [mu]M of each deoxynucleotide triphosphate, 2 pmol of each primer, 1 U of Taq DNA polymerase and buffer supplied by the manufacturer (Life Technologies). One of each primer pair was end labelled with 32P. PCR reactions consisted of 26-27 cycles of 1 min at 95oC, 1 min at 55oC and 1.5 min at 72oC, followed by a final elongation. Reaction products were diluted with formamide dye, heat-denatured, and run in 6% denaturing polyacrylamide gels. Gels were dried and exposed to Fuji XR film and subsequently to a PhosphorImager screen (Molecular Dynamics). Initially, LOH was screened visually for loss of one allele, and cases with `partial loss' or `allelic imbalance' were analysed further by the PhosphorImager using the ImageQuant software (Molecular Dynamics). A relative decrease in the intensity of the signal from one tumour allele of >40% was scored as LOH. Loci at which new alleles were detected (microsatellite alterations) were considered to be `not informative'.

Isolation and characterization of YAC clones

Two YAC libraries were used for YAC clone isolation and construction of a YAC contig. The ICI YAC library (30 ) was screened by PCR using published primer sequences for D9S258, D9S275, D9S195 and D9S302. From the CEPH YAC library (29 ), we obtained and analysed 10 YAC clones that have been shown to be positive for one of three microsatellite markers, D9S195, D9S258 and D9S275, or shown to be contiguous to positive YACs. High molecular weight DNA from each YAC clone was prepared in agarose blocks as described (34 ) and subjected to pulse-field electrophoresis in 1% agarose gels using a contour-clamped homogeneous electric field (CHEF) apparatus (Bio-Rad- CHEF DRT II system). Typical running conditions were as follows: 60 s pulse time for 15 h followed by a 90 s pulse time for 9 h at 200 V in 0.5* TBE buffer at 14oC. After ethidium bromide staining, gels were blotted onto nylon membranes (Hybond N+, Amersham) using 0.4 M NaOH as transfer buffer, and each blot was hybridized with total human DNA 32P-labelled by random priming. The size of each YAC was evaluated by using Saccharomyces cerevisae (strain YNN295, BioRad) chromosome and mutimers of [lambda] phage (BioRad) as size markers. The size of all CEPH YACs shown in Figure 2 was consistent with CEPH data (http://www.ceph.fr/).

Generation of sequence-tagged sites (STSs) from YAC-ends

STSs from YAC insert ends (YAC-ends) were generated using the modified vectorette-PCR procedure as described by Riley et al. (35 ) and direct DNA sequencing of PCR fragments. Briefly, YAC DNAs were prepared as described (34 ) and three vectorette libraries were prepared for each YAC. YAC DNA was digested with RsaI, AluI or PvuII, and then ligated with the blunt-end vectorette cassette as described (35 ). Using these three vectorette libraries as templates, PCR was performed with 224 primer (35 ) and a primer 5'-CTACTTGGAGCCACTATCGACTACGCGATC to isolate the left arm of each YAC and with 224 primer and a primer 5'-CTTGCAAGTCTGGGAAGTGAATGGAGACAT to isolate the right arm. The resulting PCR products were electrophoresed in agarose gels, and amplified fragments of appropriate size were recovered and used as sequencing templates. Direct sequencing was performed using internal primers 1207 and 368 (35 ) for the left YAC-end fragments and 1208 and 368 (35 ) for the right YAC-end fragment using a cycle sequencing kit (fmol sequencing system, Promega). Oligonucleotides which can amplify a 81-190 bp PCR fragment from each YAC-end sequence were generated (Table 1 ). The presence or absence of these STSs in each YAC clone was tested at least twice by PCR amplification and agarose gel electrophoresis. DNA from a hybrid cell line GM10611 containing an intact human chromosome 9 in a Chinese hamster background (31 ) and original YAC clone DNAs were used as positive control templates, and normal hamster fibroblast DNA as a negative control template.

Construction of the YAC contig map

Using microsatellite markers and 10 new YAC-end STSs, a YAC contig map was constructed by PCR-based analyses. PCR reactions were performed with 20 ng of YAC DNA or yeast cell pellets washed with 1* TE in 25 [mu]l reaction volumes using 1 U of Taq DNA polymerase with 200 [mu]M concentrations of each dNTP and 1.0-1.5 mM of MgCl2. PCR reactions were carried out routinely using a `hot-start', in which Taq polymerase was added to the reaction after a 5 min denaturing step at 95oC. Thirty to 35 amplification cycles with 95oC for 60s, 50-55oC for 60s and 72oC for 90s were performed.

Uniform resource locators (URLs) for public genome data

We used the following publicly available data from the World Wide Web.

The Centre d'Etudes du Polymorphisme Humain (CEPH): http://www.ceph.fr/

Généthon: http://www.genethon.fr/

The Genome Database: http://gdbwww.gdb.org/gdb

Whitehead Institute for Biomedical Research/MIT Center for Genome Research: http://www.genome.wi.mit.edu/

ACKNOWLEDGEMENTS

We thank Dr Graham Currie for helpful comments on the manuscript. We are grateful to the Centre d'Etudes du Polymorphisme Humain (Paris, France) for providing CEPH YAC clones and the Human Genome Mapping Project Resource Centre (Cambridge, UK) for the ICI YAC library and clones. This work was supported by Marie Curie Cancer Care and by a grant from the Medical Research Council.

REFERENCES

1 Olumi, A.F., Tsai, Y.C., Nichols, P.W., Skinner, D.G., Cain, D.R., Bender, L.I. and Jones, P.A. (1990) Allelic loss of chromosome 17p distinguishes high grade from low grade transitional cell carcinomas of the bladder. Cancer Res.,50,7081-7083. MEDLINE Abstract

2 Dalbagni, G., Presti, J., Reuter, V., Fair, W.R. and Cordon-Cardo, C. (1993) Genetic alterations in bladder cancer. Lancet, 342, 469-471. MEDLINE Abstract

3 Knowles, M.A., Elder, P.A., Williamson, M., Cairns, J.P., Shaw, M.E. and Law, M.G. (1994) Allelotype of human bladder cancer. Cancer Res., 54, 531-538. MEDLINE Abstract

4 Habuchi, T., Ogawa, O., Kakehi, Y., Ogura, K., Koshiba, M., Hamazaki, S., Takahashi, R., Sugiyama, T. and Yoshida, O. (1993) Accumulated allelic losses in the development of invasive urothelial cancer. Int. J. Cancer, 53, 579-584. MEDLINE Abstract

5 Cairns, P., Shaw, M.E. and Knowles, M.A. (1993) Preliminary mapping of the deleted region of chromosome 9 in bladder cancer. Cancer Res., 53, 1230-1232. MEDLINE Abstract

6 Miyao, N., Tsai, Y.C., Lerner, S.P., Olumi, A.F., Spruck, C.H.,III, Gonzalez-Zulueta, M., Nichols, P.W., Skinner, D.G. and Jones, P.A. (1993) Role of chromosome 9 in human bladder cancer. Cancer Res., 53, 4066-4070. MEDLINE Abstract

7 Smeets, W., Pauwels, R., Laarakkers, L., Debruyne, F. and Geraedts, J. (1987) Chromosomal analysis of bladder cancer. III. nonrandom alterations. Cancer Genet. Cytogenet., 29, 29-41. MEDLINE Abstract

8 Vanni, R., Scarpa, R.M., Nieddu, M. and Usai, E. (1988) Cytogenetic investigation on 30 bladder carcinomas. Cancer Genet. Cytogenet., 30, 35-42. MEDLINE Abstract

9 Ruppert, J.M., Tokino, K. and Sidransky, D. (1993) Evidence for two bladder cancer suppressor loci on human chromosome 9. Cancer Res., 53, 5093-5095. MEDLINE Abstract

10 Keen, A.J. and Knowles, M.A. (1994) Definition of two regions of deletion on chromosome 9 in carcinoma of the bladder. Oncogene, 9, 2083-2088. MEDLINE Abstract

11 Cairns, P., Tokino, K., Eby, Y. and Sidransky, D. (1994) Homozygous deletions of 9p21 in primary human bladder tumors detected by comparative multiplex polymerase chain reaction. Cancer Res., 54, 1422-1424. MEDLINE Abstract

12 Stadler, W.M., Sherman, J., Bohlander, S.K., Roulston, D., Dreyling, M., Rukstalis, D. and Olopade, O.I. (1994) Homozygous deletion within chromosomal bands 9p21-22 in bladder cancer. Cancer Res., 54, 2060-2063.MEDLINE Abstract

13 Devlin, J., Keen, A.J. and Knowles, M.A. (1994) Homozygous deletion mapping at 9p21 in bladder carcinoma defines a critical region within 2 cM of IFNA. Oncogene, 9, 2757-2760. MEDLINE Abstract

14 Kamb, A., Gruis, N.A., Weaver-Feldhaus, J., Liu, Q., Harshman, K., Tavtigian, S.V., Stockert, E., Day, R.S., Johnson, B.E. and Skolnick, M.H. (1994) A cell cycle regulator potentially involved in genesis of many tumor types. Science,264, 436-440. MEDLINE Abstract

15 Nobori, T., Miura, K., Wu, D.J., Lois, A. Takabayashi, K. and Carson, D.A. (1994) Deletions of the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers. Nature, 368, 753-756. MEDLINE Abstract

16 Cairns, P., Polascik, T.J., Eby, Y., Tokino, K., Califano, J., Merlo, A., Mao, L., Herath, J., Jenkins, R., Westra, W., Rutter, J.L., Buckler, A., Gabrielson, E., Tockman, M., Cho, K.R., Hendrick, L., Bova, G.S., Isaacs, W., Koch, W., Schwab, D. and Sidransky, D. (1995) Frequency of homozygous deletion at p16/CDKN2 in primary human tumours. Nature Genet., 11, 210-212. MEDLINE Abstract

17 Williamson, M.P., Elder, P.A., Shaw, M.E., Devlin, J. and Knowles, M.A. (1995) p16(CDKN2) is a major deletion target at 9p21 in bladder cancer. Hum. Mol. Genet., 4, 1569-1577. MEDLINE Abstract

18 Habuchi, T., Devlin, J., Elder, P.A and Knowles, M.A. (1995) Detailed deletion mapping of chromosome 9q in bladder cancer: evidence for two tumour suppressor loci. Oncogene, 11, 1671-1674. MEDLINE Abstract

19 Simoneau, A.R., Spruck III, C.H., Gonzalez-Zulueta, M., Gonzalgo, M.L., Chan, M.F., Tsai, Y.C., Dean, M., Steven, K., Horn, T. and Jones, P.A. (1996) Evidence for two tumor suppressor loci associated with proximal chromosome 9p to q and distal chromosme 9q in bladder cancer and the initial screening for GAS1 and PTC mutations. Cancer Res., 56, 5039-5043. MEDLINE Abstract

20 Ah-See, K.W., Cooke, T.G., Pickford, I.R., Souter, D. and Balmain, A. (1994) An allelotype of squamous carcinoma of the head and neck using microsatellite markers. Cancer Res., 54, 1617-1621.

21 Loughran, O., Edington, K.G., Berry, I.J., Clark, L.J. and Parkinson, E.K. (1994) Loss of heterozygosity of chromosome 9p21 is associated with the immortal phenotype of neoplastic human head and neck keratinocytes. Cancer Res., 54, 5045-5049. MEDLINE Abstract

22 Quinn, A.G., Sikkink, S. and Rees, J.L. (1994) Delineation of two distinct deleted regions on chromosome 9 in human non-melanoma skin cancers. Genes Chromosomes Cancer, 11, 222-225. MEDLINE Abstract

23 Schultz, D.C., Vanderveer, L., Buetow, K.H., Boente, M.P, Ozols, R.F., Hamilton T.C. and Godwin, A.K. (1995) Characterization of chromosome 9 in human ovarian neoplasia identifies frequent genetic imbalance on 9q and rare alterations involving 9p, including CDKN2. Cancer Res., 55, 2150-2157. MEDLINE Abstract

24 Devlin, J., Elder, P.A., Gabra, H., Steel, C.M, Knowles, M.A. (1996) High frequency of chromosome 9 deletion in ovarian cancer: evidence for three tumour-suppressor loci. Br. J. Cancer, 73, 420-423. MEDLINE Abstract

25 Cairns, P., Tokino, K., Eby, Y. and Sidransky, D. (1995) Localization of tumor suppressor loci on chromosome 9 in primary human renal cell carcinomas. Cancer Res., 55, 224-227. MEDLINE Abstract

26 Miura K., Okita K., Furukawa Y., Matsuno S. and Nakamura Y. (1995) Deletion mapping in squamous cell carcinomas of the esophagus defines a region containing a tumor suppressor gene within a 4-centimorgan interval of the distal long arm of chromosome 9. Cancer Res., 55, 1828-1830. MEDLINE Abstract

27 Povey, S., Armour, J., Farndon, P., Haines, J.L., Knowles, M., Olopade, F., Pilz, A., White, J.A., the Utah Genome Center Genetic Marker and Mapping group, and Kwiatkowski, D.J. (1994) Report on the third international workshop on chromosome 9. Ann. Hum. Genet., 58, 177-250. MEDLINE Abstract

28 Pericak-Vance, M.A., Bale, A.E., Haines, J.L., Kwiatkowski, D.J., Pilz, A., Slaugenhaupt, S., White, J.A., Edwards, J.H., Marchuk, D., Olopade, O.I., Attwood, J. and Povey, S. (1995) Report on the fourth international workshop on chromosome 9. Ann. Hum. Genet., 59, 347-391.

29 Albertsen, H.M., Abderrahim, H., Cann, H.M., Dausset, J., Le Paslier, D. and Cohen, D. (1990) Construction and characterization of a yeast artificial chromosome library containing seven haploid human genome equivalents. Proc. Natl Acad. Sci. USA, 87, 4256-4260. MEDLINE Abstract

30 Anand, R., Riley, J.H., Butler, R., Smith, J.C. and Markham, A.F. (1990) A 3.5 genome equivalent multi access YAC library: construction, characterization, screening and storage. Nucleic Acids Res., 18, 1951-1956. MEDLINE Abstract

31 National Institute of Health (1994) 1994/1995 Catalog of Cell Lines-NIGMS Human Genetic Mutant Cell Repository. National Institute of General Medical Sciences.

32 Wu, Q., Possati, L., Montesi, M., Gualandi, F., Rimessi, P., Morelli, C., Trabanelli, C. and Barbanti-Brodano, G. (1996) Growth arrest and suppression of tumorigenicity of bladder-carcinoma cell lines induced by the P16/CDKN2 (p16INK4A, MTS1) gene and other loci on human chromosome 9. Int. J. Cancer, 65, 840-846. MEDLINE Abstract

33 Gemmill, R.M., Chumakov, I., Scott, P., Waggoner, B., Rigault, P., Cypser, J., Chen, Q., Weissenbach, J., Gardiner, K., Wang, H., et al. (1995) A second-generation YAC contig map of human chromosome 3. Nature, 377, 299-319. MEDLINE Abstract

34 Chaplin, D.D. and Brownstein, B.H. (1995) In Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (eds), Current Protocols in Molecular Biology. John Wiley and Sons, Inc., pp. 6.9.1-6.10.16.

35 Riley, J., Butler, R., Ogilivie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J.C. and Markham, A.F. (1990) A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res., 18, 2887-2890. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +44 01883 722306; Fax:+44 01883 714375; Email: m.knowles@mcri.ac.uk

-->
This page is maintained by OUP admin. Last updated Mon May 12 18:10:04 BST 1997. Part of the OUP Journals World Wide Web service. Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 CarcinogenesisHome page
M. A. Knowles
Molecular subtypes of bladder cancer: Jekyll and Hyde or chalk and cheese?
Carcinogenesis, March 1, 2006; 27(3): 361 - 373.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
E. J. Chapman, P. Harnden, P. Chambers, C. Johnston, and M. A. Knowles
Comprehensive Analysis of CDKN2A Status in Microdissected Urothelial Cell Carcinoma Reveals Potential Haploinsufficiency, a High Frequency of Homozygous Co-deletion and Associations with Clinical Phenotype
Clin. Cancer Res., August 15, 2005; 11(16): 5740 - 5747.
[Abstract] [Full Text] [PDF]

Home page
 JDRHome page
E. Dabelsteen and S. Gao
ABO Blood-group Antigens in Oral Cancer
Journal of Dental Research, January 1, 2005; 84(1): 21 - 28.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pathol.Home page
M A Knowles
What we could do now: molecular pathology of bladder cancer
Mol. Pathol., August 1, 2001; 54(4): 215 - 221.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
S. Knuutila, Y. Aalto, K. Autio, A.-M. Bjorkqvist, W.'e. El-Rifai, S. Hemmer, T. Huhta, E. Kettunen, S. Kiuru-Kuhlefelt, M. L. Larramendy, et al.
DNA Copy Number Losses in Human Neoplasms
Am. J. Pathol., September 1, 1999; 155(3): 683 - 694.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
A. Hartmann, K. Moser, M. Kriegmair, A. Hofstetter, F. Hofstaedter, and R. Knuechel
Frequent Genetic Alterations in Simple Urothelial Hyperplasias of the Bladder in Patients with Papillary Urothelial Carcinoma
Am. J. Pathol., March 1, 1999; 154(3): 721 - 727.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (59)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Habuchi, T.
Right arrow Articles by Knowles, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Habuchi, T.
Right arrow Articles by Knowles, M. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?